The Intranigral Infusion of Human-Alpha Synuclein Oligomers Induces a Cognitive Impairment in Rats Associated with Changes in Neuronal Firing and Neuroinflammation in the Anterior Cingulate Cortex
Abstract
:1. Introduction
2. Materials and Methods
2.1. Expression and Purification of Recombinant Human αSyn (H-αSyn)
2.2. Purification of H-αSyn Oligomers
2.3. Animals and Stereotaxic Surgery
2.4. Behavioral Tests
2.4.1. Two-Trial Recognition Test in a Y Maze
2.4.2. Novel Object Recognition Test
2.5. Immunohistochemistry
2.6. Cresyl Violet Staining
2.7. Fluorescence Microscopy Analysis
2.8. In Vivo Single Unit Recordings from the ACC
2.9. RNA Isolation, Library Preparation and Sequencing
2.10. RNAseq Data Analysis
2.11. Reverse Transcription-Quantitative PCR (RT-qPCR)
- Gapdh: Fw 5′GGCTGCCTTCTCTTGTGACA 3′-Rev 5′ TGAACTTGCCGTGGGTAGAG 3′
- β-Actin: Fw 5′ TCAACACCCCAGCCATGTAC 3′-Rev 5′ TCCGGAGTCCATCACAATGC 3′
- Npas4: Fw 5′ ATCAGTGACACGGAAGCCTG 3′-Rev 5′ AGCTGGGGTTCCTAGGACAT 3′
- Npas4: Fw 5′ GATCGCCTTTTCCGTTGTCG3′-Rev 5′ CAGGTGGGTGAGCATGGAAT 3′.
2.12. Statistical Analysis
3. Results
3.1. The Intranigral H-αSynOs Infusion Induced a Cognitive Impairment
3.2. H-αsynOs Infusion Altered Neuronal Activity in the ACC
3.3. Npas4 Expression was Downregulated after H-αsynOs Infusion in Both the ACC and Hippocampus
3.4. The Cognitive Impairment Induced by H-αSynOs Infusion was Associated with a Dysregulated Glial Activity in ACC and Hippocampus
3.4.1. Iba-I Immunofluorescence
3.4.2. TNF-α Immunofluorescence
3.4.3. GFAP Immunofluorescence
3.4.4. GluR1 Immunofluorescence
3.5. P129-αSyn Aggregates were Detected along the Nigrostriatal Pathway
4. Discussion
4.1. The Intranigral Infusion of H-αSynOs Induced a Cognitive Decline and Suppressed Cortical Activity
4.2. The Intranigral Infusion of H-αSynOs Induced a Neuroinflammatory Response in Cognition-Related Brain Regions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chaudhuri, K.R.; Healy, D.G.; Schapira, A.H.V. Non-motor symptoms of Parkinson’s disease: Diagnosis and management. Lancet Neurol. 2006, 5, 235–245. [Google Scholar] [CrossRef]
- Aarsland, D.; Batzu, L.; Halliday, G.M.; Geurtsen, G.J.; Ballard, C.; Chaudhuri, K.R.; Weintraub, D. Parkinson disease-associated cognitive impairment. Nat. Rev. Dis. Primers 2021, 7, 47. [Google Scholar] [CrossRef] [PubMed]
- Severiano e Sousa, C.; Fabbri, M.; Godinho, C.; Moiron Simões, R.; Chendo, I.; Coelho, M.; Pavão Martins, I.; Ferreira, J.J. Profile of cognitive impairment in late-stage Parkinson’s disease. Brain Behav. 2022, 12, e2537. [Google Scholar] [CrossRef]
- Williams-Gray, C.H.; Evans, J.R.; Goris, A.; Foltynie, T.; Ban, M.; Robbins, T.W.; Brayne, C.; Kolachana, B.S.; Weinberger, D.R.; Sawcer, S.J.; et al. The distinct cognitive syndromes of Parkinson’s disease: 5 year follow-up of the CamPaIGN cohort. Brain 2009, 132, 2958–2969. [Google Scholar] [CrossRef]
- Barone, P.; Aarsland, D.; Burn, D.; Emre, M.; Kulisevsky, J.; Weintraub, D. Cognitive impairment in nondemented Parkinson’s disease. Mov. Disord. 2011, 26, 2483–2495. [Google Scholar] [CrossRef] [PubMed]
- Williams-Gray, C.H.; Mason, S.L.; Evans, J.R.; Foltynie, T.; Brayne, C.; Robbins, T.W.; Barker, R. The CamPaIGN study of Parkinson’s disease: 10-year outlook in an incident population-based cohort. J. Neurol. Neurosurg. Psychiatry 2013, 84, 1258–1264. [Google Scholar] [CrossRef] [PubMed]
- Doorn, K.J.; Moors, T.; Drukarch, B.; van de Berg, W.D.; Lucassen, P.J.; van Dam, A.M. Microglial phenotypes and toll-like receptor 2 in the substantia nigra and hippocampus of incidental Lewy body disease cases and Parkinson’s disease patients. Acta Neuropathol. Commun. 2014, 2, 90. [Google Scholar]
