Functional Recellularization of Acellular Rat Liver Scaffold by Induced Pluripotent Stem Cells: Molecular Evidence for Wnt/B-Catenin Upregulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Experimental Design and Treatment Protocol
- Group I (control group; n = 7): Following sacrifice, livers were dissected and processed for analysis without any intervention.
- Group II (decellularized group; n = 7): Following sacrifice, livers were surgically removed with preservation of portal vein, inferior vena cava, and bile duct. Livers were immediately decellularized by perfusion.
- Group III (recellularized groups; n = 21): Following sacrifice, livers were surgically removed, as above, and then decellularised by perfusion. Following decellularization, liver bioscaffolds were seeded with iPSCs (6 × 106 at 4 mL/min flow) then equally divided into three groups with different culture periods:
- (a)
- Subgroup IIIa: 4 days of the recellularization process.
- (b)
- Subgroup IIIb: 14 days of the recellularization process.
- (c)
- Subgroup IIIc: 24 days of the recellularization process.
2.3. Surgical Procedure for Liver Harvesting
2.4. Bioreactor Perfusion System
2.5. Whole-Organ Liver Decellularization
2.6. Measurement of DNA Content
2.7. Glycosaminoglycan (GAGs) Assay
2.7.1. iPS Cells (iPSCs) Generation
2.7.2. In Vitro Pluripotency Assay—Embryoid Body Formation and Spontaneous Differentiation
2.8. Perfusion Recellularized Liver Bioreactor
2.8.1. Differentiation of iPSCs into Hepatocytes within the 3D Acellular Liver Bio-Scaffold
- Stage 1 (endodermal induction). The iPSCs were initially perfused within a media consisting of RPMI (Invitrogen, Carlsbad, CA, USA), 0.5% Penicillin/Streptomycin (Millipore, Billerica, MA, USA), 1X B-27 w/o insulin supplement (Invitrogen, Carlsbad, CA, USA), 0.5% Non-Essential Amino Acids (Millipore, Billerica, MA, USA), 10 ng/mL BMP4 (R&D Systems, Minneapolis, MN, USA), 100 ng/mL Activin A (R&D Systems, Minneapolis, MN, USA), and 20 ng/mL FGF2 (BD, Franklin Lakes, NJ, USA) for 2 days. After 48 h the perfused media was switched to one without FGF2 and BMP4 for a further 2 days; at this stage, the population is considered as iPS-Heps cells. (Stage 2, definitive endoderm).
- Stage 3 (hepatic specification): The iPS Heps cells were then perfused for a further 10 days within a defined medium containing 45% DMEM low glucose 1 g/L (ThermoFisher Scientific, Waltham, MA, USA), 10% CTS KnockOut SR XenoFree Medium (ThermoFisher Scientific, Waltham, MA, USA), 45% F-12 (ThermoFisher Scientific, Waltham, MA, USA), 0.5% Non-Essential Amino Acids (ThermoFisher Scientific, Waltham, MA, USA), 50 ng/mL HGF (Kindly provided by George Michalopoulos) 0.5% L-glutamine (ThermoFisher Scientific, Waltham, MA, USA), and 1% DMSO (Sigma-Aldrich, Saint Louis, MO, USA). The medium was changed every 48 h.
- Stage 4 (hepatocytes maturation): Following the specification, the cultured iPS-Heps were maintained under perfusion within acellular bio-scaffolds for a further 10 days. Maturation media consisted of specification media further supplemented with 0.1% of Gentamicin/Amphotericin-B (ThermoFisher Scientific, Waltham, MA, USA), 1% of Penicillin/Streptomycin (ThermoFisher Scientific, Waltham, MA, USA), 0.1% of Ascorbic Acid (Sigma-Aldrich, Saint Louis, MO, USA), 0.5 µM Dexamethasone (Sigma-Aldrich, Saint Louis, MO, USA), 0.1% of Bovine Serum Albumin Free of Fatty Acids, 0.1% of Transferrin, 0.1% of Hydrocortisone, 0.1% of Insulin (HCM Bullet Kit, ThermoFisher Scientific, Waltham, MA, USA), 20 µM of Palmitic Acid (Sigma-Aldrich, Saint Louis, MO, USA), 100 µM of Urso deoxycolic acid (Sigma-Aldrich, Saint Louis, MO, USA), 30 µM of Oleic Acid (Sigma-Aldrich, Saint Louis, MO, USA), 1× of Cholesterol and 20 µM of Rifampicin (Sigma-Aldrich, Saint Louis, Missouri) (ThermoFisher Scientific, Waltham, MA, USA).
