Next Article in Journal
Optimizing Fungicide Seed Treatments for Early Foliar Disease Management in Wheat Under Northern Great Plains Conditions
Previous Article in Journal
Effects of Different Rates of Nitrogen Fertilisation and Biological Preparations to Increase Nitrogen Use Efficiency on Yield Structure Elements in Maize
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Method for the Rapid Identification of Rice Seed Blast Using Deep Learning and Hyperspectral Imagery

1
College of Life Science and Technology, Tarim University, Alar 8433001, China
2
State Key Laboratory for Crop Stress Resistance and High-Efficiency Production, Shaanxi Key Laboratory of Agricultural and Environmental Microbiology, College of Life Sciences, Northwest A&F University, Yangling 712100, China
3
College of Engineering, Northeast Agricultural University, Harbin 150038, China
4
College of Mechanical and Electrical Engineering, Tarim University, Alar 843300, China
5
Yantai Agricultural Technology Popularization Center, Yantai 264000, China
6
College of Mechanical and Electrical Engineering, Shihezi University, Shihezi 832000, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2025, 15(2), 290; https://doi.org/10.3390/agronomy15020290
Submission received: 19 November 2024 / Revised: 8 January 2025 / Accepted: 22 January 2025 / Published: 24 January 2025
(This article belongs to the Section Pest and Disease Management)

Abstract

:
Rice seeds’ infection with rice blast will directly lead to rice yield reduction or even crop failure in the next year. Therefore, it is very important accurately identify infected rice seeds. In this study, deep learning and hyperspectral imaging techniques were used for that purpose. First, hyperspectral image data were collected. Then, the UeAMNet (unsupervised extraction attention-based mixed CNN) model—designed in this study—was used to analyze these data and the results compared with the 2DCNN, 3DCNN, A2DCNN, A3DCNN, Ue2DCNN, Ue3DCNN, UeA2DCNN, UeA3DCNN, MNet, AMNet and UeMNet models using different training set (Tr) sizes. The results showed that the new UeAMNet model was superior to the comparison models when using different Tr sizes, and the accuracy could reach 100%. Notably, when Tr was only 0.05, the accuracy of this model still reached 96.85%. This showed that the proposed method could successfully identify infected rice seeds. Therefore, this study provides an approach for rice germplasm management and also for the development of crop disease identification methods in other parts of the world.

1. Introduction

Rice is one of the most important food crops in the world and is widely planted in more than 100 countries and regions. However, rice is vulnerable to a variety of diseases across its growth cycle [1]. Among these, rice seed blast, known as rice ‘cancer’, poses a huge threat to rice safety every year, causing a significant reduction in rice production or even no harvest [2]. The prevention and control of rice seed blast during the process of rice planting can effectively reduce its outbreak in the next year and thus its cost; these have, therefore, become key goals in the process of rice production. There are two main traditional approaches for the control of infected rice seeds: chemical soaking and artificial screening of diseases [3]. However, seed soaking with chemical agents cannot completely kill spores on the surface of seeds and can also cause damage to the human body [4,5]. Then, typically, early infected rice does not show symptoms, and manual screening for diseases requires a lot of manpower. Furthermore, as it is subject to considerable subjectivity, the accurate identification of rice disease is difficult [6]. In this context, to ensure food security and human health, a simple and rapid detection method for rice seed blast is urgently needed.
Among the many emerging technologies, hyperspectral technology can rapidly obtain extensive information on sample surface structures and internal characteristics [7]. Then, a calibration model can be developed to predictively identify unknown samples by learning based on a certain scale of spectral samples that contain characteristic information [8]. Because of the minimal sample pre-treatment and rapid measurement, this approach has been widely used in quality control, process monitoring, adulteration analysis, etc. [9,10]. However, the data acquired by traditional spectroscopic technology (single-point detection) lack sufficient spatial information and are unsuitable for multi-objective and simultaneous recognition [11]. As an alternative, hyperspectral imaging (HSI) technology [12,13] can rapidly obtain spectral and spatial image information on the measured object and thereby enable large-scale sample detection [14,15]. However, the large amount of information contained in HSI also results in a nonlinear structure, spatial homogeneity and heterogeneity of the data, which present challenges in the practical application of HSI technology.
Deep learning is a recent breakthrough in the field of artificial intelligence. Research in this field is progressing toward achieving the most advanced visual object recognition, target detection and many other functions [16,17]. Deep learning allows computational models that are composed of multiple processing layers to learn representations of data with multiple levels of abstraction [18]. As a result, deep learning can discover structures in complex data and extract the representations needed for detection or classification, which makes it promising for processing original HSI data without reducing their dimensions and building an ideal model. Deep learning has achieved better results than traditional machine learning in practical applications such as crop quality detection and physiological trait prediction [19,20,21].
Currently, the mainstream methods for processing hyperspectral images use 2D and 3D frameworks based on a convolutional neural network (CNN) [22,23,24]. Among these, the 2DCNN has a low computational cost and can complete simple hyperspectral image recognition tasks, but it cannot fully capture the spectral features contained in hyperspectral images. As far as we know, there is no research report using 2DCNN for crop seed disease detection. As an alternative, 3DCNN can capture both spectral and spatial features, so it is more suitable for processing HSI data. Many researchers have applied it to the identification of crop seed diseases. For example, Kaler et al. [25] proposed a recognition model named ConvLSTM combined with 3DCNN for soybean seed disease detection, which achieved 97.72% accuracy. However, the computational cost of 3DCNN is high, and redundancy in its feature extraction process will affect the performance of the model [26]. Therefore, scholars began to combine convolutional neural networks to make up for the shortcomings of 2DCNN and 3DCNN, seeking lower computational complexity and a better model performance [27,28]. For example, Liu et al. [29] used the improved HyperNet convolutional neural network combined with hyperspectral images to identify moldy peanut grains, achieving an average accuracy of 92.07%. Unfortunately, the field of accurate identification of rice seed blast has not yet benefited from this advanced technology.
Accordingly, the present study used deep learning technology and HSI technology to identify diseased rice seeds. The research objectives were as follows: (1) To establish and obtain HSI images of healthy and diseased rice seeds. (2) To establish a deep convolutional neural network model (UeAMNet) based on a 3D-2DCNN fusion for the identification of diseased rice seeds. (3) By analyzing the classification results of the UeAMNet classification model based on various sizes of the training set (Tr), to compare and evaluate the performance of the model against the classification results of classical convolutional neural networks (2D-CNN, 3D-CNN) and improved convolutional neural networks (UeA2DCNN, UeA3DCNN, Ue2DCNN, Ue3DCNN, A2DCNN, A3DCNN, MNet, UeMNet, AMNet).

