Transcriptome Analysis Unveils That Exosomes Derived from M1-Polarized Microglia Induce Ferroptosis of Neuronal Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Culture and Polarization of BV2 Microglia
2.2. Identification of Polarized M1-BV2 Microglia
2.3. Extraction of Exosomes
2.4. Identification of Exosomes
2.4.1. Transmission Electron Microscopy Analysis
2.4.2. Nanoparticle Tracking Analysis
2.4.3. Western Blotting for Exosomes
2.5. RNA Isolation and High-Throughput Sequencing of Transcriptome
2.6. Metabolic Activity, Differentially Expressed Genes, and Functional Enrichment Analyses
2.7. Isolation and Culture of Primary Neuronal Cells
2.8. Identification of Primary Neuronal Cells
2.9. Labeling of BV2 Microglia-Derived Exosomes
2.10. Coculture of Neuronal Cells with Exosomes
2.11. Internalization of Exosomes
2.12. Protein Extraction and Western Blot Analysis
2.13. Measurement of Ferrous Iron and Lipid Peroxidation
2.13.1. Measurement of Lipid Peroxidation
2.13.2. Measurement of Intracellular and Mitochondrial Ferrous Iron
2.14. Statistical Analysis
3. Results
3.1. Characterization of Polarized M1-BV2 Microglia and Exosomes
3.2. Transcriptome Metabolic Analysis and DEG Identification
3.3. GO, KEGG, and GSEA Analyses
3.4. Characterization of Neuronal Cells and the Internalization of Exosomes by Neuronal Cells
3.5. M1-BV2 Exosomes Regulate the Expression of Ferroptosis Proteins
3.6. M1-BV2 Exosomes Increase Lipid Peroxidation and Ferrous Iron Levels in Neuronal Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cardona, A.E.; Huang, D.; Sasse, M.E.; Ransohoff, R.M. Isolation of murine microglial cells for RNA analysis or flow cytometry. Nat. Protoc. 2006, 1, 1947–1951. [Google Scholar] [CrossRef]
- Parkhurst, C.N.; Gan, W.B. Microglia dynamics and function in the CNS. Curr. Opin. Neurobiol. 2010, 20, 595–600. [Google Scholar] [CrossRef] [Green Version]
- Lawson, L.J.; Perry, V.H.; Dri, P.; Gordon, S. Heterogeneity in the distribution and morphology of microglia in the normal adult mouse brain. Neuroscience 1990, 39, 151–170. [Google Scholar] [CrossRef]
- Heneka, M.T. Microglia take centre stage in neurodegenerative disease. Nat. Rev. Immunol. 2019, 19, 79–80. [Google Scholar] [CrossRef]
- Hansen, D.V.; Hanson, J.E.; Sheng, M. Microglia in Alzheimer’s disease. J. Cell. Biol. 2018, 217, 459–472. [Google Scholar] [CrossRef]
- Andersen, M.S.; Bandres-Ciga, S.; Reynolds, R.H.; Hardy, J.; Ryten, M.; Krohn, L.; Gan-Or, Z.; Holtman, I.R.; Pihlstrom, L.; International Parkinson’s Disease Genomics, C. Heritability Enrichment Implicates Microglia in Parkinson’s Disease Pathogenesis. Ann. Neurol. 2021, 89, 942–951. [Google Scholar] [CrossRef] [PubMed]
- Frakes, A.E.; Ferraiuolo, L.; Haidet-Phillips, A.M.; Schmelzer, L.; Braun, L.; Miranda, C.J.; Ladner, K.J.; Bevan, A.K.; Foust, K.D.; Godbout, J.P.; et al. Microglia induce motor neuron death via the classical NF-kappaB pathway in amyotrophic lateral sclerosis. Neuron 2014, 81, 1009–1023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, Y.; Le, W. Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Mol. Neurobiol. 2016, 53, 1181–1194. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; He, D.; Bai, Y. Microglia-Mediated Inflammation and Neurodegenerative Disease. Mol. Neurobiol. 2016, 53, 6709–6715. [Google Scholar] [CrossRef] [PubMed]