2.8.2. Detection of Albumin and Urea
2.9. Quantitative Real-Time PCR (RT-PCR)
- Initiation stage (endodermal specification): FOXA1, Forkhead Box A1; FOXA2, Forkhead Box A2; SOX17, SRY-Box Transcription Factor 17.
- Hepatoblasts specification: Wnt ligands (Wnt 1, 2 3a, 7b, 10b), HHEX, Hematopoietically expressed homeobox; HLX, H2.0-like homeobox; Prox1, Prospero homeobox 1, FGF2, Fibroblast growth factor 2; BMP4, Bone Morphogenetic Protein 4; HGF, Hepatocyte Growth Factor; FGF4, Fibroblast growth factor 4; EGF, Epidermal growth factor; TGF-β, Transforming Growth Factor Beta 1; ALB, Albumin; AFP, Alpha-fetoprotein; CK19, Cytokeratin 19.
- Hepatocytes specification & maturation: C/EBPα, CCAAT/enhancer-binding protein alpha; HNF4a, Hepatocyte nuclear factor 4, alpha; PECAM1, platelet and endothelial cell adhesion molecule 1; EpCAM, Epithelial cell adhesion molecule; Beta-actin; miR122; miR148a; miR194; U6 RNA) were purchased from Genwez (South Plainfield, NJ, USA) (Table 1).
2.10. Protein Analysis of ECM Competent and Growth Factors of Decellularized Bio-Scaffolds besides Protein Analysis of β-Catenin after Recellularization of 3D Bio-Scaffolds
2.11. Histological Study
2.12. Morphometric Study
2.13. Scanning Electron Microscopy
2.14. Statistical Analysis
3. Results
3.1. Whole-Organ Rat Liver Decellularization and Characterization
3.2. iPSCs Derivation and Characterization before Scaffold Implantation
3.3. Recellularized Rat Liver Scaffold Characterization
3.4. Albumin and Urea Secretion by Recellularised Livers
3.5. Protein Expression of Albumin, AFP and β-Catenin
3.6. Histological Analysis of Recellularized Liver Bio-Scaffolds
3.6.1. Light Microscopy
Hematoxylin and Eosin Staining
Masson’s Trichrome
3.6.2. Ultrastructure Highlights the Capability of Perfused iPSCs to Differentiate and Recellularize the 3D Acellular Bio-Scaffolds with Hepatocyte Property Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Limitation
References
- Brown, R.S., Jr. Live donors in liver transplantation. Gastroenterology 2008, 134, 1802–1813. [Google Scholar] [CrossRef] [Green Version]
- Leung, P.S. Local RAS. In The Renin-Angiotensin System: Current Research Progress in the Pancreas; Springer Science & Business Media: Berlin/Heidelberg, Germany.