2. Materials and Methods

2.1. Sample Collection

The test sample collection site was the Acheng Rice Research Base in Harbin, Heilongjiang Province (127°2′53.7″ E, 45°31′36.8″ N). The sample rice variety was Xiaotiandai 5, and the growth cycle was 125–135 days. Sample preparation was performed by a manual inoculation method with the following details: The pathogen was inoculated on PDA (Potato Dextrose Agar) and cultured in the dark at 25 °C. After the mycelia grew over the entire plate (about 14 days), the mycelia on the surface were washed with sterile water and cultured under a purple lamp. The ambient temperature was controlled at 26–28 °C, and the humidity was above 90%. A large number of gray conidia were observed on the surface of the medium (about 2 days). The spores on the surface of the medium were eluted with sterile water, and the impurities were removed by double-layer gauze. Then, the concentration of spore suspension was adjusted to 2 × 10 5 spores per milliliter. At the booting stage of rice, the configured spore suspension was sprayed on the front of rice leaves with a small 2 L electric sprayer produced by Qingdao Prandtl Electric Co., Ltd. (Qingdao, China) [30]. The spraying time of each rice plant was controlled at 5–10 s to ensure uniform coverage of the whole rice leaves. The spray distance was 20 cm, and the spray time was arranged at 7–9 a.m. to avoid the effects of high temperature and strong light on spore activity. Finally, the test samples were collected at the mature stage of rice (9 October 2022). When collecting, 100 rice ears with clear brown spots were randomly selected from the farmland.
Healthy and diseased rice were keep completely apart in space to avoid their cross-infection. The healthy rice was cultivated at the Rice Research Institute in Fangzheng County, Harbin City, Heilongjiang Province, using the Xiaotiandai 5 variety. Both healthy and diseased rice plants were grown in experimental fields within the same climatic zone, with similar temperature and soil conditions. Furthermore, their sowing and transplanting time, irrigation and fertilization systems and other farmland management methods were exactly the same, in order to reduce the adverse effects of environmental differences and ensure the comparability of the two groups of rice growth conditions. During data collection, 100 healthy rice ears without deformity or damage and with fullness were randomly selected. Then, the rice ears collected from the two sites were threshed separately, and 700 seeds were selected after the threshing of the rice blast ears. Among them, 450 had clear disease spots on the surface, 250 had no clear disease spots on the surface and 700 seeds were stored in a ventilated and dry place. The healthy grain ears collected from the Fangzheng test field were threshed, and 1250 seeds were selected and stored separately from the rice blast seeds. The collected samples are shown in Figure 1. In order to verify whether the collected rice blast seed samples were diseased, 50 seeds with clear disease spots, 50 seeds without clear disease spots and 50 healthy seeds were randomly selected. The seed DNA was extracted, and the fungal diversity detection primer ITS1 (front-end primer sequence CTTGGTCATTTAGAGGAAGTAA, back-end primer sequence GCTGCGTTCTTCATCGAT GC) was used to detect microbial diversity (community microbial composition). The results are shown in Figure 2. The results showed that diseased seeds with clear or no clear lesions were detected as containing Magnaporthe oryzae, while the healthy seeds did not contain Magnaporthe oryzae. In order to prevent the potential influence of moisture on the spectral characteristics, diseased and healthy rice seed samples were heated in a drying oven at 50 °C. The heating process lasted for 1 h, during which the moisture content of the seed samples decreased from 20% ± 1.5 to 3% ± 0.8. After drying, the prepared samples were placed in a temperature and humidity DW-HL668 (Zhongke Meiling Cryogenic Technology Co., Ltd., Hefei, China) with a temperature of 20 °C and a relative humidity of 7%, and we performed detection as soon as possible to avoid the influences of the external environment and the physiological activities of the rice seeds themselves.

2.2. Hyperspectral Image Acquisition and Pre-Processing

In this experiment, a Specim IQ handheld intelligent hyperspectral imager (Finland SPECIM Co., Shanghai, China) was used to obtain hyperspectral images (model SN: 190-1100381) from 397 to 1003 nm with 204 bands and a spectral resolution of 3 nm. To reduce errors such as baseline drift caused by the system, the power supply was turned on for 30 min to warm up the HSI system before data collection. The setup of the instrument is shown in Figure 3. The hyperspectral camera was perpendicular to the black test stand and was located 55 cm above the Labsphere Spectralon panel. To maintain the consistency of data collection, the Labsphere Spectralon panel was used as the reference in the field measurements for its near-perfect reflectance over the 250–2500 nm region and thermal stability, with a nominal reflectance of 99%. Stable illumination was provided by two 123 W halogen lamps during image acquisition. Healthy and diseased rice seeds were randomly selected from seed samples (1200 healthy seeds, 200 without clear disease and 400 with clear disease), giving a total of 1800 samples. The seeds were evenly distributed into 60 groups with a ratio of 2:1 between healthy and diseased seeds, and hyperspectral imaging was subsequently performed. Each group contained 20 healthy seeds and 10 diseased seeds, resulting in a total of 30 seeds per group. The distribution of seeds with clear and unclear disease symptoms was randomized within each group. During the whole test process, tweezers were used to clamp the sample being tested. After a period of image collection, the test bench was cleaned to ensure the quality of the collected data. Due to the errors arising from the dark current and other factors, the collected hyperspectral data needed to be corrected according to Equation (1):
R = I B W B
In using hyperspectral and deep learning technology to solve the problem of rice blast seed recognition, it is necessary to mark target samples and give them corresponding labels. To apply sample labels accurately and quickly, a single-band grayscale image of each hyperspectral image was extracted in Envi5.3 (Research Systems Inc., CO, Boulder, Colorado, USA). The labelme tool was used to manually mark the region of interest selected on the grayscale image. Python3.6 (Python Software Foundation, Wilmington, DE, USA) was used to batch process each .json file generated after labeling, automatically generate a mask image and convert it into a binary image. The corresponding true value label image was automatically generated simultaneously.

2.3. Principal Component Analysis

PCA is an unsupervised learning method that visualizes data by dimensional reduction and cluster analysis. It can provide an overview of complex multivariate data and has been widely adopted to process HSI data [31,32]. Using this approach, a reduced set of factors is produced. Such a set can be used for exploration since it provides an accurate description of the entire dataset. Specifically, form hyperspectral rice samples { x 1 , x 2 , , x m } , each sample i has n-dimensional feature X i = ( x 1 i , x 2 i , , x n i ) . The features for each dimension j are centralized across all samples to obtain ( x j 1 1 m k = 1 m x j k , x j 2 1 m k = 1 m x j k , , x j m 1 m k = 1 m x j k , ) , ( j = 1 , 2 , , m ) . The corresponding covariance matrix has m eigenvalues λ j i and eigenvectors u j i . By selecting the top p eigenvalues, the corresponding eigenvectors are obtained as u j 1 , u j 2 , , u j p . Finally, the original data { x 1 , x 2 , , x m } are projected into the new p principal component space, and the data { y j 1 , y j 2 , , y j p } after dimensionality reduction are obtained. The calculation formula is as follows:
( y j 1 y j 2 y j p ) = ( ( x j 1 , x j 2 , , x j m ) · u j 1 ( x j 1 , x j 2 , , x j m ) · u j 2 ( x j 1 , x j 2 , , x j m ) · u j p )
where { y 1 i , y 2 i , , y n i } , ( i = 1 , 2 , , p ) constitutes a principal component (PC). In this study, PCA was performed on the spectral data on 204 bands, and p = 3—that is, three principal components (PC1, PC2 and PC3)—were extracted.