- Kouli, A.; Camacho, M.; Allinson, K.; Williams-Gray, C.H. Neuroinflammation and protein pathology in Parkinson’s disease dementia. Acta Neuropathol. Commun. 2020, 8, 211. [Google Scholar] [CrossRef]
- Kövari, E.; Gold, G.; Herrmann, F.R.; Canuto, A.; Hof, P.R.; Bouras, C.; Giannakopoulos, P. Lewy body densities in the entorhinal and anterior cingulate cortex predict cognitive deficits in Parkinson’s disease. Acta Neuropathol. 2003, 106, 83–88. [Google Scholar] [CrossRef]
- Mattila, P.M.; Rinne, J.O.; Helenius, H.; Dickson, D.W.; Röyttä, M. Alpha-synuclein-immunoreactive cortical Lewy bodies are associated with cognitive impairment in Parkinson’s disease. Acta Neuropathol. 2000, 100, 285–290. [Google Scholar] [CrossRef]
- Compta, Y.; Parkkinen, L.; O’Sullivan, S.S.; Vandrovcova, J.; Holton, J.L.; Collins, C.; Lashley, T.; Kallis, C.; Williams, D.R.; de Silva, R.; et al. Lewy- and Alzheimer-type pathologies in Parkinson’s disease dementia: Which is more important? Brain 2011, 134, 1493–1505. [Google Scholar] [CrossRef] [PubMed]
- Braak, H.; Rüb, U.; Jansen Steur, E.N.H.; Del Tredici, K.; de Vos, R.A.I. Cognitive status correlates with neuropathologic stage in Parkinson disease. Neurology 2005, 64, 1404–1410. [Google Scholar] [CrossRef] [PubMed]
- Muslimovic, D.; Post, B.; Speelman, J.D.; Schmand, B. Cognitive profile of patients with newly diagnosed Parkinson disease. Neurology 2005, 65, 1239–1245. [Google Scholar] [CrossRef] [PubMed]
- Kuter, K.Z.; Cenci, M.A.; Carta, A.R. The role of glia in Parkinson’s disease, Emerging concepts and therapeutic applications. Prog. Brain Res. 2020, 252, 131–168. [Google Scholar]
- Edison, P.; Ahmed, I.; Fan, Z.; Hinz, R.; Gelosa, G.; Chaudhuri, K.R.; Walker, Z.; Turkheimer, F.E.; Brooks, D.J. Microglia, amyloid, and glucose metabolism in Parkinson’s disease with and without dementia. Neuropsychopharmacology 2013, 38, 938–949. [Google Scholar] [CrossRef]
- Imamura, K.; Hishikawa, N.; Sawada, M.; Nagatsu, T.; Yoshida, M.; Hashizume, Y. Distribution of major histocompatibility complex class II-positive microglia and cytokine profile of Parkinson’s disease brains. Acta Neuropathol. 2003, 106, 518–526. [Google Scholar] [CrossRef]
- Wilson, H.; Dervenoulas, G.; Pagano, G.; Tyacke, R.J.; Polychronis, S.; Myers, J.; Gunn, R.N.; Rabiner, E.A.; Nutt, D.; Politis, M. Imidazoline 2 binding sites reflecting astroglia pathology in Parkinson’s disease: An in vivo11C-BU99008 PET study. Brain 2019, 142, 3116–3128. [Google Scholar] [CrossRef]
- Shepherd, C.E.; Thiel, E.; McCann, H.; Harding, A.J.; Halliday, G.M. Cortical inflammation in Alzheimer disease but not dementia with Lewy bodies. Arch. Neurol. 2000, 57, 817–822. [Google Scholar] [CrossRef]
- Streit, W.J.; Xue, Q.-S. Microglia in dementia with Lewy bodies. Brain Behav. Immun. 2016, 55, 191–201. [Google Scholar] [CrossRef]
- Wijeyekoon, R.S.; Kronenberg-Versteeg, D.; Scott, K.M.; Hayat, S.; Kuan, W.L.; Evans, J.R.; Breen, D.P.; Cummins, G.; Jones, J.L.; Clatworthy, M.R.; et al. Peripheral innate immune and bacterial signals relate to clinical heterogeneity in Parkinson’s disease. Brain Behav. Immun. 2020, 87, 473–488. [Google Scholar] [CrossRef]
- Blank, T.; Prinz, M. Microglia as modulators of cognition and neuropsychiatric disorders. Glia 2013, 61, 62–70. [Google Scholar] [CrossRef] [PubMed]
- Parkhurst, C.N.; Yang, G.; Ninan, I.; Savas, J.N.; Yates, J.R., III; Lafaille, J.J.; Hempstead, B.L.; Littman, D.R.; Gan, W.B. Microglia promote learning-dependent synapse formation through brain-derived neurotrophic factor. Cell 2013, 155, 1596–1609. [Google Scholar] [CrossRef] [PubMed]