- Croce, S.; Peloso, A.; Zoro, T.; Avanzini, M.A.; Cobianchi, L. A hepatic scaffold from decellularized liver tissue: Food for thought. Biomolecules 2019, 9, 813. [Google Scholar] [CrossRef] [Green Version]
- Murray, K.F.; Carithers, R.L., Jr. AASLD practice guidelines: Evaluation of the patient for liver transplantation. Hepatology 2005, 41, 1407–1432. [Google Scholar] [CrossRef] [PubMed]
- Fishman, J.A.; Rubin, R.H. Infection in organ-transplant recipients. N. Engl. J. Med. 1998, 338, 1741–1751. [Google Scholar] [CrossRef] [PubMed]
- Fishman, J.A. Infection in solid-organ transplant recipients. N. Engl. J. Med. 2007, 357, 2601–2614. [Google Scholar] [CrossRef] [Green Version]
- Ye, J.; Su, X.; Stoltz, J.; de Isla, N.; Zhang, L. Signalling pathways involved in the process of mesenchymal stem cells differentiating into hepatocytes. Cell Prolif. 2015, 48, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Sellaro, T.L.; Ranade, A.; Faulk, D.M.; McCabe, G.P.; Dorko, K.; Badylak, S.F.; Strom, S.C. Maintenance of human hepatocyte function in vitro by liver-derived extracellular matrix gels. Tissue Eng. Part A 2010, 16, 1075–1082. [Google Scholar] [CrossRef] [Green Version]
- Sérandour, A.; Loyer, P.; Garnier, D.; Courselaud, B.; Théret, N.; Glaise, D.; Guguen-Guillouzo, C.; Corlu, A. TNFα-mediated extracellular matrix remodeling is required for multiple division cycles in rat hepatocytes. Hepatology 2005, 41, 478–486. [Google Scholar] [CrossRef]
- Hammond, J.S.; Gilbert, T.W.; Howard, D.; Zaitoun, A.; Michalopoulos, G.; Shakesheff, K.M.; Beckingham, I.J.; Badylak, S.F. Scaffolds containing growth factors and extracellular matrix induce hepatocyte proliferation and cell migration in normal and regenerating rat liver. J. Hepatol. 2011, 54, 279–287. [Google Scholar] [CrossRef]
- Bauer, A.L.; Jackson, T.L.; Jiang, Y. Topography of extracellular matrix mediates vascular morphogenesis and migration speeds in angiogenesis. PLoS Comput. Biol. 2009, 5, e1000445. [Google Scholar] [CrossRef] [Green Version]
- Lang, R.; Stern, M.M.; Smith, L.; Liu, Y.; Bharadwaj, S.; Liu, G.; Baptista, P.M.; Bergman, C.R.; Soker, S.; Yoo, J.J.; et al. Three-dimensional culture of hepatocytes on porcine liver tissue-derived extracellular matrix. Biomaterials 2011, 32, 7042–7052. [Google Scholar] [CrossRef]
- Baptista, P.M.; Vyas, D.; Moran, E.; Wang, Z.; Soker, S. Human liver bioengineering using a whole liver decellularized bioscaffold. In Organ Regeneration; Springer: Berlin/Heidelberg, Germany, 2013; pp. 289–298. [Google Scholar]
- Takeishi, K.; de l’Hortet, A.C.; Wang, Y.; Handa, K.; Guzman-Lepe, J.; Matsubara, K.; Morita, K.; Jang, S.; Haep, N.; Florentino, R.M.; et al. Assembly and function of a bioengineered human liver for transplantation generated solely from induced pluripotent stem cells. Cell Rep. 2020, 31, 107711. [Google Scholar] [CrossRef] [PubMed]