2.4. Model Development

2.4.1. UeAMNet Model

The main structure of the proposed model is shown in Figure 4. It consists of three parts: the unsupervised feature extraction module, spectral feature extraction module and spatial feature extraction module. First, for input hyperspectral image I (I ∈ RM × N × B; M and N denote width and height, respectively; B denotes the number of original spectral bands), feature extraction is performed in the unsupervised feature extraction module. The spectral feature extraction module then extracts spectral–spatial features with 25 × 25 × 25 neighborhood pixel blocks. Then, the 25 × 25 × 25 neighborhood pixel blocks are sent into the spatial feature extraction module to extract the spectrum–space features. Finally, these are sent to the full connection layer to output C (required classification number) classification nodes for softmax classification. More detail on these steps is provided below.
The original rice HSI is composed of hundreds of thousands of pixels, and each pixel contains 204 (397–1003 nm) continuous spectral bands. Therefore, there are a large number of high-dimensional data in HSI, and it is very difficult to analyze HSI data directly, which not only leads to a huge amount of calculation but also makes it difficult to mine the subtle features in the data. Therefore, in the unsupervised feature extraction part of the UeAMNet model (Figure 4A), SuperPCA, an unsupervised feature extraction method based on superpixel-level principal component analysis (PCA) proposed by Jiang et al. [33] was used. This is a dimensionality reduction method that integrates data category labels, prior information and adaptive optimization strategies to more effectively extract features closely associated with rice varieties. Compared with traditional PCA, it significantly enhances the specificity, robustness and classification performance of feature extraction, demonstrating clear advantages in high-dimensional data analysis. Specifically, SuperPCA first divided an HSI into multiple uniform regions by superpixel segmentation to obtain the first principal component, which captured the most HSI information. Then, ESR was performed on to achieve superpixel segmentation. SuperPCA uses the ERS method because it is efficient and effective. Finally, these low-dimensional matrices were rearranged and combined to form a reduced-dimensional hyperspectral image. Equation (3) is as follows:
I f = k S X k , s . t . X k X g = ϕ , ( k g )
Here, S is the number of superpixels, Xk is the kth superpixel and X k X g = ϕ , ( k g ) means that the intersection between superpixels is an empty set.
Figure 4B describes the spectral feature extraction layer. To better calculate the class of each pixel in the original image represented by the smaller feature map after convolution, the HSI data cube was first divided into 25 × 25 × 25 overlapping 3D patches. Then, it was input into the spectral feature extraction module comprising three layers of 3DCNN convolution. The convolution kernel sizes were 8 × 3 × 3 × 7, 16 × 3 × 3 × 5 and 32 × 3 × 3 × 3, respectively. The three-layer, three-dimensional convolution kernel could simultaneously obtain image features and spectral features, which reduced the dimensions and merged adjacent spectral bands and image pixels, making the calculation more efficient.
Next, the features extracted by the spectral feature extraction module were input into the spatial feature extraction layer (Figure 4C). First, the extracted data were input into the CBAM module, and then CBAM applied attention-based feature refinement with two distinctive modules, channel and spatial, and achieved a considerable performance while keeping the overhead small [34]. The channel layer used average pooling and max pooling operations to aggregate the spatial information of the feature map, which then passed through a multi-layer perceptron (MLP) using a two-dimensional 1 × 1 convolution kernel to compress the spatial dimension of the input feature map and merge by element. The spatial layer used average pooling and max pooling to compress the input feature map, whose data were then passed through a 7 × 7 convolution layer to reduce the dimensions to a single channel. Finally, the data were activated by the Sigmoid function and input into the 2DCNN. The data entered into the 2DCNN were convoluted with the two-dimensional kernel. The number of convolution kernels was 16, and the size was set to 3 × 3. After two-dimensional convolution, a batch normalization (layer) was added for data normalization to speed up the convergence, prevent ‘gradient dispersion’ and alleviate over-fitting. Taking the 0.05 training ratio as an example, the detailed parameters of the UeAMNet model are shown in Table 1.

2.4.2. Models for Comparison

In this study, the classical deep convolutional neural networks 2DCNN and 3DCNN were used as comparison models. At the same time, in order to verify the role of the key modules of the model established in this paper, ablation experiments were performed on three key modules: the Ue unsupervised feature extraction module (SuperPCA), CBAM-BN attention module (the important part of spatial feature extraction layer) and Mnet combined neural network module (the hybrid neural network is composed of the 3DCNN network in the spectral feature extraction layer and the 2DCNN in the spatial feature extraction layer). The ablation models used were UeAMNet, UeMNet, AMNet, Mnet, UeA3DCNN, UeA2DCNN, Ue3DCNN, Ue2DCNN, A3DCNN and A2DCNN. The specific combinations of all models and the corresponding modules are shown in Table 2.
The computer configuration of this study comprised a Corei5-6300hq, NVIDIA960m (2G) and 16 GB physical memory with a fundamental frequency of 2.30 GHz. The training was implemented in Python (3.6.5) with the deep learning library Keras (2.2.2), which could rapidly build a deep learning training system. The single training iteration of all models was set to 50. We set the training set ratios to 0.9, 0.7, 0.5, 0.3, 0.1 and 0.05, with the training set ratio of 0.05 considered the minimal training sample.

2.5. Model Assessment

The overall accuracy (OA), average accuracy (AA) and Kappa coefficient (Kappa) evaluation metrics were used to evaluate the performance of the model in identifying rice seed blast. Here, OA represents the ratio of the number of correctly classified samples to the total number of samples in the test sample. AA for each class is calculated the ratio of the number of correctly predicted samples for each class and the overall number of each class. Kappa is a statistical measure that provides mutual information about the strength of agreement between the truth map and the classification map. The corresponding Equations (4)–(6) are shown below:
OA = i = 1 n x i i i = 1 n j = 1 n x i j
A A = 1 n i = 1 n x i i j = 1 n x i j
K a p p a = i = 1 n j = 1 n x i j × i = 1 n x i i i = 1 i = j n ( i = 1 n x i j × j = 1 n x i j ) ( i = 1 n j = 1 n x i j ) 2 i = 1 i = j n ( i = 1 n x i j × j = 1 n x i j )
where i = 1 , 2 , 3 represents the three categories of healthy, unclear disease and clear disease in real samples, respectively; j = 1 , 2 , 3 represents the three categories of healthy, unclear disease and clear disease in predicted samples; n = 3 denotes the total number of categories; and x i j represents the number of samples where the true class is i but the predicted class is j , while x i i indicates the number of samples where both the true and predicted classes are i .

3. Results

3.1. Spectral and Principal Component Analyses of Rice Seed Blast

The spectra of healthy and diseased rice seeds extracted from hyperspectral images are shown in Figure 5A. Healthy and diseased rice seeds showed different but similar characteristics, which may have been due to their different physical and chemical properties but similar composition and structure [35]. In the visible light range of 400–440 nm, the spectral reflectance initially decreased. It was also observed that the spectral values of healthy seeds were lower than those of diseased seeds in this range. This may be due to the accumulation of disease-resistant metabolites such as phenolic compounds in the surface and interior of diseased seeds when they are infected by diseases [36]. These metabolites interact with the biomolecular structures in rice seeds, altering the optical properties of the seed surface [37], which leads to higher reflectance for diseased seeds compared to healthy ones in this wavelength range. Notably, in the 480–920 nm range, the spectral values of healthy seeds were significantly higher than those of diseased seeds. This could be attributed to the deposition of dark substances, caused by cell death and fungal infection in the diseased seeds [38], which results in the appearance of dark or black spots on the seed surface. This observation is consistent with the phenomenon shown in Figure 1. Specifically, the spectral reflectance at 440–650 nm began to increase and then remained high. The spectral reflectance began to decline at about 650–750 nm and remained relatively stable at 780–1000 nm. Among them, the spectral value of diseased seeds in the 920–1003 nm band is higher than that of healthy seeds. It is speculated that it is affected by factors such as cell structural damage and chemical compositional changes caused by diseases, rendering the seed surface more likely to reflect near-infrared light [39]. In addition, a comparison of the spectra of healthy and diseased rice seeds revealed that the difference at the peak was large. In summary, although all spectra had similar trends, sample-to-sample variations, noise and baseline drift still existed.
Figure 5 also shows that the average reflectance of the diseased rice seeds was lower than that of the healthy rice seeds, probably because the phenotype of the infected rice seeds became dark gray. There was a downward reflection valley near 430–450 nm (blue–purple region), which was due to the clear absorption of N-containing molecules. As rice seeds are yellow–orange, for which the complementary color is blue–purple, blue–purple light was absorbed. Additionally, a peak appeared at 620–740 nm (red), which mainly reflected the absorption of chemical bonds such as O-H and C-H in the rice seeds [40]. These observed differences could be further used as a basis for identifying rice seed blast. However, there was still an overlap in the spectral reflectance between healthy and diseased rice seeds. Therefore, a data-driven approach was needed for further analysis.
The PCA results are shown in Figure 5B. Each dataset explained more than 90% of the variance in the spectra through PC1, PC2 and PC3 and showed complex cluster scenarios. From Supplementary Figure S1, it can be seen that PC1, PC2 and PC3 are closely related to the wavelengths of 735 nm, 566 nm and 423 nm and their adjacent areas, respectively. Overall, clusters of healthy and diseased rice species were very close and not well separated, consistent with the information presented in the original spectra, as described above. This may have been because the infected and healthy rice seeds still belong to the same species, so their spectral information was similar. This result indicated that there was a correlation and overlapping information between the spectral information of the healthy and diseased rice seeds, which may hinder identification. Overall, the PCA results demonstrated the separability of diseased and healthy rice seeds but that it was difficult to distinguish them completely using spectra alone. Therefore, it was necessary to use deep learning end-to-end modeling to enable accurate classification.