- Lemaire, Q.; Raffo-Romero, A.; Arab, T.; Van Camp, C.; Drago, F.; Forte, S.; Gimeno, J.P.; Begard, S.; Colin, M.; Vizioli, J.; et al. Isolation of microglia-derived extracellular vesicles: Towards miRNA signatures and neuroprotection. J. Nanobiotechnol. 2019, 17, 119. [Google Scholar] [CrossRef]
- Ceccarelli, L.; Giacomelli, C.; Marchetti, L.; Martini, C. Microglia extracellular vesicles: Focus on molecular composition and biological function. Biochem. Soc. Trans. 2021, 49, 1779–1790. [Google Scholar] [CrossRef] [PubMed]
- Huotari, J.; Helenius, A. Endosome maturation. EMBO J. 2011, 30, 3481–3500. [Google Scholar] [CrossRef] [PubMed]
- Hill, A.F. Extracellular Vesicles and Neurodegenerative Diseases. J. Neurosci. 2019, 39, 9269–9273. [Google Scholar] [CrossRef]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reichert, C.O.; de Freitas, F.A.; Sampaio-Silva, J.; Rokita-Rosa, L.; Barros, P.L.; Levy, D.; Bydlowski, S.P. Ferroptosis Mechanisms Involved in Neurodegenerative Diseases. Int. J. Mol. Sci. 2020, 21, 8765. [Google Scholar] [CrossRef]
- Long, H.Z.; Zhou, Z.W.; Cheng, Y.; Luo, H.Y.; Li, F.J.; Xu, S.G.; Gao, L.C. The Role of Microglia in Alzheimer’s Disease From the Perspective of Immune Inflammation and Iron Metabolism. Front. Aging. Neurosci. 2022, 14, 888989. [Google Scholar] [CrossRef]
- Guo, M.; Wang, J.; Zhao, Y.; Feng, Y.; Han, S.; Dong, Q.; Cui, M.; Tieu, K. Microglial exosomes facilitate alpha-synuclein transmission in Parkinson’s disease. Brain 2020, 143, 1476–1497. [Google Scholar] [CrossRef]
- Fernandes, A.; Ribeiro, A.R.; Monteiro, M.; Garcia, G.; Vaz, A.R.; Brites, D. Secretome from SH-SY5Y APPSwe cells trigger time-dependent CHME3 microglia activation phenotypes, ultimately leading to miR-21 exosome shuttling. Biochimie 2018, 155, 67–82. [Google Scholar] [CrossRef]
- Sardar Sinha, M.; Ansell-Schultz, A.; Civitelli, L.; Hildesjo, C.; Larsson, M.; Lannfelt, L.; Ingelsson, M.; Hallbeck, M. Alzheimer’s disease pathology propagation by exosomes containing toxic amyloid-beta oligomers. Acta Neuropathol. 2018, 136, 41–56. [Google Scholar] [CrossRef] [Green Version]
- Asai, H.; Ikezu, S.; Tsunoda, S.; Medalla, M.; Luebke, J.; Haydar, T.; Wolozin, B.; Butovsky, O.; Kugler, S.; Ikezu, T. Depletion of microglia and inhibition of exosome synthesis halt tau propagation. Nat. Neurosci. 2015, 18, 1584–1593. [Google Scholar] [CrossRef]
- Henn, A.; Lund, S.; Hedtjarn, M.; Schrattenholz, A.; Porzgen, P.; Leist, M. The suitability of BV2 cells as alternative model system for primary microglia cultures or for animal experiments examining brain inflammation. ALTEX 2009, 26, 83–94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, X.; Showiheen, S.A.A.; Sun, A.R.; Crawford, R.; Xiao, Y.; Mao, X.; Prasadam, I. Exosomes Extraction and Identification. Methods Mol. Biol. 2019, 2054, 81–91. [Google Scholar] [CrossRef] [PubMed]