- Carpentier, A.; Nimgaonkar, I.; Chu, V.; Xia, Y.; Hu, Z.; Liang, T.J. Hepatic differentiation of human pluripotent stem cells in miniaturized format suitable for high-throughput screen. Stem Cell Res. 2016, 16, 640–650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Minami, T.; Ishii, T.; Yasuchika, K.; Fukumitsu, K.; Ogiso, S.; Miyauchi, Y.; Kojima, H.; Kawai, T.; Yamaoka, R.; Oshima, Y.; et al. Novel hybrid three-dimensional artificial liver using human induced pluripotent stem cells and a rat decellularized liver scaffold. Regen. Ther. 2019, 10, 127–133. [Google Scholar] [CrossRef]
- Shen, M.M. Nodal signaling: Developmental roles and regulation. Development 2007, 134, 1023–1034. [Google Scholar] [CrossRef] [Green Version]
- Zorn, A.M.; Wells, J.M. Molecular basis of vertebrate endoderm development. Int. Rev. Cytol. 2007, 259, 49–111. [Google Scholar]
- Apte, U.; Zeng, G.; Muller, P.; Tan, X.; Micsenyi, A.; Cieply, B.; Dai, C.; Liu, Y.; Kaestner, K.H.; Monga, S.P.S. Activation of Wnt/β-catenin pathway during hepatocyte growth factor–induced hepatomegaly in mice. Hepatology 2006, 44, 992–1002. [Google Scholar] [CrossRef] [PubMed]
- Sate, F.; Mitaka, T.; Mizuguchi, T.; Mochizuki, Y.; Hirata, K. Effects of nicotinamide-related agents on the growth of primary rat hepatocytes and formation of small hepatocyte colonies. Liver 1999, 19, 481–488. [Google Scholar] [CrossRef] [PubMed]
- Nejak-Bowen, K.; Monga, S.P.S. Wnt/β-catenin signaling in hepatic organogenesis. Organogenesis 2008, 4, 92–99. [Google Scholar] [CrossRef] [Green Version]
- Yagi, H.; Fukumitsu, K.; Fukuda, K.; Kitago, M.; Shinoda, M.; Obara, H.; Itano, O.; Kawachi, S.; Tanabe, M.; Coudriet, G.M.; et al. Human-scale whole-organ bioengineering for liver transplantation: A regenerative medicine approach. Cell Transplant. 2013, 22, 231–242. [Google Scholar] [CrossRef] [Green Version]
- Gilbert, T.W.; Freund, J.M.; Badylak, S.F. Quantification of DNA in biologic scaffold materials. J. Surg. Res. 2009, 152, 135–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okita, K.; Matsumura, Y.; Sato, Y.; Okada, A.; Morizane, A.; Okamoto, S.; Hong, H.; Nakagawa, M.; Tanabe, K.; Tezuka, K.; et al. A more efficient method to generate integration-free human iPS cells. Nat. Methods 2011, 8, 409–412. [Google Scholar] [CrossRef] [Green Version]
- Abdelatty, A.M.; Mandouh, M.I.; Mohamed, S.A.; Busato, S.; Badr, O.A.M.; Bionaz, M.; Elolimy, A.A.; Moustafa, M.M.A.; Farid, O.A.A.; Al-Mokaddem, A.K. Azolla leaf meal at 5% of the diet improves growth performance, intestinal morphology and p70S6K1 activation, and affects cecal microbiota in broiler chicken. Animal 2021, 15, 100362. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Daly, A.B.; Wallis, J.M.; Borg, Z.D.; Bonvillain, R.W.; Deng, B.; Ballif, B.A.; Jaworski, D.M.; Allen, G.B.; Weiss, D.J. Initial binding and recellularization of decellularized mouse lung scaffolds with bone marrow-derived mesenchymal stromal cells. Tissue Eng. Part A 2012, 18, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Wu, Q.; Wang, Y.; Li, L.; Chen, F.; Shi, Y.; Bao, J.; Bu, H. Construction of bioengineered hepatic tissue derived from human umbilical cord mesenchymal stem cells via aggregation culture in porcine decellularized liver scaffolds. Xenotransplantation 2017, 24, e12285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bancroft, J.D.; Layton, C. Connective and other mesenchymal tissues with their stains. In Bancroft’s Theory and Practice Histological Techniques E-Book; Churchill Livingstone; Elsevier: Philadelphia, PA, USA, 2018; p. 153. [Google Scholar]
- Wu, Q.; Bao, J.; Zhou, Y.; Wang, Y.; Du, Z.; Shi, Y.; Li, L.; Bu, H. Optimizing perfusion-decellularization methods of porcine livers for clinical-scale whole-organ bioengineering. Biomed Res. Int. 2015, 2015, 785474. [Google Scholar] [CrossRef]
- Jiang, W.-C.; Cheng, Y.-H.; Yen, M.-H.; Chang, Y.; Yang, V.W.; Lee, O.K. Cryo-chemical decellularization of the whole liver for mesenchymal stem cells-based functional hepatic tissue engineering. Biomaterials 2014, 35, 3607–3617. [Google Scholar] [CrossRef] [Green Version]
- Ko, I.K.; Peng, L.; Peloso, A.; Smith, C.J.; Dhal, A.; Deegan, D.B.; Zimmerman, C.; Clouse, C.; Zhao, W.; Shupe, T.D. Bioengineered transplantable porcine livers with re-endothelialized vasculature. Biomaterials 2015, 40, 72–79. [Google Scholar] [CrossRef]
- Vavken, P.; Joshi, S.; Murray, M.M. TRITON-X is most effective among three decellularization agents for ACL tissue engineering. J. Orthop. Res. 2009, 27, 1612–1618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soto-Gutierrez, A.; Zhang, L.; Medberry, C.; Fukumitsu, K.; Faulk, D.; Jiang, H.; Reing, J.; Gramignoli, R.; Komori, J.; Ross, M.; et al. A whole-organ regenerative medicine approach for liver replacement. Tissue Eng. Part C Methods 2011, 17, 677–686. [Google Scholar] [CrossRef] [PubMed]
- Ott, H.C.; Matthiesen, T.S.; Goh, S.-K.; Black, L.D.; Kren, S.M.; Netoff, T.I.; Taylor, D.A. Perfusion-decellularized matrix: Using nature’s platform to engineer a bioartificial heart. Nat. Med. 2008, 14, 213–221. [Google Scholar] [CrossRef] [PubMed]
- Uygun, B.E.; Soto-Gutierrez, A.; Yagi, H.; Izamis, M.-L.; Guzzardi, M.A.; Shulman, C.; Milwid, J.; Kobayashi, N.; Tilles, A.; Berthiaume, F.; et al. Organ reengineering through development of a transplantable recellularized liver graft using decellularized liver matrix. Nat. Med. 2010, 16, 814. [Google Scholar] [CrossRef]
- Patel, N.; Solanki, E.; Picciani, R.; Cavett, V.; Caldwell-Busby, J.A.; Bhattacharya, S.K. Strategies to recover proteins from ocular tissues for proteomics. Proteomics 2008, 8, 1055–1070. [Google Scholar] [CrossRef] [PubMed]
- Rozario, T.; DeSimone, D.W. The extracellular matrix in development and morphogenesis: A dynamic view. Dev. Biol. 2010, 341, 126–140. [Google Scholar] [CrossRef] [Green Version]