- Sipe, G.O.; Lowery, R.L.; Tremblay, M.-È.; Kelly, E.A.; Lamantia, C.E.; Majewska, A.K. Microglial P2Y12 is necessary for synaptic plasticity in mouse visual cortex. Nat. Commun. 2016, 7, 10905. [Google Scholar] [CrossRef] [PubMed]
- Boi, L.; Pisanu, A.; Greig, N.H.; Scerba, M.T.; Tweedie, D.; Mulas, G.; Fenu, S.; Carboni, E.; Spiga, S.; Carta, A.R. Immunomodulatory drugs alleviate L-dopa-induced dyskinesia in a rat model of Parkinson’s disease. Mov. Disord. 2019, 34, 1818–1830. [Google Scholar] [CrossRef] [PubMed]
- Carta, A.R.; Mulas, G.; Bortolanza, M.; Duarte, T.; Pillai, E.; Fisone, G.; Vozari, R.R.; Del-Bel, E. l-DOPA-induced dyskinesia and neuroinflammation: Do microglia and astrocytes play a role? Eur. J. Neurosci. 2017, 45, 73–91. [Google Scholar] [CrossRef]
- Beattie, E.C.; Stellwagen, D.; Morishita, W.; Bresnahan, J.C.; Ha, B.K.; Von Zastrow, M.; Beattie, M.S.; Malenka, R.C. Control of synaptic strength by glial TNFalpha. Science 2002, 295, 2282–2285. [Google Scholar] [CrossRef]
- Boi, L.; Pisanu, A.; Palmas, M.F.; Fusco, G.; Carboni, E.; Casu, M.A.; Satta, V.; Scherma, M.; Janda, E.; Mocci, I.; et al. Modeling Parkinson’s Disease Neuropathology and Symptoms by Intranigral Inoculation of Preformed Human α-Synuclein Oligomers. Int. J. Mol. Sci. 2020, 21, 8535. [Google Scholar] [CrossRef]
- Murgia, F.; Atzori, L.; Carboni, E.; Santoru, M.L.; Hendren, A.; Pisanu, A.; Caboni, P.; Boi, L.; Fusco, G.; Carta, A.R. Metabolomics Fingerprint Induced by the Intranigral Inoculation of Exogenous Human Alpha-Synuclein Oligomers in a Rat Model of Parkinson’s Disease. Int. J. Mol. Sci. 2020, 21, 6745. [Google Scholar] [CrossRef]
- Palmas, M.F.; Ena, A.; Burgaletto, C.; Casu, M.A.; Cantarella, G.; Carboni, E.; Etzi, M.; De Simone, A.; Fusco, G.; Cardia, M.C.; et al. Repurposing Pomalidomide as a Neuroprotective Drug, Efficacy in an Alpha-Synuclein-Based Model of Parkinson’s Disease. Neurotherapeutics 2022, 19, 305–324. [Google Scholar] [CrossRef]
- Carta, A.R.; Boi, L.; Pisanu, A.; Palmas, M.F.; Carboni, E.; De Simone, A. Advances in modelling alpha-synuclein-induced Parkinson’s diseases in rodents, Virus-based models versus inoculation of exogenous preformed toxic species. J. Neurosci. Methods 2020, 338, 108685. [Google Scholar] [CrossRef]
- Fusco, G.; Chen, S.W.; Williamson, P.T.F.; Cascella, R.; Perni, M.; Jarvis, J.A.; Cecchi, C.; Vandruscolo, M.; Chiti, F.; Cremades, N.; et al. Structural basis of membrane disruption and cellular toxicity by α-synuclein oligomers. Science 2017, 358, 1440–1443. [Google Scholar] [CrossRef] [PubMed]
- Cascella, R.; Perni, M.; Chen, S.W.; Fusco, G.; Cecchi, C.; Vendruscolo, M.; Chiti, F.; Dobson, C.M.; De Simone, A. Probing the Origin of the Toxicity of Oligomeric Aggregates of α-Synuclein with Antibodies. ACS Chem. Biol. 2019, 14, 1352–1362. [Google Scholar] [CrossRef] [PubMed]
- Paxinos, G.; Watson, C. The Rat Brain in Stereotaxic Coordinates: Hard Cover Edition; Elsevier: Amsterdam, The Netherlands, 2006. [Google Scholar]
- Dellu, F.; Mayo, W.; Cherkaoui, J.; Le Moal, M.; Simon, H. A two-trial memory task with automated recording: Study in young and aged rats. Brain Res. 1992, 588, 132–139. [Google Scholar] [CrossRef]
- Ferreira, D.G.; Temido-Ferreira, M.; Vicente Miranda, H.; Batalha, V.L.; Coelho, J.E.; Szegö, É.M.; Marques-Morgado, I.; Vaz, S.H.; Rhee, J.S.; Schmitz, M.; et al. α-synuclein interacts with PrP(C) to induce cognitive impairment through mGluR5 and NMDAR2B. Nat. Neurosci. 2017, 20, 1569–1579. [Google Scholar] [CrossRef] [PubMed]