- Zhai, L.; Shen, H.; Sheng, Y.; Guan, Q. ADMSC Exo-MicroRNA-22 improve neurological function and neuroinflammation in mice with Alzheimer’s disease. J. Cell Mol. Med. 2021, 25, 7513–7523. [Google Scholar] [CrossRef] [PubMed]
- Cubuk, C.; Hidalgo, M.R.; Amadoz, A.; Rian, K.; Salavert, F.; Pujana, M.A.; Mateo, F.; Herranz, C.; Carbonell-Caballero, J.; Dopazo, J. Differential metabolic activity and discovery of therapeutic targets using summarized metabolic pathway models. NPJ. Syst. Biol. Appl. 2019, 5, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Green Version]
- Weyer, A.; Schilling, K. Developmental and cell type-specific expression of the neuronal marker NeuN in the murine cerebellum. J. Neurosci. Res. 2003, 73, 400–409. [Google Scholar] [CrossRef]
- Kirino, T.; Brightman, M.W.; Oertel, W.H.; Schmechel, D.E.; Marangos, P.J. Neuron-specific enolase as an index of neuronal regeneration and reinnervation. J. Neurosci. 1983, 3, 915–923. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Yang, J.; Yan, W.; Li, Y.; Shen, Z.; Asahara, T. Pretreatment of Cardiac Stem Cells With Exosomes Derived From Mesenchymal Stem Cells Enhances Myocardial Repair. J. Am. Heart. Assoc. 2016, 5. [Google Scholar] [CrossRef] [Green Version]
- Hood, J.L.; Pan, H.; Lanza, G.M.; Wickline, S.A.; Consortium for Translational Research in Advanced, I.; Nanomedicine. Paracrine induction of endothelium by tumor exosomes. Lab. Investig. 2009, 89, 1317–1328. [Google Scholar] [CrossRef] [Green Version]
- Gonciarz, R.L.; Collisson, E.A.; Renslo, A.R. Ferrous Iron-Dependent Pharmacology. Trends. Pharm. Sci. 2021, 42, 7–18. [Google Scholar] [CrossRef]
- Miotto, G.; Rossetto, M.; Di Paolo, M.L.; Orian, L.; Venerando, R.; Roveri, A.; Vuckovic, A.M.; Bosello Travain, V.; Zaccarin, M.; Zennaro, L.; et al. Insight into the mechanism of ferroptosis inhibition by ferrostatin-1. Redox. Biol. 2020, 28, 101328. [Google Scholar] [CrossRef] [PubMed]
- Drummen, G.P.; van Liebergen, L.C.; Op den Kamp, J.A.; Post, J.A. C11-BODIPY(581/591), an oxidation-sensitive fluorescent lipid peroxidation probe: (micro)spectroscopic characterization and validation of methodology. Free Radic. Biol. Med. 2002, 33, 473–490. [Google Scholar] [CrossRef] [PubMed]
- Stockwell, B.R.; Friedmann Angeli, J.P.; Bayir, H.; Bush, A.I.; Conrad, M.; Dixon, S.J.; Fulda, S.; Gascon, S.; Hatzios, S.K.; Kagan, V.E.; et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171, 273–285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hambright, W.S.; Fonseca, R.S.; Chen, L.; Na, R.; Ran, Q. Ablation of ferroptosis regulator glutathione peroxidase 4 in forebrain neurons promotes cognitive impairment and neurodegeneration. Redox. Biol. 2017, 12, 8–17. [Google Scholar] [CrossRef]
- Hanisch, U.K.; Kettenmann, H. Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci. 2007, 10, 1387–1394. [Google Scholar] [CrossRef]
- Saijo, K.; Glass, C.K. Microglial cell origin and phenotypes in health and disease. Nat. Rev. Immunol. 2011, 11, 775–787. [Google Scholar] [CrossRef]