3.2. Ablation Test Results

To intuitively compare the role of each key module, the ablation test results (Table 3) under the condition of a 0.05 training set were selected for analysis and discussion. In addition, the ablation test results with training set ratios of 0.9, 0.7, 0.5, 0.3 and 0.1 are shown in Table S2 of the Supplementary Materials.
From Table 3, we can find the contribution rates of the three most important components of the model: Ue module > Mnet combined neural network module > CBAM-BN attention module. The addition of the Ue module increases the accuracy of MNet from 82.29% to 91.43%, 3DCNN from 76.47% to 89.88% and 2DCNN from 71.94% to 89.03%. The excellent feature extraction ability of the Ue module helps to improve the model performance. The Mnet combined neural network module combines the advantages of 3DCNN and 2DCNN, which can be improved by 5.82–10.35% when compared with 3DCNN and 2DCNN alone. The addition of the CBAM-BN attention module further improves the accuracy of the model. UeAMNet is 5.41% higher than UeMNet, and AMNet is 4.43% higher than MNet. The accuracies of 3DCNN and 2DCNN have been improved to varying degrees. This analysis further confirms the effectiveness of the proposed UeAMnet network framework and clearly shows the role and function of these three key modules.

3.3. Results of the Identification Model for Rice Seed Blast

3.3.1. Results Under Different Training Samples

To verify each model’s ability to identify diseased rice seeds in different scenarios, Tr was set to 0.9, 0.7, 0.5, 0.3 or 0.1. As can be seen from Figure 6, as Tr decreased, the three indicators—OA, Kappa and AA—of the model evaluation generally showed a downward trend, and the test loss rate showed an upward trend. However, the OA of the UeAMNet model was above 99.25% under all Tr conditions, which is significantly higher than for the other models. At the same time, the loss rate of UeAMNet was always lower than that of the comparison models. We found that 2DCNN and 3DCNN achieved the worst results in any Tr case.
Specifically, the OA, Kappa and AA values of all models were over 90% when the Tr sizes were 0.9, 0.7, 0.5 and 0.3 (Figure 6). The OA, Kappa and AA values of UeAMNet, UeMNet, AMNet, MNet, UeA2DCNN, UeA3DCNN, Ue2DCNN and Ue3DCNN at 0.9, 0.7, 0.5 and 0.3 were all above 99%, and the fluctuation of the test loss rates of UeAMNet, UeMNet, AMNet and MNet at Tr sizes of 0.9, 0.7, 0.5 and 0.3 was not significantly close to 0. When Tr was 0.1, the OA, Kappa and AA values of UeAMNet, UeMNet, AMNet, MNet, UeA2DCNN, UeA3DCNN, Ue2DCNN and Ue3DCNN decreased significantly but were still above 88.10%, and the test loss rate increased significantly. For 2DCNN and 3DCNN, when Tr was 0.1, the decrease in OA, Kappa and AA was more clear. Compared with the training results of 2DCNN and 3DCNN at a Tr of 0.7, OA, Kappa and AA decreased by 20%, 50% and 30%, respectively.

3.3.2. Minimal Training Samples

Although deep learning has achieved great success in various fields by using a large amount of labeled data, existing technologies usually face great challenges in practical scenarios because only a few labeled instances are available. Therefore, this paper specifically discusses the results of the deep learning classification model under small training samples, when Tr was only 0.05. It can be seen from Figure 7 that the loss rate of each model during training fluctuated greatly when Tr was 0.05, but the loss rate of UeAMNet was always the lowest of the compared models. When Tr was 0.05, the overall accuracies (OAs) of 2DCNN and 3DCNN were 71.95% and 76.48%, respectively, the Kappa coefficients were 26.84% and 43.56%, respectively, and the AAs were 61.37% and 70.06%, respectively. After adding Ue (unsupervised feature extraction), the three evaluation indexes greatly improved for 2DCNN and 3DCNN. The OAs increased by 17.09% and 13.41%, respectively, the Kappa coefficients increased by 48.37% and 33.96%, respectively, and the AAs increased by 25.37% and 18.51%, respectively. When compared with 2DCNN and 3DCNN, the OAs of the MNet, AMNet, UeNet and UeMNet models increased by 12.73–15.98%, the Kappa coefficient increased by 31.93–42.76% and the AA increased by 17.11–22.62%.

3.4. Visualization of Identification Results of Rice Seed Blast

In this paper, the identification results of diseased rice seeds (rice blast) are visualized (Figure 8). The corresponding color markers of diseased and normal rice seeds were generated by the model. From the camera image (Figure 9), it can be seen that there is no significant difference between the appearances of the diseased rice seeds and the healthy rice seeds. It is difficult to distinguish them without circling unclearly diseased rice seeds in green and clearly diseased rice seeds in red. The image recognition results of all models under different Tr sizes are compared. When Tr was 0.9, 0.7, 0.5 or 0.3, all models could effectively identify healthy and diseased seeds. The error recognition of 3DCNN and 2DCNN was the most clear, possibly as they could not learn enough spectral features under this sample size. With a decrease in the amount of data in the training set, the 2DCNN and 3DCNN models not only faced the problem of inter-class confusion but also faced scattered error identification pixels. The recognition accuracy of all models decreased significantly when Tr was 0.1 or 0.05. We found that 2DCNN and 3DCNN could not effectively distinguish diseased rice seeds. However, the SuperPCA feature extraction of the unsupervised feature extraction module and the improved model (UeAMNet, UeMNet, AMNet, MNet, Ue2DCNN and Ue3DCNN) after CBAM-BN block optimization were improved when compared with the classical deep learning networks (2DCNN and 3DCNN). The number of error pixels was greatly reduced, and the identification result was close to the label image. Notably, in any Tr case, the identification results of the UeAMNet model constructed in this study were largely consistent with the label images, indicating that the processing method could best identify rice seed blast. Therefore, it seems feasible to use UeAMNet to visualize diseased rice seeds (rice seed blast), whereas this is difficult to achieve with chemical methods or visual observation. Additionally, when compared with single-point detection technology, HSI technology can more readily visualize diseased rice seeds; the chemical image can be obtained online simply by establishing an accurate classification model.