- Spano, M.S.; Fadda, P.; Frau, R.; Fattore, L.; Fratta, W. Cannabinoid self-administration attenuates PCP-induced schizophrenia-like symptoms in adult rats. Eur. Neuropsychopharmacol. 2010, 20, 25–36. [Google Scholar] [CrossRef]
- Mulas, G.; Espa, E.; Fenu, S.; Spiga, S.; Cossu, G.; Pillai, E.; Carboni, E.; Simbula, G.; Jadžić, D.; Angius, F.; et al. Differential induction of dyskinesia and neuroinflammation by pulsatile versus continuous l-DOPA delivery in the 6-OHDA model of Parkinson’s disease. Exp. Neurol. 2016, 286, 83–92. [Google Scholar] [CrossRef]
- Au-Young, S.M.; Shen, H.; Yang, C.R. Medial prefrontal cortical output neurons to the ventral tegmental area (VTA) and their responses to burst-patterned stimulation of the VTA: Neuroanatomical and in vivo electrophysiological analyses. Synapse 1999, 34, 245–255. [Google Scholar] [CrossRef]
- Connors, B.W.; Gutnick, M.J. Intrinsic firing patterns of diverse neocortical neurons. Trends Neurosci. 1990, 13, 99–104. [Google Scholar] [CrossRef]
- Secci, M.E.; Mascia, P.; Sagheddu, C.; Beggiato, S.; Melis, M.; Borelli, A.C.; Tomasini, M.C.; Panlilio, L.V.; Schindler, C.W.; Tanda, G.; et al. Astrocytic Mechanisms Involving Kynurenic Acid Control Δ(9)-Tetrahydrocannabinol-Induced Increases in Glutamate Release in Brain Reward-Processing Areas. Mol. Neurobiol. 2019, 56, 3563–3575. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 18 June 2021).
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Leek, J.T. svaseq: Removing batch effects and other unwanted noise from sequencing data. Nucleic Acids Res. 2014, 42, e161. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Manchinu, M.F.; Pala, M.; Palmas, M.F.; Pisanu, A.; Carboni, E.; Carta, A.R. Transcriptomic profile of cognition-related areas in a alpha-synuclein-based rat model of Parkinson’s disease. In preparation.
- Aarsland, D.; Creese, B.; Politis, M.; Chaudhuri, K.R.; Ffytche, D.H.; Weintraub, D.; Ballard, C. Cognitive decline in Parkinson disease. Nat. Rev. Neurol. 2017, 13, 217–231. [Google Scholar] [CrossRef]
- Gracia, P.; Camino, J.D.; Volpicelli-Daley, L.; Cremades, N. Multiplicity of α-Synuclein Aggregated Species and Their Possible Roles in Disease. Int. J. Mol. Sci. 2020, 21, 8043. [Google Scholar] [CrossRef] [PubMed]
- Winner, B.; Jappelli, R.; Maji, S.K.; Desplats, P.A.; Boyer, L.; Aigner, S.; Hetzer, C.; Loher, T.; Vilar, M.; Campioni, S.; et al. In vivo demonstration that alpha-synuclein oligomers are toxic. Proc. Natl. Acad. Sci. USA 2011, 108, 4194–4199. [Google Scholar] [CrossRef]
- Peelaerts, W.; Bousset, L.; Van der Perren, A.; Moskalyuk, A.; Pulizzi, R.; Giugliano, M.; Van den Haute, C.; Melki, R.; Baekelandt, V. α-Synuclein strains cause distinct synucleinopathies after local and systemic administration. Nature 2015, 522, 340–344. [Google Scholar] [CrossRef]
- Tokuda, T.; Qureshi, M.M.; Ardah, M.T.; Vargese, S.; Shehab, S.A.S.; Kasai, T.; Ishigami, N.; Tamaoka, A.; Nakagawa, M.; El-Agnaf, O.M.A. Detection of elevated levels of α-synuclein oligomers in CSF from patients with Parkinson disease. Neurology 2010, 75, 1766–1772. [Google Scholar] [CrossRef]
- Sharon, R.; Bar-Joseph, I.; Frosch, M.P.; Walsh, D.M.; Hamilton, J.A.; Selkoe, D.J. The formation of highly soluble oligomers of alpha-synuclein is regulated by fatty acids and enhanced in Parkinson’s disease. Neuron 2003, 37, 583–595. [Google Scholar] [CrossRef]
- Majbour, N.K.; Vaikath, N.N.; Eusebi, P.; Chiasserini, D.; Ardah, M.; Varghese, S.; Haque, M.E.; Tokuda, T.; Auinger, P.; Calabresi, P.; et al. Longitudinal changes in CSF alpha-synuclein species reflect Parkinson’s disease progression. Mov. Disord. 2016, 31, 1535–1542. [Google Scholar] [CrossRef]