- Basma, H.; Soto–Gutiérrez, A.; Yannam, G.R.; Liu, L.; Ito, R.; Yamamoto, T.; Ellis, E.; Carson, S.D.; Sato, S.; Chen, Y.; et al. Differentiation and transplantation of human embryonic stem cell–derived hepatocytes. Gastroenterology 2009, 136, 990–999. [Google Scholar] [CrossRef] [Green Version]
- Woo, D.; Kim, S.; Lim, H.; Heo, J.; Park, H.S.; Kang, G.; Kim, S.; You, H.; Hoeppner, D.J.; Kim, Y.; et al. Direct and indirect contribution of human embryonic stem cell–derived hepatocyte-like cells to liver repair in mice. Gastroenterology 2012, 142, 602–611. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Tseng, C.; Wang, H.; Kuo, H.; Yang, V.W.; Lee, O.K. Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol. Hepatology 2012, 55, 1193–1203. [Google Scholar] [CrossRef] [Green Version]
- Touboul, T.; Hannan, N.R.F.; Corbineau, S.; Martinez, A.; Martinet, C.; Branchereau, S.; Mainot, S.; Strick-Marchand, H.; Pedersen, R.; Di Santo, J.; et al. Generation of functional hepatocytes from human embryonic stem cells under chemically defined conditions that recapitulate liver development. Hepatology 2010, 51, 1754–1765. [Google Scholar] [CrossRef]
- Russell, J.O.; Monga, S.P. Wnt/β-catenin signaling in liver development, homeostasis, and pathobiology. Annu. Rev. Pathol. Mech. Dis. 2018, 13, 351–378. [Google Scholar] [CrossRef] [Green Version]
- Jung, J.; Zheng, M.; Goldfarb, M.; Zaret, K.S. Initiation of mammalian liver development from endoderm by fibroblast growth factors. Science 1999, 284, 1998–2003. [Google Scholar] [CrossRef]
- Rossi, J.M.; Dunn, N.R.; Hogan, B.L.M.; Zaret, K.S. Distinct mesodermal signals, including BMPs from the septum transversum mesenchyme, are required in combination for hepatogenesis from the endoderm. Genes Dev. 2001, 15, 1998–2009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clevers, H. Wnt/β-catenin signaling in development and disease. Cell 2006, 127, 469–480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Decaens, T.; Godard, C.; de Reynies, A.; Rickman, D.S.; Tronche, F.; Couty, J.P.; Perret, C.; Colnot, S. Stabilization of beta-catenin affects mouse embryonic liver growth and hepatoblast fate. Hepatology 2007, 47, 247–258. [Google Scholar] [CrossRef]
- Burke, Z.D.; Tosh, D. The Wnt/beta-catenin pathway: Master regulator of liver zonation? Bioessays 2006, 28, 1072–1077. [Google Scholar] [CrossRef]
- Berg, T.; Rountree, C.B.; Lee, L.; Estrada, J.; Sala, F.G.; Choe, A.; Veltmaat, J.M.; De Langhe, S.; Lee, R.; Tsukamoto, H.; et al. Fibroblast growth factor 10 is critical for liver growth during embryogenesis and controls hepatoblast survival via beta-catenin activation. Hepatology 2007, 46, 1187–1197. [Google Scholar] [CrossRef]
- Zhou, Q.; Xiang, L.; Shao, J.; Hu, R.; Lu, Y.; Yao, H.; Dai, L. In vitro differentiation of hepatic progenitor cells from mouse embryonic stem cells induced by sodium butyrate. J. Cell Biochem. 2007, 100, 29–42. [Google Scholar] [CrossRef]