- Faden, A.I.; Wu, J.; Stoica, B.A.; Loane, D.J. Progressive inflammation-mediated neurodegeneration after traumatic brain or spinal cord injury. Br. J. Pharmacol. 2016, 173, 681–691. [Google Scholar] [CrossRef] [Green Version]
- Loane, D.J.; Kumar, A. Microglia in the TBI brain: The good, the bad, and the dysregulated. Exp. Neurol. 2016, 275 Pt. 3, 316–327. [Google Scholar] [CrossRef] [Green Version]
- Saitgareeva, A.R.; Bulygin, K.V.; Gareev, I.F.; Beylerli, O.A.; Akhmadeeva, L.R. The role of microglia in the development of neurodegeneration. Neurol. Sci. 2020, 41, 3609–3615. [Google Scholar] [CrossRef]
- Devanney, N.A.; Stewart, A.N.; Gensel, J.C. Microglia and macrophage metabolism in CNS injury and disease: The role of immunometabolism in neurodegeneration and neurotrauma. Exp. Neurol. 2020, 329, 113310. [Google Scholar] [CrossRef]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, aau6977. [Google Scholar] [CrossRef] [PubMed]
- Hickman, S.; Izzy, S.; Sen, P.; Morsett, L.; El Khoury, J. Microglia in neurodegeneration. Nat. Neurosci. 2018, 21, 1359–1369. [Google Scholar] [CrossRef] [PubMed]
- Du, L.; Zhang, Y.; Chen, Y.; Zhu, J.; Yang, Y.; Zhang, H.L. Role of Microglia in Neurological Disorders and Their Potentials as a Therapeutic Target. Mol. Neurobiol. 2017, 54, 7567–7584. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zheng, Y.; Luo, Y.; Du, Y.; Zhang, X.; Fu, J. Curcumin inhibits LPS-induced neuroinflammation by promoting microglial M2 polarization via TREM2/TLR4/NF-kappaB pathways in BV2 cells. Mol. Immunol. 2019, 116, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Kong, J.; Du, Z.; Dong, L. Pinitol Prevents Lipopolysaccharide (LPS)-Induced Inflammatory Responses in BV2 Microglia Mediated by TREM2. Neurotox. Res. 2020, 38, 96–104. [Google Scholar] [CrossRef]
- Hirt, U.A.; Leist, M. Rapid, noninflammatory and PS-dependent phagocytic clearance of necrotic cells. Cell Death Differ. 2003, 10, 1156–1164. [Google Scholar] [CrossRef]
- Qin, Y.; Qiu, J.; Wang, P.; Liu, J.; Zhao, Y.; Jiang, F.; Lou, H. Impaired autophagy in microglia aggravates dopaminergic neurodegeneration by regulating NLRP3 inflammasome activation in experimental models of Parkinson’s disease. Brain Behav. Immun. 2021, 91, 324–338. [Google Scholar] [CrossRef]
- Pimenova, A.A.; Herbinet, M.; Gupta, I.; Machlovi, S.I.; Bowles, K.R.; Marcora, E.; Goate, A.M. Alzheimer’s-associated PU.1 expression levels regulate microglial inflammatory response. Neurobiol. Dis. 2021, 148, 105217. [Google Scholar] [CrossRef]
- Kim, R.E.; Shin, C.Y.; Han, S.H.; Kwon, K.J. Astaxanthin Suppresses PM2.5-Induced Neuroinflammation by Regulating Akt Phosphorylation in BV-2 Microglial Cells. Int. J. Mol. Sci. 2020, 21, 7227. [Google Scholar] [CrossRef]
- Sun, Y.; Chen, P.; Zhai, B.; Zhang, M.; Xiang, Y.; Fang, J.; Xu, S.; Gao, Y.; Chen, X.; Sui, X.; et al. The emerging role of ferroptosis in inflammation. Biomed. Pharm. 2020, 127, 110108. [Google Scholar] [CrossRef]
- Wang, F.; He, J.; Xing, R.; Sha, T.; Sun, B. Molecular mechanisms of ferroptosis and their role in inflammation. Int. Rev. Immunol. 2021, 1–11. [Google Scholar] [CrossRef]