- Das, T.; Hwang, J.J.; Poston, K.L. Episodic recognition memory and the hippocampus in Parkinson’s disease: A review. Cortex 2019, 113, 191–209. [Google Scholar] [CrossRef] [PubMed]
- Calabresi, P.; Castrioto, A.; Di Filippo, M.; Picconi, B. New experimental and clinical links between the hippocampus and the dopaminergic system in Parkinson’s disease. Lancet Neurol. 2013, 12, 811–821. [Google Scholar] [CrossRef]
- Filippi, M.; Canu, E.; Donzuso, G.; Stojkovic, T.; Basaia, S.; Stankovic, I.; Tomic, A.; Markovic, V.; Petrovic, I.; Stefanova, E.; et al. Tracking Cortical Changes Throughout Cognitive Decline in Parkinson’s Disease. Mov. Disord. 2020, 35, 1987–1998. [Google Scholar] [CrossRef] [PubMed]
- Lewis, S.J.G.; Shine, J.M.; Duffy, S.; Halliday, G.; Naismith, S.L. Anterior cingulate integrity: Executive and neuropsychiatric features in Parkinson’s disease. Mov. Disord. 2012, 27, 1262–1267. [Google Scholar] [CrossRef]
- de Schipper, L.J.; van der Grond, J.; Marinus, J.; Henselmans, J.M.L.; van Hilten, J.J. Loss of integrity and atrophy in cingulate structural covariance networks in Parkinson’s disease. NeuroImage Clin. 2017, 15, 587–593. [Google Scholar] [CrossRef]
- Grossman, M.; Crino, P.; Reivich, M.; Stern, M.B.; Hurtig, H.I. Attention and sentence processing deficits in Parkinson’s disease: The role of anterior cingulate cortex. Cereb. Cortex 1992, 2, 513–525. [Google Scholar] [CrossRef]
- Gallagher, C.L.; Bell, B.; Palotti, M.; Oh, J.; Christian, B.T.; Okonkwo, O.; Sojkova, J.; Buyan-Dent, L.; Nickles, R.J.; Harding, S.J.; et al. Anterior cingulate dopamine turnover and behavior change in Parkinson’s disease. Brain Imaging Behav. 2015, 9, 821–827. [Google Scholar] [CrossRef]
- Spiegel, I.; Mardinly, A.R.; Gabel, H.W.; Bazinet, J.E.; Couch, C.H.; Tzeng, C.P.; Harmin, D.A.; Greenberg, M.E. Npas4 regulates excitatory-inhibitory balance within neural circuits through cell-type-specific gene programs. Cell 2014, 157, 1216–1229. [Google Scholar] [CrossRef]
- Sun, X.; Lin, Y. Npas4: Linking Neuronal Activity to Memory. Trends Neurosci. 2016, 39, 264–275. [Google Scholar] [CrossRef]
- Izco, M.; Blesa, J.; Verona, G.; Cooper, J.M.; Alvarez-Erviti, L. Glial activation precedes alpha-synuclein pathology in a mouse model of Parkinson’s disease. Neurosci. Res. 2021, 170, 330–340. [Google Scholar] [CrossRef]
- Kirik, D.; Rosenblad, C.; Burger, C.; Lundberg, C.; Johansen, T.E.; Muzyczka, N.; Mandel, R.J.; Björklund, A. Parkinson-like neurodegeneration induced by targeted overexpression of alpha-synuclein in the nigrostriatal system. J. Neurosci. 2002, 22, 2780–2791. [Google Scholar] [CrossRef] [PubMed]
- Luk, K.C.; Kehm, V.; Carroll, J.; Zhang, B.; O’Brien, P.; Trojanowski, J.Q.; Lee, V. M-Y. Pathological α-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 2012, 338, 949–953. [Google Scholar] [CrossRef]
- Sorrentino, Z.A.; Brooks, M.M.T.; Hudson, V., III; Rutheford, N.J.; Golde, T.E.; Giasson, B.I.; Chakrabarty, P. Intrastriatal injection of α-synuclein can lead to widespread synucleinopathy independent of neuroanatomic connectivity. Mol. Neurodegener. 2017, 12, 40. [Google Scholar] [CrossRef]
- Buell, A.K.; Galvagnion, C.; Gaspar, R.; Sparr, E.; Vendruscolo, M.; Knowles, T.P.J.; Linse, S.; Dobson, C.M. Solution conditions determine the relative importance of nucleation and growth processes in α-synuclein aggregation. Proc. Natl. Acad. Sci. USA 2014, 111, 7671–7676. [Google Scholar] [CrossRef] [PubMed]
- Danzer, K.M.; Haasen, D.; Karow, A.R.; Moussaud, S.; Habeck, M.; Giese, A.; Kretzschmar, H.; Hengerer, B.; Kostka, M. Different species of alpha-synuclein oligomers induce calcium influx and seeding. J. Neurosci. 2007, 27, 9220–9232. [Google Scholar] [CrossRef]