4. Discussion

The classification of HSI is a fundamental analytical task that has attracted considerable attention. However, the efficient and accurate classification of HSI data has been challenging for many years due to their high-dimensionality, the similarity between spectra and the difficulty in obtaining labeled samples [41]. To solve these problems, deep learning classification models have been used. In this study, a deep convolutional neural network combined with HSI technology was used to identify rice seed blast for the first time. The proposed method achieved rapid and non-destructive identification of infected rice seed blast. The proposed method was compared with the classical neural networks 2DCNN and 3DCNN as well as deep learning classification models UeA2DCNN, UeA3DCNN, Ue2DCNN, Ue3DCNN, A2DCNN, A3DCNN, MNet, AMNet, UeMNet and UeMNet. Generally, the UeAMNet model designed in this study outperformed the comparison models under different Tr sizes, and it had a maximum test accuracy of 100%. Notably, when Tr was only 0.05, the test accuracy of this model still reached 96.85%. The main reasons for these results were the SuperPCA and MNet architecture of the unsupervised feature extraction module of UeAMNet and the role of CBAM-BN in the spatial feature extraction module.
Although deep learning methods can automatically acquire deep-level features, they use raw HSIs as inputs, which may result in redundancy when developing models. Therefore, transformations such as PCA are used to reduce the dimensions of the HSI, following which deep learning models based on the reduced data are developed [42]. However, in this study, it was inappropriate to use the traditional PCA method to reduce the dimensions of the HSI according to a unified projection. Therefore, Ue2DCNN, Ue3DCNN and UeMNet were built for data dimensionality reduction using SuperPCA. Compared with the three models without SuperPCA, 2DCNN, 3DCNN and MNet, it was found that the improvement effect was unclear at Tr values of 0.9, 0.7, 0.5 and 0.3, because there were sufficient training samples and each identification model could learn enough spectral features. However, when Tr was 0.1 or 0.05, compared with 2DCNN and 3DCNN, the OA of Ue2DCNN and Ue3DCNN increased by 12.73–15.98%, the Kappa coefficient increased by 31.93–42.76% and the AA increased by 17.11–22.62%. Compared with MNet, the average OA of UeMNet increased by 5.38%, the AA increased by 6.43% and the Kappa coefficient increased by 12.09%. Thus, SuperPCA improved the classification accuracy, especially in the case of small samples. This was because SuperPCA is different from the traditional PCA method, which is based on the whole image. SuperPCA considers the diversity of different homogeneous regions; that is, different regions should have different projections. Second, to address the problem of most traditional feature extraction models being unable to directly use the spatial information from HSI, SuperPCA integrates spatial context information into unsupervised dimensionality reduction through superpixel segmentation. Due to the homogeneity of the regions obtained by superpixel segmentation, SuperPCA can extract potential low-dimensional features even under noise. Overall, the Tr had a considerable influence on the prediction results in the identification of rice seed blast, with more training data improving the identification effect of the model. However, in real-world applications, the identification of rice seed blast will face great challenges because there are only a few marker instances available. To address this, the UeAMNet model was constructed based on the MNet framework combined with SuperPCA and CBAM-BN modules, and this achieved excellent results without data augmentation in the case of small Tr, which demonstrated the value of UeAMNet in practical applications for the identification of rice seed blast.
Previous studies have shown that using only 2DCNN or 3DCNN has the disadvantages of missing channel relationship information or very complex models, respectively. This also prevents these methods from achieving a better accuracy on hyperspectral images. The main reason for this is that hyperspectral images are volumetric data and have spectral dimensions. A pure 2DCNN cannot extract better discriminative feature maps from spectral dimensions, which was similar to the results obtained with a 2DCNN in this study. Similarly, a deep 3DCNN is computationally highly complex [43]. This was the motivation for utilizing the MNet architecture in the recent study, which overcomes the shortcomings of previous models [27]. The MNet architecture contributed to the classification of diseased rice seeds (rice seed blast) by extracting deep abstract spectral–spatial features, thus guiding the feature selection at the bottom of the network. This network structure made MNet more competitive than 2DCNN and 3DCNN. Additionally, this study added the CBAM-BN module to the MNet network to further improve the accuracy and stability of the model. Under different Tr, UeAMNet and AMNet improved the recognition accuracy by 2–4% compared with UeMNet and MNet. This was because the spatial attention in CBAM-BN focused the neural network on the pixel areas in the image that played a decisive role in the identification and ignored irrelevant areas. Simultaneously, channel attention was used to process the distribution relationship of feature map channels [44].
Previously, hyperspectral image detection of rice blast in rice seeds had not been reported, so we compared the latest research on grain disease detection. Irene Teixido-Orries et al. [45] used a random forest algorithm combined with hyperspectral imagery to classify the pollution degree of oat samples, and the classification accuracy was 77.8%. Peng Xu et al. [46] used hyperspectral imaging (HSI) and deep learning methods to identify maize seed diseases and proposed an information fusion convolutional neural network (CNN-RB) model based on full variable and feature variable modeling. The accuracy rate was 98.12% when the ratio of the training set and test set was set to 7:3. In this study, hyperspectral imaging technology and a convolutional neural network were used to identify healthy and diseased rice seeds for the first time. When the ratio of the training set to the test set was 7:3, the accuracy rate was 99.86%. Compared with the random forest and CNN-RB models, the accuracy increased by 22.06% and 1.74%, respectively. The model training epoch is set to 50 to converge, which is much smaller than the epoch of 600 times required for the CNN-RB model. This shows that the UeAMNet model established in this study achieved a balance between hardware resource requirements and performance, with fewer training parameters compared to the comparison models. In addition, the identification accuracy of the model can also reach 96.85% in the case of a very small sample with a training set ratio of 0.05, which again shows the potential of the model in the identification of healthy and diseased rice seeds.
This study shows that the UeAMNet model has achieved high-precision identification results on the HSI dataset of healthy and diseased rice seeds. It could have practical applications in the areas of food safety and disease detection, and it is also of reference significance for grain disease and germplasm monitoring of maize, peanut, soybean and other crops. However, while hyperspectral imaging technology can provide a wide range of spectral information with high resolution and high sensitivity, its data processing is still a computationally intensive task and requires a lot of computing resources. It is not conducive to real-time detection in practical applications and has certain limitations. Therefore, future research needs to develop a data-optimized processing algorithm to improve the computational efficiency and shorten the identification time, to meet the needs of rapid diagnosis in agricultural production and serve sustainable agriculture.

5. Conclusions

In this study, HSI technology and a deep convolutional neural network were used to identify healthy rice seeds and diseased rice seeds (rice seed blast). The proposed UeAMNet discrimination model was compared with the results of classical convolutional neural networks (2D-CNN, 3D-CNN, HybridSN) and improved deep convolutional networks (UeAMNet, UeMNet, AMNet, MNet, UeA2DCNN, UeA3DCNN, Ue2DCNN, Ue3DCNN, A3DCNN and A2DCNN) under different Tr scenarios. The performance parameter values revealed that the UeAMNet model was generally superior to the classical convolutional neural networks in the identification of diseased rice seeds (rice seed blast) regardless of the Tr scenario. The UeAMNet model had the best identification effect and still achieved excellent results with small training samples. This method enabled the successful identification of diseased rice seeds (rice seed blast). However, since the results obtained were based on a preliminary exploration, future studies are needed on more diverse situations (such as rice seed germination, variety differences, etc.) to verify the reliability of the technology.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy15020290/s1, Figure S1: The factor loadings of PC1, PC2 and PC3 across various spectral bands; Table S1: Table of the microbial community composition; Table S2: Summary of ablation test training.