- Qiu, Y.; Cao, Y.; Cao, W.; Jia, Y.; Lu, N. The Application of Ferroptosis in Diseases. Pharm. Res. 2020, 159, 104919. [Google Scholar] [CrossRef] [PubMed]
- Tuo, Q.Z.; Lei, P.; Jackman, K.A.; Li, X.L.; Xiong, H.; Li, X.L.; Liuyang, Z.Y.; Roisman, L.; Zhang, S.T.; Ayton, S.; et al. Tau-mediated iron export prevents ferroptotic damage after ischemic stroke. Mol. Psychiatry 2017, 22, 1520–1530. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Kon, N.; Li, T.; Wang, S.J.; Su, T.; Hibshoosh, H.; Baer, R.; Gu, W. Ferroptosis as a p53-mediated activity during tumour suppression. Nature 2015, 520, 57–62. [Google Scholar] [CrossRef] [Green Version]
- Tian, Y.; Lu, J.; Hao, X.; Li, H.; Zhang, G.; Liu, X.; Li, X.; Zhao, C.; Kuang, W.; Chen, D.; et al. FTH1 Inhibits Ferroptosis Through Ferritinophagy in the 6-OHDA Model of Parkinson’s Disease. Neurotherapeutics 2020, 17, 1796–1812. [Google Scholar] [CrossRef] [PubMed]
- Friedman, A.; Arosio, P.; Finazzi, D.; Koziorowski, D.; Galazka-Friedman, J. Ferritin as an important player in neurodegeneration. Park. Relat. Disord. 2011, 17, 423–430. [Google Scholar] [CrossRef] [PubMed]
- Torti, F.M.; Torti, S.V. Regulation of ferritin genes and protein. Blood 2002, 99, 3505–3516. [Google Scholar] [CrossRef] [Green Version]
- Sammarco, M.C.; Ditch, S.; Banerjee, A.; Grabczyk, E. Ferritin L and H subunits are differentially regulated on a post-transcriptional level. J. Biol. Chem. 2008, 283, 4578–4587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, X.; Wang, H.; Han, D.; Xie, E.; Yang, X.; Wei, J.; Gu, S.; Gao, F.; Zhu, N.; Yin, X.; et al. Ferroptosis as a target for protection against cardiomyopathy. Proc. Natl. Acad. Sci. USA 2019, 116, 2672–2680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gan, B. Mitochondrial regulation of ferroptosis. J. Cell Biol. 2021, 220, e202105043. [Google Scholar] [CrossRef]
Gene | Forward, 5′ → 3′ | Reverse, 5′ → 3′ |
---|---|---|
IL-1β | TGACGGACCCCAAAAGATGA | CTTGTTGATGTGCTGCTGCG |
IL-6 | GGATACCACTCCCAACAGACC | TGTTTTCTGCAAGTGCATCATCG |
TNF-α | CGTCAGCCGATTTGCTATCT | CCTCAGGGAAGAATCTGGAAAG |
GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, S.; Jia, S.; Bai, L.; Li, D.; Meng, C. Transcriptome Analysis Unveils That Exosomes Derived from M1-Polarized Microglia Induce Ferroptosis of Neuronal Cells. Cells 2022, 11, 3956. https://doi.org/10.3390/cells11243956
Gao S, Jia S, Bai L, Li D, Meng C. Transcriptome Analysis Unveils That Exosomes Derived from M1-Polarized Microglia Induce Ferroptosis of Neuronal Cells. Cells. 2022; 11(24):3956. https://doi.org/10.3390/cells11243956
Chicago/Turabian StyleGao, Sheng, Shu Jia, Luyue Bai, Dongru Li, and Chunyang Meng. 2022. "Transcriptome Analysis Unveils That Exosomes Derived from M1-Polarized Microglia Induce Ferroptosis of Neuronal Cells" Cells 11, no. 24: 3956. https://doi.org/10.3390/cells11243956
APA StyleGao, S., Jia, S., Bai, L., Li, D., & Meng, C. (2022). Transcriptome Analysis Unveils That Exosomes Derived from M1-Polarized Microglia Induce Ferroptosis of Neuronal Cells. Cells, 11(24), 3956. https://doi.org/10.3390/cells11243956