- Majbour, N.K.; Vaikath, N.N.; van Dijk, K.D.; Ardah, M.T.; Vargese, S.; Vesterager, L.B.; Montezinho, L.P.; Poole, S.; Safieh-Garabedian, B.; Tokuda, T.; et al. Oligomeric and phosphorylated alpha-synuclein as potential CSF biomarkers for Parkinson’s disease. Mol. Neurodegener. 2016, 11, 7. [Google Scholar] [CrossRef] [PubMed]
- Imamura, K.; Hishikawa, N.; Ono, K.; Suzuki, H.; Sawada, M.; Nagatsu, T.; Yoshida, M.; Hashizume, Y. Cytokine production of activated microglia and decrease in neurotrophic factors of neurons in the hippocampus of Lewy body disease brains. Acta Neuropathol. 2005, 109, 141–150. [Google Scholar] [CrossRef]
- Gerhard, A.; Pavese, N.; Hotton, G.; Turkheimer, F.; Es, M.; Hammers, A.; Eggert, K.; Oartel, W.; Banati, R.B.; Brooks, D.J. In vivo imaging of microglial activation with [11C](R)-PK11195 PET in idiopathic Parkinson’s disease. Neurobiol. Dis. 2006, 21, 404–412. [Google Scholar] [CrossRef]
- Ouchi, Y.; Yoshikawa, E.; Sekine, Y.; Futatsubashi, M.; Kanno, T.; Ogusu, T.; Torizuka, T. Microglial activation and dopamine terminal loss in early Parkinson’s disease. Ann. Neurol. 2005, 57, 168–175. [Google Scholar] [CrossRef]
- Dzamko, N.; Gysbers, A.; Perera, G.; Bahar, A.; Shankar, A.; Gao, J.; Fu, Y.H.; Halliday, G.M. Toll-like receptor 2 is increased in neurons in Parkinson’s disease brain and may contribute to alpha-synuclein pathology. Acta Neuropathol. 2017, 133, 303–319. [Google Scholar] [CrossRef]
- Nemutlu Samur, D.; Akçay, G.; Yıldırım, S.; Özkan, A.; Çeker, T.; Derin, N.; Tanrıöver, G.; Aslan, M.; Ağar, A.; Özbey, G. Vortioxetine ameliorates motor and cognitive impairments in the rotenone-induced Parkinson’s disease via targeting TLR-2 mediated neuroinflammation. Neuropharmacology 2022, 208, 108977. [Google Scholar] [CrossRef]
- Bittencourt, A.; Brum, P.O.; Ribeiro, C.T.; Gasparotto, J.; Bortolin, R.C.; de Vargas, A.R.; Heimfarth, L.; de Almeida, R.F.; Moreira, J.C.F.; de Oliveira, J.; et al. High fat diet-induced obesity causes a reduction in brain tyrosine hydroxylase levels and non-motor features in rats through metabolic dysfunction, neuroinflammation and oxidative stress. Nutr. Neurosci. 2022, 25, 1026–1040. [Google Scholar] [CrossRef] [PubMed]
- Fan, Z.; Aman, Y.; Ahmed, I.; Chetelat, G.; Landeau, B.; Chaudhuri, K.R.; Brooks, D.J.; Edison, P. Influence of microglial activation on neuronal function in Alzheimer’s and Parkinson’s disease dementia. Alzheimer’s Dement. 2015, 11, 608–621.e7. [Google Scholar] [CrossRef] [PubMed]
- Iannaccone, S.; Cerami, C.; Alessio, M.; Garibotto, V.; Panzacchi, A.; Olivieri, S.; Gelsomino, G.; Moresco, R.M.; Perani, D. In vivo microglia activation in very early dementia with Lewy bodies, comparison with Parkinson’s disease. Parkinsonism Relat. Disord. 2013, 19, 47–52. [Google Scholar] [CrossRef]
- Foo, H.; Mak, E.; Chander, R.J.; Ng, A.; Au, W.L.; Sitoh, Y.Y.; Tan, L.C.S.; Kandiah, N. Associations of hippocampal subfields in the progression of cognitive decline related to Parkinson’s disease. NeuroImage Clin. 2017, 14, 37–42. [Google Scholar] [CrossRef]
- Beyer, M.K.; Bronnick, K.S.; Hwang, K.S.; Bergsland, N.; Tysnes, O.B.; Larsen, J.P.; Thompson, P.M.; Somme, J.H.; Apostolova, L.G. Verbal memory is associated with structural hippocampal changes in newly diagnosed Parkinson’s disease. J. Neurol. Neurosurg. Psychiatry 2013, 84, 23–28. [Google Scholar] [CrossRef]