Author Contributions

Writing—original draft preparation, Y.Y.; Visualization, Y.Y.; Software, R.W.; Validation, R.W. and Y.J.; Investigation, R.W. and Y.J.; Methodology, Y.J.; Formal analysis, Y.S.; Project administration, Y.S.; Data curation, Y.L.; Resources, Y.L. and Z.W.; Conceptualization, Z.W. and X.S.; Writing—review and editing, Z.W. and X.S.; Supervision, Z.W.; Project administration, X.S.; Funding acquisition, X.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (32330004 to X.S.) and the Research Innovation Project for Doctoral Students of Tarim University (TDBSCX202203 to Y.Y.).

Data Availability Statement

Data are contained within the article or Supplementary Material.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wang, L.; Xie, H.; Zheng, X.; Chen, J.; Zhang, S.; Wu, J. Recent advances and emerging trends in antiviral defense networking in rice. Crop J. 2021, 9, 553–563. [Google Scholar] [CrossRef]
  2. Law, J.W.F.; Ser, H.L.; Khan, T.M.; Chuah, L.H.; Pusparajah, P.; Chan, K.G.; Goh, B.H.; Lee, L.H. The potential of Streptomyces as biocontrol agents against the rice blast fungus, Magnaporthe oryzae (Pyricularia oryzae). Front. Microbiol. 2017, 8, 3. [Google Scholar] [CrossRef]
  3. Chethana, B.S.; Deepak, C.A.; Rajanna, M.P. Identification of novel resistance source in traditional varieties against major diseases of rice. Oryza 2020, 57, 116–125. [Google Scholar] [CrossRef]
  4. Hayasaka, T.; Matsuura, T.; Namai, T. Behavior and control of pyricularia oryzae in brown rice seed as inoculum source of rice seedling blast. Jpn. J. Phytopathol. 2019, 68, 297–304. [Google Scholar] [CrossRef]
  5. Wei, F.; Mortimer, M.; Cheng, H.; Sang, N.; Guo, L.H. Parabens as chemicals of emerging concern in the environment and humans: A review. Sci. Total Environ. 2021, 778, 146150. [Google Scholar] [CrossRef]
  6. Zhang, Z. Establishment of a rapid detection method for rice blast fungus based on one-step loop-mediated isothermal amplification (LAMP). Plant Dis. 2019, 103, 1967–1973. [Google Scholar] [CrossRef]
  7. Wang, Z.; Chen, G.; Jiang, R.; Zhao, M.; Lin, T.; Wang, R.; Wang, J. SC-HybridSN: A deep learning network method for rapid discriminant analysis of industrial paraffin contamination levels in rice. J. Food Compos. Anal. 2024, 133, 106404. [Google Scholar] [CrossRef]
  8. Sun, X.; Zhou, X.; Liu, C.; Li, C.; Zhang, S.; Zheng, D. Rapid and nondestructive identification of rice storage year using hyperspectral technology. Food Control 2025, 168, 110850. [Google Scholar] [CrossRef]
  9. Li, Y.; Ercisli, S. Data-efficient crop pest recognition based on KNN distance entropy. Sustain. Comput. Inform. Syst. 2023, 38, 100860. [Google Scholar] [CrossRef]
  10. Lorente, D.; Aleixos, N.; Gómez-Sanchis, J.U.A.N.; Cubero, S.; García-Navarrete, O.L.; Blasco, J. Recent advances and applications of hyperspectral imaging for fruit and vegetable quality assessment. Food Bioproc. Technol. 2012, 5, 1121–1142. [Google Scholar] [CrossRef]
  11. Terentev, A.; Dolzhenko, V.; Fedotov, A.; Eremenko, D. Current state of hyperspectral remote sensing for early plant disease detection: A review. Sensors 2022, 22, 757. [Google Scholar] [CrossRef]
  12. Lu, B.; Dao, P.D.; Liu, J.; He, Y.; Shang, J. Recent advances of hyperspectral imaging technology and applications in agriculture. Remote Sens. 2020, 12, 2659. [Google Scholar] [CrossRef]
  13. Lu, Y.; Saeys, W.; Kim, M.; Peng, Y.; Lu, R. Hyperspectral imaging technology for quality and safety evaluation of horticultural products: A review and celebration of the past 20-year progress. Postharvest Biol. Technol. 2020, 170, 111318. [Google Scholar] [CrossRef]
  14. Qin, J.; Chao, K.; Kim, M.S.; Lu, R.; Burks, T.F. Hyperspectral and multispectral imaging for evaluating food safety and quality. J. Food Eng. 2013, 118, 157–171. [Google Scholar] [CrossRef]
  15. Plaza, A.; Benediktsson, J.A.; Boardman, J.W.; Brazile, J.; Bruzzone, L.; Camps-Valls, G.; Chanussot, J.; Fauvel, M.; Gamba, P.; Gualtieri, A.; et al. Recent advances in techniques for hyperspectral image processing. Remote Sens. Environ. 2009, 113, S110–S122. [Google Scholar] [CrossRef]
  16. Padhiary, M. The Convergence of Deep Learning, IoT, Sensors, and Farm Machinery in Agriculture. In Designing Sustainable Internet of Things Solutions for Smart Industries; IGI Global: Hershey, PA, USA, 2025; pp. 109–142. [Google Scholar] [CrossRef]
  17. Janiesch, C.; Zschech, P.; Heinrich, K. Machine learning and deep learning. Electron. Mark. 2021, 31, 685–695. [Google Scholar] [CrossRef]
  18. LeCun, Y.; Bengio, Y.; Hinton, G. Deep learning. Nature 2015, 521, 436–444. [Google Scholar] [CrossRef]
  19. Su, Z.; Zhang, C.; Yan, T.; Zhu, J.; Zeng, Y.; Lu, X.; Gao, P.; Feng, L.; He, L.; Fan, L. Application of hyperspectral imaging for maturity and soluble solids content determination of strawberry with deep learning approaches. Front. Plant Sci. 2021, 12, 736334. [Google Scholar] [CrossRef]
  20. Soni, A.; Dixit, Y.; Reis, M.M.; Brightwell, G. Hyperspectral imaging and machine learning in food microbiology: Developments and challenges in detection of bacterial, fungal, and viral contaminants. Compreh. Rev. Food Sci. Food Saf. 2022, 21, 3717–3745. [Google Scholar] [CrossRef]
  21. Ma, Y.; Liu, Z.; Chen, C.P. Hybrid spatial-spectral feature in broad learning system for hyperspectral image classification. Appl. Intell. 2022, 52, 2801–2812. [Google Scholar] [CrossRef]
  22. Gao, H.; Lin, S.; Yang, Y.; Li, C.; Yang, M. Convolution neural network based on two-dimensional spectrum for hyperspectral image classification. J. Sens. 2018, 2018, 8602103. [Google Scholar] [CrossRef]
  23. Li, Y.; Chen, J.; Nie, J.; Li, J.; Ercisli, S. Low-carbon jujube moisture content detection based on spectral selection and reconstruction. IEEE Internet Things J. 2024, 11, 38953–38964. [Google Scholar] [CrossRef]
  24. Wang, C.; Ma, N.; Ming, Y.; Wang, Q.; Xia, J. Classification of hyperspectral imagery with a 3d convolutional neural network and j-m distance. Adv. Space Res. 2019, 64, 886–899. [Google Scholar] [CrossRef]
  25. Kaler, N.; Bhatia, V.; Mishra, A.K. Deep learning-based robust analysis of laser bio-speckle data for detection of fungal-infected soybean seeds. IEEE Access 2023, 11, 89331–89348. [Google Scholar] [CrossRef]