- Lemaigre, F.; Zaret, K.S. Liver development update: New embryo models, cell lineage control, and morphogenesis. Curr. Opin. Genet. Dev. 2004, 14, 582–590. [Google Scholar] [CrossRef]
- Monga, S.P.S.; Monga, H.K.; Tan, X.; Mulé, K.; Pediaditakis, P.; Michalopoulos, G.K. β-catenin antisense studies in embryonic liver cultures: Role in proliferation, apoptosis, and lineage specification. Gastroenterology 2003, 124, 202–216. [Google Scholar] [CrossRef]
- Suksaweang, S.; Lin, C.-M.; Jiang, T.-X.; Hughes, M.W.; Widelitz, R.B.; Chuong, C.-M. Morphogenesis of chicken liver: Identification of localized growth zones and the role of β-catenin/Wnt in size regulation. Dev. Biol. 2004, 266, 109–122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Accession № | Primers Sequences (5′→3′) | Amplicons | |
---|---|---|---|---|
FOXA1 | NM_012742.1 | F: | GACGTTCAAGCGCAGTTACC | 189 |
R: | GACAGTGAGTGGCGAATGGA | |||
FOXA2 | NM_012743.1 | F: | CTGAGGTGGGTAGCCAGAAAAA | 160 |
R: | CACGGCTCCCAGCATACTTT | |||
SOX17 | NM_001107902.1 | F: | TTCAGCCGTCCTATTTCCCC | 187 |
R: | CTGGTCGTCACTGGCGTATC | |||
FGF2 | NM_019305.2 | F: | TCCATCAAGGGAGTGTGTGC | 139 |
R: | TCCGTGACCGGTAAGTGTTG | |||
BMP4 | NM_012827.2 | F: | CAGGGCCAACATGTCAGGAT | 188 |
R: | TGGCGACGGCAGTTCTTATT | |||
HGF | NM_017017.2 | F: | ACAGCTTTTTGCCTTCGAGC | 178 |
R: | TAGCTTTCACCGTTGCAGGT | |||
FGF4 | NM_053809.1 | F: | CTACCTGCTGGGCCTCAAAA | 130 |
R: | CACACCCCGCTGCTGTC | |||
EGF | NM_012842.1 | F: | CGATGTCAGCACCGAGACTT | 202 |
R: | CGTTGCTGCTTGACTCTTCG | |||
TGF-β | NM_021578.2 | F: | GACTCTCCACCTGCAAGACC | 100 |
R: | GGACTGGCGAGCCTTAGTTT | |||
ALB | NM_134326.2 | F: | TCGTATGAGCCAGCGATTCC | 159 |
R: | GTGGCCTGGTTCTCACACAT | |||
AFP | NM_012493.2 | F: | CCAGTGCCCGACAGAGAAAA | 120 |
R: | TTCATTGCAGCCAACGCATC | |||
CK19 | NM_199498.2 | F: | TTGGGTCAGGGGGTGTTTTC | 208 |
R: | AGGCGATCGTTCAGGTTCTG | |||
HHEX | NM_024385.1 | F: | CAGCGACCTCTGCACAAAAG | 128 |
R: | ATCTTGGCCAGACGCTTTCT | |||
HLX | NM_001077674.1 | F: | CTGGCTCCCTTCTACGCTTC | 131 |
R: | ATGTCCGCGATGCAGAAAGA | |||
Prox1 | NM_001107201.1 | F: | TTGACTCGGGACACAACGAG | 191 |
R: | TGATAGCCCTTCATTGCGCT | |||
C/EBPα | NM_001287577.1 | F: | GGGAGCAAACATGTGCCTTG | 168 |
R: | TCTAAGGACAGGGACGGAGG | |||
HNF-4α | NM_001270931.1 | F: | ATGAGCTGGTCTTGCCCTTC | 183 |
R: | GAGAGTCATACTGCCGGTCG | |||
PECAM1 (CD31) | NM_031591.1 | F: | GGTAATAGCCCCGGTGGATG | 160 |
R: | TTCTTCGTGGAAGGGTCTGC | |||
EpCAM | NM_138541.1 | F: | CGATCCAGAACAACGACGGT | 135 |
R: | CCGTGTCCTTGTCGGTTCTC | |||
SOX2 | NM_001109181.1 | F: | CTCTGTGGTCAAGTCCGAGG | 105 |
R: | ATGCTGATCATGTCCCGGAG | |||
OCT4 | XM_032889059.1 | F: | CCTGGGCGTTCTCTTTGGAAAGGTG | 198 |
R: | GCCTGCACCAGGGTCTCCGA | |||
Nanog | NM_001100781.1 | F: | ACACACCCACCCTACTCCAT | 174 |
R: | ACGATACACAGTGCACACCA | |||
Wnt1 | NM_001105714.1 | F | CGTTGCTGTCCCTGTGGTAT | 105 |
R | CAGGTGTGGTGGTTAGGGAC | |||
Wnt2 | XM_575397.8 | F | CAGAATGCGTGGGCTAGTCA | 91 |
R | TCACCCTTGGAATGGATGGC | |||
Wnt3a | NM_001107005.2 | F | CGGGTTCTTCTCTGGTCCTTG | 218 |
R | CTGACAGTGGTGCAGTTCCA | |||
Wnt7b | NM_001009695.1 | F | CTCTGCTTTGGCGTCCTCTAC | 184 |
R | GCTGGCATTCATCGATACCC | |||
Wnt10b | NM_001108111.1 | F | CCCTGTCCGGCTTGAGTAAG | 214 |
R | AAGGAGAACGCACTCTCACG | |||
TUBB3 | NM_139254.2 | F | CAACTATGTGGGGGACTCGG | 89 |
R | TGGCTCTGGGCACATACTTG | |||
FOXA2 | NM_012743.2 | F | AGGTGGGTAGCCAGAAAAAGG | 197 |
R | AGTAGCTGCTCCAGTCGGAT | |||
RUNX1 | NM_017325.2 | F | CCAAACTCTGAAAGCGAGGC | 88 |
R | TTAGCAACTGGCCGCTTAGT | |||
ACTA2 | NM_031004.2 | F | ACCATCGGGAATGAACGCTT | 191 |
R | CTGTCAGCAATGCCTGGGTA | |||
GATA6 | NM_019185.2 | F | GCCAACCCTGAGAACAGTGA | 166 |
R | GTATGAGGCCTTCAGAGCCC | |||
GATA4 | XM_017599788.2 | F | ACCCATCACACAGATCGCAG | 85 |
R | TGTTCAGGCTGGAGAGCAAG | |||
PAX6 | NM_013001.2 | F | CCGAATTCTGCAGGTGTCCA | 111 |
R | GTCGCCACTCTTGGCTTACT | |||
TERT | NM_053423.1 | F | TTCCTTCCACCAGGTGTCATC | 88 |
R | AGCCAGCACATTCCTCTCAC | |||
c-Myc | NM_012603.2 | F | TGAAAAGAGCTCCTCGCGTT | 139 |
R | AAATAGGGCTGCACCGAGTC | |||
B-Actin | NM_031144.3 | F: | GCGAGTACAACCTTCTTGCAG | 70 |
R: | TCGTCATCCATGGCGAACTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ebrahim, N.; Badr, O.A.M.; Yousef, M.M.; Hassouna, A.; Sabry, D.; Farid, A.S.; Mostafa, O.; Saihati, H.A.A.; Seleem, Y.; Abd El Aziz, E.; et al. Functional Recellularization of Acellular Rat Liver Scaffold by Induced Pluripotent Stem Cells: Molecular Evidence for Wnt/B-Catenin Upregulation. Cells 2021, 10, 2819. https://doi.org/10.3390/cells10112819
Ebrahim N, Badr OAM, Yousef MM, Hassouna A, Sabry D, Farid AS, Mostafa O, Saihati HAA, Seleem Y, Abd El Aziz E, et al. Functional Recellularization of Acellular Rat Liver Scaffold by Induced Pluripotent Stem Cells: Molecular Evidence for Wnt/B-Catenin Upregulation. Cells. 2021; 10(11):2819. https://doi.org/10.3390/cells10112819
Chicago/Turabian StyleEbrahim, Nesrine, Omnia A. M. Badr, Mohamed M. Yousef, Amira Hassouna, Dina Sabry, Ayman Samir Farid, Ola Mostafa, Hajir A. Al Saihati, Yasmin Seleem, Eman Abd El Aziz, and et al. 2021. "Functional Recellularization of Acellular Rat Liver Scaffold by Induced Pluripotent Stem Cells: Molecular Evidence for Wnt/B-Catenin Upregulation" Cells 10, no. 11: 2819. https://doi.org/10.3390/cells10112819
APA StyleEbrahim, N., Badr, O. A. M., Yousef, M. M., Hassouna, A., Sabry, D., Farid, A. S., Mostafa, O., Saihati, H. A. A., Seleem, Y., Abd El Aziz, E., Khalil, A. H., Nawar, A., Shoulah, A. A., Aljasir, M., Mohamed, A. Z., El-Sherbiny, M., Elsherbiny, N. M., Eladl, M. A., Forsyth, N. R., & Salim, R. F. (2021). Functional Recellularization of Acellular Rat Liver Scaffold by Induced Pluripotent Stem Cells: Molecular Evidence for Wnt/B-Catenin Upregulation. Cells, 10(11), 2819. https://doi.org/10.3390/cells10112819