- Fixemer, S.; Ameli, C.; Hammer, G.; Salamanca, L.; Uriarte Huarte, O.; Schwartz, C.; Gérardy, J.J.; Mechawar, N.; Skupin, A.; Mittelbronn, M.; et al. Microglia phenotypes are associated with subregional patterns of concomitant tau, amyloid-β and α-synuclein pathologies in the hippocampus of patients with Alzheimer’s disease and dementia with Lewy bodies. Acta Neuropathol. Commun. 2022, 10, 36. [Google Scholar] [CrossRef]
- Klegeris, A.; Pelech, S.; Giasson, B.I.; Maguire, J.; Zhang, H.; McGeer, E.G.; McGeer, P.L. Alpha-synuclein activates stress signaling protein kinases in THP-1 cells and microglia. Neurobiol. Aging 2008, 29, 739–752. [Google Scholar] [CrossRef]
- Lee, E.-J.; Woo, M.-S.; Moon, P.-G.; Baek, M.-C.; Choi, I.-Y.; Kim, W.-K.; Junn, E.; Kim, H.-S. Alpha-synuclein activates microglia by inducing the expressions of matrix metalloproteinases and the subsequent activation of protease-activated receptor-1. J. Immunol. 2010, 185, 615–623. [Google Scholar] [CrossRef]
- Wilms, H.; Rosenstiel, P.; Romero-Ramos, M.; Arlt, A.; Schäfer, H.; Seegert, D.; Kahle, P.J.; Odoy, S.; Claasen, J.H.; Holzknecht, C.; et al. Suppression of MAP kinases inhibits microglial activation and attenuates neuronal cell death induced by alpha-synuclein protofibrils. Int. J. Immunopathol. Pharmacol. 2009, 22, 897–909. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, T.; Pei, Z.; Miller, D.S.; Wu, X.; Block, M.L.; Wilson, B.; Zhang, W.; Zhou, Y.; Hong, J.-S.; et al. Aggregated alpha-synuclein activates microglia: A process leading to disease progression in Parkinson’s disease. FASEB J. 2005, 19, 533–542. [Google Scholar] [CrossRef] [PubMed]
- Daniele, S.G.; Béraud, D.; Davenport, C.; Cheng, K.; Yin, H.; Maguire-Zeiss, K.A. Activation of MyD88-dependent TLR1/2 signaling by misfolded α-synuclein, a protein linked to neurodegenerative disorders. Sci. Signal. 2015, 8, ra45. [Google Scholar] [CrossRef]
- Kim, C.; Ho, D.-H.; Suk, J.-E.; You, S.; Michael, S.; Kang, J.; Lee, S.J.; Masliah, E.; Hwang, D.; Lee, H.-J.; et al. Neuron-released oligomeric α-synuclein is an endogenous agonist of TLR2 for paracrine activation of microglia. Nat. Commun. 2013, 4, 1562. [Google Scholar] [CrossRef] [PubMed]
- Balosso, S.; Ravizza, T.; Pierucci, M.; Calcagno, E.; Invernizzi, R.; Di Giovanni, G.; Esposito, E.; Vezzani, A. Molecular and functional interactions between tumor necrosis factor-alpha receptors and the glutamatergic system in the mouse hippocampus: Implications for seizure susceptibility. Neuroscience 2009, 161, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Lewitus, G.M.; Pribiag, H.; Duseja, R.; St-Hilaire, M.; Stellwagen, D. An adaptive role of TNFα in the regulation of striatal synapses. J. Neurosci. 2014, 34, 6146–6155. [Google Scholar] [CrossRef]
- Bauer, M.E.; Teixeira, A.L. Neuroinflammation in Mood Disorders: Role of Regulatory Immune Cells. Neuroimmunomodulation 2021, 28, 99–107. [Google Scholar] [CrossRef]
- Sama, D.M.; Mohmmad Abdul, H.; Furman, J.L.; Artiushin, I.A.; Szymkowski, D.E.; Scheff, S.W.; Norris, C. M. Inhibition of soluble tumor necrosis factor ameliorates synaptic alterations and Ca2+ dysregulation in aged rats. PLoS ONE 2012, 7, e38170. [Google Scholar] [CrossRef]
- Lecca, D.; Jung, Y.J.; Scerba, M.T.; Hwang, I.; Kim, Y.K.; Kim, S.; Modrow, S.; Tweedie, D.; Hsueh, S.-C.; Liu, D.; et al. Role of chronic neuroinflammation in neuroplasticity and cognitive function: A hypothesis. Alzheimer’s Dement. 2022, 1–14. [Google Scholar] [CrossRef]
- Tweedie, D.; Ferguson, R.A.; Fishman, K.; Frankola, K.A.; Van Praag, H.; Holloway, H.W.; Luo, W.; Li, Y.; Caracciolo, L.; Russo, I.; et al. Tumor necrosis factor-α synthesis inhibitor 3,6’-dithiothalidomide attenuates markers of inflammation, Alzheimer pathology and behavioral deficits in animal models of neuroinflammation and Alzheimer’s disease. J. Neuroinflammation 2012, 9, 106. [Google Scholar] [CrossRef]