  26. Ahmad, M.; Mazzara, M.; Distefano, S. Regularized cnn feature hierarchy for hyperspectral image classification. Remote Sens. 2021, 13, 2275. [Google Scholar] [CrossRef]
  27. Gavahi, K.; Abbaszadeh, P.; Moradkhani, H. DeepYield: A combined convolutional neural network with long short-term memory for crop yield forecasting. Expert Syst. Appl. 2021, 184, 115511. [Google Scholar] [CrossRef]
  28. Roy, S.K.; Krishna, G.; Dubey, S.R.; Chaudhuri, B.B. Hybridsn: Exploring 3d-2d cnn feature hierarchy for hyperspectral image classification. IEEE Geosci. Remote Sens. Lett. 2020, 17, 277–281. [Google Scholar] [CrossRef]
  29. Liu, Z.; Jiang, J.; Qiao, X.; Qi, X.; Pan, Y.; Pan, X. Using convolution neural network and hyperspectral image to identify moldy peanut kernels. LWT Food Sci. Technol. 2020, 132, 109815. [Google Scholar] [CrossRef]
  30. Murakami, J.; Tomita, R.; Kataoka, T.; Nakayashiki, H.; Tosa, Y.; Mayama, S. Analysis of host species specificity of magnaporthe grisea toward foxtail millet using a genetic cross between isolates from wheat and foxtail millet. Phytopathology 2003, 93, 42–45. [Google Scholar] [CrossRef]
  31. Wang, J.; Chen, G.; Ju, J.; Lin, T.; Wang, R.; Wang, Z. Characterization and classification of urban weed species in northeast China using terrestrial hyperspectral images. Weed Sci. 2023, 71, 353–368. [Google Scholar] [CrossRef]
  32. Abdi, H.; Williams, L.J. Principal component analysis. Wiley Interdiscip. Rev. Comput. Stat. 2010, 2, 433–459. [Google Scholar] [CrossRef]
  33. Jiang, J.; Ma, J.; Chen, C.; Wang, Z.; Cai, Z.; Wang, L. SuperPCA: A Superpixelwise PCA Approach for Unsupervised Feature Extraction of Hyperspectral Imagery. IEEE Trans. Geosci. Remote Sens. 2018, 56, 4581–4593. [Google Scholar] [CrossRef]
  34. Jiang, M.; Song, L.; Wang, Y.; Li, Z.; Song, H. Fusion of the YOLOv4 network model and visual attention mechanism to detect low-quality young apples in a complex environment. Precis. Agric. 2022, 23, 559–577. [Google Scholar] [CrossRef]
  35. Shahin, M.A.; Symons, S.J.; Hatcher, D.W. Quantification of mildew damage in soft red winter wheat based on spectral characteristics of bulk samples: A comparison of visible-near-infrared imaging and near-infrared spectroscopy. Food Bioprocess Technol. 2014, 7, 224–234. [Google Scholar] [CrossRef]
  36. Li, Q.; Xu, K.; Wang, S.; Li, M.; Jiang, Y.; Liang, X.; Niu, J.; Wang, C. Enzymatic browning in wheat kernels produces symptom of black point caused by Bipolaris sorokiniana. Front. Microbiol. 2020, 11, 526266. [Google Scholar] [CrossRef] [PubMed]
  37. Jeong, J.E.; Woo, S.J.; Le, V.S.; Choi, H.; Woo, H.Y. Combination of conjugated polyelectrolytes and biomolecules: A new optical platform for highly sensitive and selective chemo- and biosensors. Macromol. Res. 2014, 22, 461–473. [Google Scholar] [CrossRef]
  38. Sawada, H.; Sugihara, M.; Takagaki, M.; Nagayama, K. Monitorina and characterization of Magnaporthe grisea isolates with decreased sensitivity to scytalone dehydratase inhibitors. Pest. Manag. Sci. 2004, 60, 777–785. [Google Scholar] [CrossRef]
  39. Tan, J.; Wang, M.; Shi, Z.; Miao, X. OsEXPA10 mediates the balance between growth and resistance to biotic stress in rice. Plant Cell Rep. 2018, 37, 993–1002. [Google Scholar] [CrossRef] [PubMed]
  40. Amigo, J.M.; Martí, I.; Gowen, A. Hyperspectral imaging and chemometrics: A perfect combination for the analysis of food structure, composition and quality. Data Handl. Sci. Technol. 2014, 28, 343–370. [Google Scholar] [CrossRef]
  41. Yang, X.; Ye, Y.; Li, X.; Lau, R.Y.; Zhang, X.; Huang, X. Hyperspectral image classification with deep learning models. IEEE Trans. Geosci. Remote Sens. 2018, 56, 5408–5423. [Google Scholar] [CrossRef]
  42. Zhang, C.; Li, G.; Lei, R.; Du, S.; Zhang, X.; Zheng, H.; Wu, Z. Deep feature aggregation network for hyperspectral remote sensing image classification. IEEE J. Sel. Top. Appl. Earth Observ. Remote Sens. 2020, 13, 5314–5325. [Google Scholar] [CrossRef]
  43. Chen, Y.; Jiang, H.; Li, C.; Jia, X.; Ghamisi, P. Deep feature extraction and classification of hyperspectral images based on convolutional neural networks. IEEE Trans. Geosci. Remote Sens. 2016, 54, 6232–6251. [Google Scholar] [CrossRef]
  44. Woo, S.; Park, J.; Lee, J.Y.; Kweon, I.S. CBAM: Convolutional Block Attention Module. In Proceedings of the European Conference on Computer Vision (ECCV), Munich, Germany, 8–14 September 2018; pp. 3–19. [Google Scholar] [CrossRef]
  45. Teixido-Orries, I.; Molino, F.; Femenias, A.; Ramos, A.J.; Marín, S. Quantification and classification of deoxynivalenol-contaminated oat samples by near-infrared hyperspectral imaging. Food Chem. 2023, 417, 135924. [Google Scholar] [CrossRef]
  46. Xu, P.; Fu, L.; Xu, K.; Sun, W.; Tan, Q.; Zhang, Y.; Zha, X.; Yang, R. Investigation into maize seed disease identification based on deep learning and multi-source spectral information fusion techniques. J. Food Compos. Anal. 2023, 119, 105254. [Google Scholar] [CrossRef]
Figure 1. Morphological characteristics of healthy and diseased rice (rice seed blast). (A) Clearly diseased rice (rice seed blast). (B) Rice seeds without clear disease (rice seed blast). (C) Healthy rice seeds.
Figure 1. Morphological characteristics of healthy and diseased rice (rice seed blast). (A) Clearly diseased rice (rice seed blast). (B) Rice seeds without clear disease (rice seed blast). (C) Healthy rice seeds.
Agronomy 15 00290 g001
Figure 2. The microbial community composition OTU_6 species relative abundance histogram. S1 and S2 were healthy seeds, S3 and S4 were diseased seeds with no clear disease characteristics and S5 and S6 were diseased seeds with clear disease characteristics. The results of OTU_6 species analysis were Kingdom: Fungi, Phylum: Ascomycota, Class: Sordariomycetes, Order: Magnaporthales, Family: Magnaporthaceae, Genus: Magnaporthe, Species: Magnaporthe_grisea.
Figure 2. The microbial community composition OTU_6 species relative abundance histogram. S1 and S2 were healthy seeds, S3 and S4 were diseased seeds with no clear disease characteristics and S5 and S6 were diseased seeds with clear disease characteristics. The results of OTU_6 species analysis were Kingdom: Fungi, Phylum: Ascomycota, Class: Sordariomycetes, Order: Magnaporthales, Family: Magnaporthaceae, Genus: Magnaporthe, Species: Magnaporthe_grisea.