- Butler, M.P.; O’Connor, J.J.; Moynagh, P.N. Dissection of tumor-necrosis factor-alpha inhibition of long-term potentiation (LTP) reveals a p38 mitogen-activated protein kinase-dependent mechanism which maps to early-but not late-phase LTP. Neuroscience 2004, 124, 319–326. [Google Scholar] [CrossRef]
- Ekdahl, C.T.; Claasen, J.-H.; Bonde, S.; Kokaia, Z.; Lindvall, O. Inflammation is detrimental for neurogenesis in adult brain. Proc. Natl. Acad. Sci. USA 2003, 100, 13632–13637. [Google Scholar] [CrossRef] [PubMed]
- Tancredi, V.; D’Arcangelo, G.; Grassi, F.; Tarroni, P.; Palmieri, G.; Santoni, A.; Eusebi, F. Tumor necrosis factor alters synaptic transmission in rat hippocampal slices. Neurosci. Lett. 1992, 146, 176–178. [Google Scholar] [CrossRef]
- Wang, Q.; Wu, J.; Rowan, M.J.; Anwyl, R. Beta-amyloid inhibition of long-term potentiation is mediated via tumor necrosis factor. Eur. J. Neurosci. 2005, 22, 2827–2832. [Google Scholar] [CrossRef] [PubMed]
- Ganai, A.A.; Husain, M. Genistein Alleviates Neuroinflammation and Restores Cognitive Function in Rat Model of Hepatic Encephalopathy: Underlying Mechanisms. Mol. Neurobiol. 2018, 55, 1762–1772. [Google Scholar] [CrossRef] [PubMed]
ACC (Iba-1 IR; Volume/mm3) | | ||
Veh | H-αSynOs | ||
III layer | 318.4 ± 23.02 | 357.1 ± 25.25 | |
V layer | 348.6 ± 24.80 | 380.2 ± 26.42 | |
Dorsal Hippocampus (Iba-1 IR; Volume/mm3) | |||
Veh | H-αSynOs | ||
DG (GCL) | 335.2 ± 16.68 | 348.6 ± 22.24 | |
DG (hilus) | 320.8 ± 16.53 | 387.2 ± 20.30 * | |
CA3 (pyramidal layer) | 280.8 ± 18.75 | 249.7 ± 16.52 | |
CA1 (pyramidal layer) | 463.1 ± 28.13 | 600.5 ± 30.42 ** | |
CA1 (stratum radiatum) | 564.2 ± 28.49 | 644.5 ± 39.35 | |
CA1 (stratum moleculare) | 899.7 ± 40.77 | 843.6 ± 44.55 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Palmas, M.F.; Etzi, M.; Pisanu, A.; Camoglio, C.; Sagheddu, C.; Santoni, M.; Manchinu, M.F.; Pala, M.; Fusco, G.; De Simone, A.; et al. The Intranigral Infusion of Human-Alpha Synuclein Oligomers Induces a Cognitive Impairment in Rats Associated with Changes in Neuronal Firing and Neuroinflammation in the Anterior Cingulate Cortex. Cells 2022, 11, 2628. https://doi.org/10.3390/cells11172628
Palmas MF, Etzi M, Pisanu A, Camoglio C, Sagheddu C, Santoni M, Manchinu MF, Pala M, Fusco G, De Simone A, et al. The Intranigral Infusion of Human-Alpha Synuclein Oligomers Induces a Cognitive Impairment in Rats Associated with Changes in Neuronal Firing and Neuroinflammation in the Anterior Cingulate Cortex. Cells. 2022; 11(17):2628. https://doi.org/10.3390/cells11172628
Chicago/Turabian StylePalmas, Maria Francesca, Michela Etzi, Augusta Pisanu, Chiara Camoglio, Claudia Sagheddu, Michele Santoni, Maria Francesca Manchinu, Mauro Pala, Giuliana Fusco, Alfonso De Simone, and et al. 2022. "The Intranigral Infusion of Human-Alpha Synuclein Oligomers Induces a Cognitive Impairment in Rats Associated with Changes in Neuronal Firing and Neuroinflammation in the Anterior Cingulate Cortex" Cells 11, no. 17: 2628. https://doi.org/10.3390/cells11172628
APA StylePalmas, M. F., Etzi, M., Pisanu, A., Camoglio, C., Sagheddu, C., Santoni, M., Manchinu, M. F., Pala, M., Fusco, G., De Simone, A., Picci, L., Mulas, G., Spiga, S., Scherma, M., Fadda, P., Pistis, M., Simola, N., Carboni, E., & Carta, A. R. (2022). The Intranigral Infusion of Human-Alpha Synuclein Oligomers Induces a Cognitive Impairment in Rats Associated with Changes in Neuronal Firing and Neuroinflammation in the Anterior Cingulate Cortex. Cells, 11(17), 2628. https://doi.org/10.3390/cells11172628