Agronomy 15 00290 g002
Figure 3. Hyperspectral identification of rice seed blast.
Figure 3. Hyperspectral identification of rice seed blast.
Agronomy 15 00290 g003
Figure 4. UeAMNet model structure. (A) Unsupervised feature extraction module. (B) Spectral feature extraction module. (C) Spatial feature extraction module.
Figure 4. UeAMNet model structure. (A) Unsupervised feature extraction module. (B) Spectral feature extraction module. (C) Spatial feature extraction module.
Agronomy 15 00290 g004
Figure 5. Reflectance curves of the sample at 397–978 nm and PCA results. (A) Spectral curves of healthy and diseased rice seeds ( is the average spectral reflectance of diseased rice seeds, is the spectral reflectance range of diseased rice seeds, is the average spectral reflectance of healthy rice seeds, is the spectral reflectance range of healthy rice seeds). (B) PCA analysis results of healthy and of diseased rice seeds ( is diseased rice seeds, is projection of PCA analysis results of diseased rice seeds on XY axis, is healthy rice seeds, is projection of PCA analysis results of healthy rice seeds on XY axis).
Figure 5. Reflectance curves of the sample at 397–978 nm and PCA results. (A) Spectral curves of healthy and diseased rice seeds ( is the average spectral reflectance of diseased rice seeds, is the spectral reflectance range of diseased rice seeds, is the average spectral reflectance of healthy rice seeds, is the spectral reflectance range of healthy rice seeds). (B) PCA analysis results of healthy and of diseased rice seeds ( is diseased rice seeds, is projection of PCA analysis results of diseased rice seeds on XY axis, is healthy rice seeds, is projection of PCA analysis results of healthy rice seeds on XY axis).
Agronomy 15 00290 g005
Figure 6. Test set results of 12 disease rice identification models. (A) OA. (B) Test loss rate. (C) Kappa. (D) AA.
Figure 6. Test set results of 12 disease rice identification models. (A) OA. (B) Test loss rate. (C) Kappa. (D) AA.
Agronomy 15 00290 g006
Figure 7. Training accuracy and loss rate of 12 identification models under Tr = 0.05. (A) Training accuracy. (B) Training loss rate.
Figure 7. Training accuracy and loss rate of 12 identification models under Tr = 0.05. (A) Training accuracy. (B) Training loss rate.
Agronomy 15 00290 g007
Figure 8. Recognition results of mixed images of different models; is normal rice seed, is diseased rice seed (rice blast). (A) The identification results of the UeAMNet model at a Tr of 0.05 show that the red circle has a pixel recognition error. (B) The identification results of the 2DCNN model at a Tr of 0.05, where the red circles show the identification of diseased rice seeds (rice seed blast).
Figure 8. Recognition results of mixed images of different models; is normal rice seed, is diseased rice seed (rice blast). (A) The identification results of the UeAMNet model at a Tr of 0.05 show that the red circle has a pixel recognition error. (B) The identification results of the 2DCNN model at a Tr of 0.05, where the red circles show the identification of diseased rice seeds (rice seed blast).
Agronomy 15 00290 g008
Figure 9. Camera and disease marker images of samples. Camera image: RGB image of the sample. Disease marker image: marking the diseased parts, including the conspicuous, clear signs of disease in the red circles, and the unclear disease in the green circles.
Figure 9. Camera and disease marker images of samples. Camera image: RGB image of the sample. Disease marker image: marking the diseased parts, including the conspicuous, clear signs of disease in the red circles, and the unclear disease in the green circles.
Agronomy 15 00290 g009
Table 1. The layerwise summary of the proposed UeAMNet architecture with window size 25 × 25.
Table 1. The layerwise summary of the proposed UeAMNet architecture with window size 25 × 25.
NO.Layer (Type)Kemel SizeOutput ShapeActivation FunctionParam
1Input_1 (Input Layer) (25, 25, 25, 1)
2Conv3D_1 (Conv3D)(3, 3, 7)(23, 23,19, 8)ReLU512
3Conv3D_2 (Conv3D)(3, 3, 5)(21, 21, 15,16)ReLU5776
4Conv3D_3 (Conv3D)(3, 3, 3)(19, 19, 13,32)ReLU13,856
5reshape_1 (Reshape) (19, 19, 416)
6CBAM (19,19,416)
7conv2d_1 (Conv2D)(3, 3)(17, 17, 16) 59,920
8BN (17, 17, 16) 64
9Flatten_1 (Flatten) 150,176
10Dense_1 (Dense) 256ReLU1,184,000
11Dropout_1 (Dropout) 256
12Dense_2 (Dense) 128ReLU32,896
13Dropout_2 (Dropout) 128
14Dense_3 (Dense) 2 Softmax258
Note: ‘Conv3D’ means the three-dimensional convolutional layer, ‘CBAM’ means the CBAM module and ‘BN’ means the batch normalization layer.
Table 2. Improved models of ablation experiment.
Table 2. Improved models of ablation experiment.
Improved ModelsModule
2DCNN3DCNNUeCBAM-bnMnet
UeAMNet
UeMNet
AMNet
Mnet
UeA3DCNN
UeA2DCNN
Ue3DCNN
Ue2DCNN
A3DCNN
A2DCNN
3DCNN
2DCNN
Table 3. Model ablation test results.
Table 3. Model ablation test results.
ModelTr 0.05
OA%AA%Kappa%
UeAMNet96.85%95.90%92.95%
UeMNet91.43%91.49%81.42%
AMNet86.72%86.65%71.42%
Mnet82.29%79.08%59.77%
UeA3DCNN91.46%90.77%79.31%
UeA2DCNN91.02%87.35%79.26%
Ue3DCNN89.88%88.57%77.52%
Ue2DCNN89.03%86.74%75.20%
A3DCNN79.54%72.89%48.69%
A2DCNN74.32%69.75%36.87%
3DCNN76.47%70.07%43.56%
2DCNN71.94%61.37%26.83%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yin, Y.; Wang, R.; Jiang, Y.; Suo, Y.; Li, Y.; Wang, Z.; Shen, X. A Method for the Rapid Identification of Rice Seed Blast Using Deep Learning and Hyperspectral Imagery. Agronomy 2025, 15, 290. https://doi.org/10.3390/agronomy15020290

AMA Style

Yin Y, Wang R, Jiang Y, Suo Y, Li Y, Wang Z, Shen X. A Method for the Rapid Identification of Rice Seed Blast Using Deep Learning and Hyperspectral Imagery. Agronomy. 2025; 15(2):290. https://doi.org/10.3390/agronomy15020290

Chicago/Turabian Style

Yin, Yanling, Ruidong Wang, Yang Jiang, Yuting Suo, Yang Li, Zhentao Wang, and Xihui Shen. 2025. "A Method for the Rapid Identification of Rice Seed Blast Using Deep Learning and Hyperspectral Imagery" Agronomy 15, no. 2: 290. https://doi.org/10.3390/agronomy15020290

APA Style

Yin, Y., Wang, R., Jiang, Y., Suo, Y., Li, Y., Wang, Z., & Shen, X. (2025). A Method for the Rapid Identification of Rice Seed Blast Using Deep Learning and Hyperspectral Imagery. Agronomy, 15(2), 290. https://doi.org/10.3390/agronomy15020290

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop