Next Article in Journal
Recycling Agricultural Residues as Straw and Hydrochar for Improved Soil Carbon Management Under Contrasting Irrigation Conditions
Next Article in Special Issue
Biosynthesis of Silver Nanoparticles in Prunella vulgaris L. Extracts and Evaluation of the Bioactivity of Nanoformulations with Importance in Plant Protection
Previous Article in Journal
Response of Soybean (Glycine max (L.) Merr.) to Vermicompost Fertilization and Foliar Application of Methylobacterium symbioticum
Previous Article in Special Issue
Fungicide Preharvest Application Strategies and Their Effects on Crop Yield, Quality, and Sprouting of Dried Onion Bulbs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antifungal Activity of Oregano Essential Oil Against Fusarium oxysporum f. sp. cubense Race 1 and Fusarium Wilt Disease on Silk Banana Plants

by
Marisol Oltehua-Vázquez
1,
Syl Soledad Martínez-Bolaños
2,
Victor López-Martínez
3,
Caucasella Diaz-Trujillo
4,
Mario Orozco-Santos
5,
Moisés Roberto Vallejo-Pérez
6,
Gilberto Manzo-Sánchez
7 and
Luciano Martínez-Bolaños
8,*
1
Unidad Regional Universitaria Sursureste (URUSSE), Carrera de Ingeniero Agrónomo Especialista en Zonas Tropicales (CIAEZT), Universidad Autónoma Chapingo, Carretera Teapa—Puyacatengo km. 7, Teapa 86800, Tabasco, Mexico
2
Departamento de Agroindustrias, Universidad Autónoma Chapingo, Carretera México—Texcoco km. 38.5, Texcoco 56230, Estado de México, Mexico
3
Postgrado en Ciencias Agropecuarias y Desarrollo Rural, Facultad de Ciencias Agropecuarias, Universidad Autónoma del Estado de Morelos (UAEM), Av. Universidad 1001, Cuernavaca 62209, Morelos, Mexico
4
Jardines de Pensiones, Mérida 97219, Yucatán, Mexico
5
Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), Campo Experimental Tecomán, Tecomán 28930, Colima, Mexico
6
Coordinación para la Innovación y Aplicación de la Ciencia y Tecnología (CIACYT), Universidad Autónoma de San Luis Potosí, San Luis Potosí 78000, San Luis Potosi, Mexico
7
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colima, Autopista Colima—Manzanillo km. 40, Tecomán 28930, Colima, Mexico
8
Centro Académico Regional Sede Oaxaca, Ingeniería en Agricultura Sostenible, Maestría en Protección Vegetal, Instituto de Investigación y Postgrado en Protección Vegetal (IIPPV), Universidad Autónoma Chapingo, Fitosanidad Tropical, Zimatlán de Álvarez 71200, Oaxaca, Mexico
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(12), 2682; https://doi.org/10.3390/agronomy15122682
Submission received: 4 September 2025 / Revised: 20 October 2025 / Accepted: 27 October 2025 / Published: 22 November 2025

Abstract

Banana and plantain crops are essential for food security; Fusarium wilt, caused by Fusarium oxysporum f. sp. cubense (FOC), is one of the most devastating disease affecting these crops worldwide. The pathogen infects the radicular system and subsequently colonizes and collapses the vascular tissue, leading to wilting and plant death. The aims of our study were to determinate the chemical composition of the essential oil from Origanum vulgare obtained by hydro-distillation, and to evaluate its antifungal activity against FOC race 1. GC/MS analysis identified 31 compounds in the oil. Eugenol (76.3%) and D-Limonene (6.13%) were the main components. Antifungal activity was evaluated in vitro and OEO inhibited the mycelial growth of FOC race 1 at 500 µL L−1. The minimum inhibitory concentrations (MIC50 and MIC95) were 111.1 and 174.1 µL L−1, respectively. Fusarium wilt control evaluated in Silk banana vitroplants was analyzed by disease severity in the internal corm, controlled by oregano essential oil at 3000 µL L−1. OEO treatments had no detrimental effects on Silk banana vitroplants. This paper provides knowledge to use oregano-derived compounds to develop bioproducts aimed at the integral and sustainable management of Fusarium wilt in banana and plantain crops.

1. Introduction

Plantains (Musa balbisiana Colla AAB) and bananas (Musa acuminata Colla AAA) are remarkable tropical fruits, not only for their nutritional value but also for their economic and social impact worldwide. These musaceous crops are cultivated in 132 countries, covering approximately 5,940,159 ha, with a total production of 1,351,112,326 tons, and of this, 15% is traded internationally [1]. In Mexico, the banana and plantain crops cover 87,393.92 hectares, with an annual production of 2,670,290.89 tons [2].
Fusarium wilt disease in bananas, caused by the fungus Fusarium oxysporum f. sp. cubense (FOC) [3], is one of the most important and devastating diseases of the musaceae around the world [4]. FOC produces three types of spores: macroconidia, microconidia, and chlamydospores, all of which participate in the infection process of plantain and banana plants. Chlamydospores can survive in soils for up to 30 years, and under favorable conditions, they germinate and infect the root system. Subsequently, the fungus colonizes and disrupts the vascular system, causing wilting and plant death [5]. The spread of this disease could be quick and the infection can lead to a complete loss of banana production [3].
FOC is classified in three physiological races based on its pathogenicity in plantains and bananas cultivars. Race 1 (R1) affects cultivars such as “Gros Michel” (Musa sp. AAA group), “Silk”, “Pome”, and “Pisang Awak” (Musa sp. AAB group). Race 2 (R2) affects the Bluggoe plantain group (ABB) while Tropical Race 4 (FOCTR4) severely affects the Cavendish group and all the cultivars susceptible to R1 and R2. To date, FOCTR4 is not present in México; however, the fungi are present in commercial banana plantations in Australia, China, Philippines, Malaysia, and Taiwan [6], as well as in other countries [7]. More recently, it was reported in South America, including Colombia [8], Peru [9], and Venezuela [10]; hence, there exists a high risk of distribution of FOCTR4 in the Caribbean and Latin America region [11], where the cultivated plantain and banana cultivars are susceptible.
The impact of Fusarium wilt disease has led to development of molecular techniques for pathogen diagnosis and detection [12]; integrated disease management plants include prophylactic measures and biosecurity protocols to reduce fungal dissemination [13] and genetic improvement programs for the selection of resistant germplasm, such as “Guijiao 9” [14] and the following somaclonal varieties: GCTCV 215, GCTV 247, and CJ19 [15]. Additionally, genetically modified varieties like RGA2 transgenic plants have been developed [16].
Efforts have also focused on biological control [17,18], the use of elicitors as resistance inductors [19], organic amendments [20], plant extracts [21], crop rotation [22], pre-fumigation and soil disinfection [23], disinfection of tools and equipment [24] and the use of fungicides [25]. However, due to monoculture system and the FOC complex epidemiology, effective management remains a significant challenge [13]. Moreover, excessive fungicide use increases production costs and poses risks to human health and the environment, highlighting the need to develop eco-friendly strategies using biorational or green products, and to promote healthy and suppressive soils for sustainable Fusarium wilt management.
Essential oils (EOs), a mixture of aromatic and volatile compounds extracted from different plant parts, are composed mainly of terpenoids and their derivatives. These compounds have demonstrated broad spectrum antimicrobial activity against plant pathogens [26]. Their mechanism of action includes alterations in cell wall composition, disruption of ATP synthesis, disintegration of the plasma membrane, and structural damage to mitochondria [27], as well as interference with mitochondrial enzymatic processes [28].
Several studies have demonstrated the antifungal activity of plant extracts and volatiles against FOCTR4, including Allium tuberosum [21,29], Melaleuca alternifolia [30], Zingiber officinale [31], and Cinnamomum zeylanicum [32]. Similarly, essential oils from Origanum vulgare [33], Pimenta dioica [34], Cinnamomum verum [35], and Eucalyptus spp. [36] have shown inhibitory effects on various plant pathogens.
Based on the above and the world necessity for healthier and safer foods with less economic, social, and environmental impact, the search for other control alternatives is justified. The aim of this study was to determine the effect of bio essential oils against Fusarium oxysporum f. sp. cubense race 1, contributing to development of eco-friendly strategies for the sustainable management of FOCTR4 in regions affected by Fusarium wilt.

2. Materials and Methods

2.1. Plant Material and Essential Oil Extraction

The oregano was collected from an agricultural area in the municipality of Playa Vicente, Veracruz, Mexico. The taxonomic identification was performed using standard taxonomic keys. A voucher specimen was deposited in the herbarium of the Tropical Agriculture Garden at Chapingo University, and it is also available on the Herbanwmex website (access number 11024). After collection, the leaves were dried in an oven at 60 °C for 72 h and manually ground until particles of approximately 0.8 mm thickness were obtained using a sieve. The samples were then stored in flasks until oil extraction.
Oregano essential oil (OEO) was extracted by hydro-distillation for 2 h using water in a Clevenger-type apparatus [37]. Briefly, 60 g of dried plant material was placed in a flask with 500 mL of water and processed for 2 h at 100 °C. The setup included a condenser system that directed vapor into a receiver section where the essential oil was collected. The obtained essential oil was stored in an amber glass container at 4 °C.

2.2. Chemical Characterization

The chemical compositions of O. vulgare essential oil were determined using gas chromatography mass spectrometry (GC-MS). Analysis was conducted on an Agilent 6890 gas chromatograph directly coupled to an Agilent 5973 Mass Selective Detector (MSD). The GC was equipped with an HP-5MS fused silica capillary column (5% phenyl, 95% polydimethylsiloxane; 30 m × 0.25 mm I.d.; 0.25 micron film thickness; J&W Scientific, Folsom, CA, USA). The GC/MSD operating conditions were as follows: injector temperature, 240 °C; transfer line temperature, 280 °C; oven temperature programmed from 50 to 260 °C at a rate of 10 °C/min, with a final hold time of 30 min. The solvent delay was set to 2 min, and a post-run temperature of 270 °C was applied at one min. Mass spectra were acquired in electron ionization (EI) mode at 70 eV, with a scan range of m/z 40–400.

2.3. Plant Pathogenic Fungi

Fusarium oxysporum f. sp. cubense race 1 was isolated from Silk banana (AAB) plants showing yellowing and necrosis in the lower leaves, as well as vascular discoloration in the pseudostem (Figure 1A,B). Samples were collected in Mexico (21°79′69″ N and 105°28′24″ O, 10 masl). Under aseptic conditions, small sections of the pseudostem were cultured on potato dextrose agar (PDA) at 26 °C. Morphological identification of Fusarium species was carried out using the Imperfect Fungi taxonomic key [38]. Pathogenicity tests were conducted on in vitro Silk banana vitroplants. DNA of the fungal sample was extracted in CTAB buffer, and PCR reaction was performed by using universal primer ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) to amplify the DNA sequence of internal transcribed spacer 1 (ITS1), 5.8S rRNA gene, and ITS2. The PCR products showed unique bands and were sequenced at Macrogen. Sequence editing and analysis were performed using CLC Main Workbench 24.0.2 software. The “Forward” and “Reverse” sequences were assembled to obtain consensus sequensces, which were used to perform nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/ accessed on 5 August 2025) analysis. For this purpose, FOC ITS region sequences were downloaded from PopSet at NCBI to create a local database of 61 sequences. The PCR product was sequenced and compared with sequences published in databases using the BLAST search tool at NCBI to identify the fungal species; FOCR1Nay01 (NCBI:PQ787221) presented a percentage identity of 99.38% in a coverage of 482 nucleotides with strain M1 of FOC race 1 (NCBI:OR617432), which was isolated from banana plants from the Ivory Coast. Monosporic cultures of FOC race 1 were maintained on PDA, and one strain was selected for further experiments (Figure 1C).

2.4. In Vitro Evaluation of Antifungal Activity

The study was conducted under laboratory conditions using a completely randomized design with five replicates. The antifungal tests of essential oil were evaluated by a mycelial growth assay based on the inhibition percentage of radial mycelial growth (IPRMG) of FOC race 1 on PDA medium. Oregano essential oil was solubilized in sterile distilled water and emulsified with 0.01% (v/v) Tween 20. OEO was added to molten (45 °C) potato dextrose agar (PDA) medium at different concentrations: 100, 500, 1000, 3000, and 5000 μL L−1. A five-millimeter-fungal disk from a 7-day-old culture taken from the margin was placed at the center of each PDA plate amended with essential oil. PDA without the essential oil served as the negative control. The cultures were incubated at 26 °C in the dark, and radial mycelial growth was measured until the control plates were fully colonized. The inhibition percentage radial mycelial growth (IPRMG) was calculated using the following formula: IPRMG = ((RMGC-RMGEO)/RMGC)*100 where IPRMG is the inhibition percentage radial mycelial growth, RMGC is the radial mycelial growth of the control, and RMGEO is the radial mycelial growth in EO treatments.
The minimum inhibitory concentration (MIC) of essential oil was defined as the lowest concentrations that completely inhibited visible growth.

2.5. Determination of Antifungal Activity on Fusarium Wilt Control

The experiment was also arranged in a completely randomized design with four replicates. Three-month-old Silk banana vitroplants were removed from polybags, washed, and root-pruned to 10 cm before inoculation. They were then immersed for 30 min in a conidial suspension of FOC race 1. The FOC race 1 strain was cultured for 5 days on potato dextrose agar (PDA); then, conidia suspensions were filtered with a cell strainer (8.47 μL). A sample volume of conidia suspension was added on a Neubauer chamber (Blaubrand, Wertheim, Germany) and it was observed under compound microscope to count the number of conidia. Then the volume of conidia was adjusted with sterile water to obtain a concentration of approximately 1 × 106 conidia mL−1. After inoculation, vitroplants were immersed for 3 min in OEO at 500, 750, 1000, 3000, and 5000 μL L−1. Untreated vitroplants served as controls. Treated and control vitroplants were transplanted into polybags containing sterile soil. Each treatment included four replicates with one vitroplant per replicate.

2.6. Disease Index

Disease incidence and severity were recorded weekly for three months. Leaf symptom disease (LSI) was evaluated based on the following scale [39]: 0 = plant without symptoms; 1 = initial yellowing, mainly in the older leaves; 2 = yellowing in all the lower leaves with some discoloration in younger leaves; 3 = all leaves severely yellowed or plant dead. Internal rhizome symptoms were visually assessed at the end of the experiment using a scale based on rhizome discoloration: 0 = no symptoms, 1 = 1–20%, 2 = 21–40%, and 3 ≥ 40% discoloration.

2.7. Statistical Analysis

Analysis of variance (ANOVA) was used to analyze each experiment in Statistical Analysis System (SAS v.9.0) software (using 95% confidence limits). Tukey’s multiple range test was applied to determine significant differences among treatments in all the experiments (p < 0.05). MIC data were analyzed by Probit analysis using the SAS PROC PROBIT procedure to estimate the effective concentration 50% (EC50) and 95% (EC95).

3. Results

3.1. Composition of Oregano Essential Oil

Extraction of the essential oil hydro-distillation using Clevenger apparatus showed a yield of 1.3 and 1.7 mL of essential oil by 60 g of oregano dried plant material. According to GC/MC analysis of the essential oil from O. vulgare, a total of thirty-one compounds were identified. The major chemical constituent was eugenol (3-allyl-6-methoxyphenol), comprising 76.3% of the total composition. Other relevant components included D-limonene (1-methyl-4-(1-methylethenyl)-cyclohexene) at 6.2%, followed by α-bergamotene, terpinolene and β-cis-terpineol/α-terpineol (2.2% each), carvacol (1.06%), cinnamic aldehyde (0.39%), eucalyptol (0.24%), cariophyllene (0.21%), terminen (0.06%), and other components (Table 1).

3.2. Antifungal Assays on Fusarium oxysporum f. sp. Cubense Race 1

The essential oil of O. vulgare exhibited strong inhibitory effects on the mycelial growth of F. oxysporum f. sp. cubense (FOC) race 1 in a concentration-dependent manner. Complete inhibition of mycelial growth was observed at 500 µL L−1 (Table 2). The minimum inhibitory concentration required to inhibit 95% of fungal growth (MIC95) was estimated at 174.1 µL L−1 (Table 3, Figure 2).
One-way analysis of variance of the results shown in the in vitro tests showed that all five OEO doses had a statistically significant effect on the growth of F. oxysporum f. sp. cubense race 1 at p < 0.0001 (Table 2).

3.3. In Vivo Antifungal Activity of Oregano Essential Oil Against FOC Race 1

Silk banana vitroplants inoculated with FOC race 1 and treated with different concentrations of OEO displayed varying degrees of external symptoms depending on the dose. Eighty-four days after inoculation, vitroplants treated with 100 μL L−1 of OEO presented with yellowing and necrosis of the lower leaves. In contrast, vitroplants treated with 500 and 1000 μL L−1 of OEO, only showed mild yellowing of lower leaves, and those treated with 3000 and 5000 μL L−1 showed no visible external symptoms. Control vitroplants (untreated) exhibited severe symptoms, including complete wilting of the lower leaves and sudden plant death.
The severity of Fusarium wilt disease, based on internal damage, showed that vitroplants inoculated with FOC race 1 without treatment presented dark discoloration throughout the rhizome whereas vitroplants treated with OEO showed reduced internal symptoms. Vitroplants treated with OEO at 3000 and 5000 μL L−1 had healthy rhizomes (Figure 3).
The disease progression of Fusarium wilt disease was inhibited for 84 days in Silk banana vitroplants treated by being dipped in O. vulgare essential oil for 3 min at concentrations of 3000 and 5000 μL L−1 (Figure 4). The agronomic use of these doses of oregano essential oil for controlling FOC race 1 is focused on trying banana propagative material, like rhizomes, to develop a novel bio fungicide to combat Fusarium wilt.

4. Discussion

The use of prophylactic systems, genetic breeding programs for banana plant resistance, development of healthy soil, and the application of natural plant extracts, microorganisms or elicitors to control Fusarium wilt disease represents the best option for sustainable management of worldwide banana crops. OEO contains compounds with the potential to control various plant pathogenic microorganisms, such as FOC race 1, even at low concentrations.
Research on the antimicrobial effects showed that O. vulgare essential oil inhibited both the mycelial growth and conidial germination of Pilidiella granati at 100 μL L−1 [40]; similarly, studies achieved excellent control of Alternaria alternara, Geotrichum candidum, and Rhizopus stolonifer using O. vulgare essential oil incorporated into cellulose acetate films [41] and an antifungal effect of OEO against Scopulariopsis sp. and Fusarium sp. [42]. Likewise, other authors reported sensitivity of Pythium insidious to OEO, with MIC50 and MIC90 values of 220 μg mL−1 and 870 μg mL−1, respectively [43].
The results shown in Figure 4 represent the effect of oregano essential oil treatment on severity index of Fusarium wilt banana, caused by Fusarium oxysporum f. sp. cubense on Silk banana plants while the results shown in Table 2 represent the in vitro inhibition of FOC race 1 mycelial growth caused by oregano essential oil after eight days of incubation. This differences were due to the type of interaction: in the first case (Figure 4), the results implied interaction between FOC race 1, OEO, silk banana plant and the environment while in the second case, the results (Table 2) were the product of interaction between FOC race 1 and oregano essential oil.
Our in vitro screening oregano essential oil study against FOC race 1 considered the minimum concentration of 100 μg mL−1, which showed a basic fungi growth inhibition (34.8%); however, in the present study with OEO at a dose of 500 μL mL−1 or higher, 100% inhibition of FOC race 1 mycelial growth was achieved. The potential fungicide activity of OEO over FOC race 1 may be related to its ability to disrupt cell membranes and cell walls through elicitor action.
Also, experiments in Silk banana plants artificially inoculated with mycelium and conida of Fusarium oxysporum f. sp. cubense race 1 demonstrated that Origanum vulgare-extracted essential oil provided protection against Fusarium wilt in banana plants (Figure 3). Disease progression was inhibited for 84 days in Silk banana plants treated by dipping in O. vulgare essential oil for 3 min at concentrations of 3000 and 5000 μL L−1 although at 1000 μL L−1, disease index increased, as shown in (Figure 4). Our results are consistent with those obtained using crude extracts from Allium tuberosum on banana Cavendish infected with FOCTR4, where the disease severity index was reduced at 81% [44]. In the same way, this antifungal activity of Origanum essential oil is similar to that of tea tree (Melaleuca alternifolia) essential oil against Fusarium wilt disease on banana plants, with reduction from 70% to 20% [30]. OEO treatments did not have a perceivable effect on banana rhizome plants, even though it was tested at quite a high concentration of 3000 and 5000 μL L−1.
Regarding the bioactive compounds present in oregano essential oil, a similar concentration range was observed and compared to other studies, although with varying proportions. The main compound identified in OEO was eugenol (76.31%), which aligns with other reports [45,46] of Eugenol concentrations between 68.0 and 89.5% and is different from [47] which reported a concentration of 43.01%. These variations in the yield and concentration of bioactive compounds among different oregano essential oils may be attributed to different factors such as climatic conditions, soil type, crop plant management, tissue and plant age, harvest time, postharvest management [46], and distillation process [48]. This differences could affect the OEO biological activities.
The main component of OEO specifically studied was 3-allyl-6-methoxyphenol (eugenol), which has been reported as a natural compound with antimicrobial properties [49]. The antimicrobial activity of essential oils is attributed to their hydrophobic nature and their ability to act as elicitors of reactive oxygen species (ROS) production. This ROS-inducing capacity is essential for OEO, as it promotes the disruption of fungal cell wall and membrane lipids, leading to alterations in membrane and organelle function, as well as inhibition of protein synthesis and nuclear acid integrity [50,51].
We believe the use of oregano essential oil and particularly its components may provide a basis for a novel bio fungicide to sustainably manage Fusarium wilt. This paper represents the first time that oregano essential oil is used to control Fusarium oxysporum f. sp. cubensis race 1 and is the reason for the use of different concentrations of oil. We certainly agree that using high concentrations on the field would make costs high; however, we are presently showing the oregano oil as a putative novel bio fungicide to combat Fusarium wilts and focused the use under these conditions onto plant propagation material and considered testing other concentrations for further research. In order to deepen the understanding of OEO effects on FOC, we will continue further research not only on race 1, but also other races and certainly test another concentration gradient.

5. Conclusions

The antifungal effects of Origanum vulgare essential oil were tested against the banana pathogen FOC race 1. OEO suppressed the pathogen mycelial growth in vitro at 500 μL L−1 and reduced the severity index of Fusarium wilt in the susceptible banana vitroplants at 3000 μL L−1. On the other hand, eugenol was the main compound identified in oregano essential oil. This study suggests that OEO, a novel and eco-friendly product containing bioactive antifungal compound, could constitute an alternative approach for prophylactic treatment and contribute to the integrated and sustainable management of Fusarium wilt in plantain and banana crops.

Author Contributions

Designed this study, L.M.-B., M.O.-V., G.M.-S. and M.O.-S.; analyzed the results, L.M.-B., V.L.-M. and M.O.-V.; DART-MS, analysis and technical support, L.M.-B., V.L.-M., S.S.M.-B. and C.D.-T.; statistically analyzed the date, L.M.-B., G.M.-S. and M.R.V.-P.; supervision, L.M.-B., M.O.-S., G.M.-S. and M.R.V.-P.; wrote the manuscript, L.M.-B., M.O.-V. and V.L.-M.; revised and edited the manuscript, L.M.-B., V.L.-M., S.S.M.-B. and C.D.-T. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

This work was supported by the Consejo Nacional de Humanidades, Ciencias y Tecnologías (CONAHCyT) of Mexico through the Sistema Nacional de Investigadores e Investigadoras (SNII), and to Universidad Autónoma Chapingo (UACh-DGIPS) for the founding project (support number: 25028-C-63).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO). FAOSTAT, Cultivos y Productos de Ganadería. Available online: https://www.fao.org/faostat/es/#data/QCL (accessed on 5 August 2025).
  2. Dirección General del Servicio de Información Agroalimentaria y Pesquera (DGSIAP). SIAP. Anuario Estadístico de la Producción Agrícola. Available online: https://nube.agricultura.gob.mx/cierre_agricola/ (accessed on 10 August 2025).
  3. Maryani, N.; Lombard, L.; Poerba, Y.S.; Subandiyah, S.; Crous, P.W.; Kema, G.H.J. Phylogeny and genetic diversity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp. cubense in the Indonesian centre of origin. Stud. Mycol. 2019, 92, 155–194. [Google Scholar] [CrossRef]
  4. Ploetz, R.; Kema, G.H.J.; Ma, L.J. Impact of diseases on export and smallholder production of banana. Annu. Rev. Phytopathol. 2015, 53, 269–288. [Google Scholar] [CrossRef]
  5. Kaliapan, K.; Mazlin, S.N.A.; Chua, K.O.; Rejab, N.A.; Mohd-Yusuf, Y. Secreted in Xylem (SIX) genes in Fusarium oxysporum f. sp. cubense (Foc) unravels the potential biomarkers for early detection of Fusarium wilt disease. Arch. Microbiol. 2024, 206, 271. [Google Scholar] [CrossRef]
  6. Molina, A.B.; Fabregar, E.; Sinohin, V.G.; Yi, G.; Viljoen, A. Recent Occurrence of Fusarium oxysporum f. sp. cubense Tropical Race 4 in Asia. Acta Hortic. 2009, 828, 109–114. [Google Scholar] [CrossRef]
  7. Viljoen, A.; Mostert, D.; Chiconela, T.; Beukes, I.; Fraser, C.; Dwyer, J.; Murray, H.; Amisse, J.; Matabuana, E.L.; Tazan, G.; et al. Occurrence and spread of the banana fungus Fusarium oxysporum f. sp. cubense TR4 in Mozambique. S. Afr. J. Sci. 2020, 116, 88–98. [Google Scholar] [CrossRef]
  8. García, B.F.A.; Quintero, V.J.C.; Ayala, V.M.; Schermer, T.; Seidi, M.F.; Santos, P.M.; Noguera, A.M.; Aguilera, G.C.; Wittenberg, A.; Hofstede, R.; et al. First report of Fusarium wilt tropical race 4 in Cavendish bananas caused by Fusarium odoratissimum in Colombia. Plant Dis. 2019, 104, 994. [Google Scholar] [CrossRef]
  9. Acuña, R.; Rouard, M.; Leiva, A.M.; Marques, C.; Olortegui, J.A.; Ureta, C.; Cabrera-Pintado, R.M.; Rojas, J.C.; Lopez-Alvarez, D.; Cenci, A.; et al. First report of Fusarium oxysporum f. sp. cubense Tropical Race 4 causing Fusarium wilt in Cavendish bananas in Peru. Plant Dis. 2022, 106, 2268. [Google Scholar] [CrossRef]
  10. Mejías, H.R.; Hernández, Y.; Magdama, F.; Mostert, D.; Bothma, S.; Paredes, S.E.M.; Terán, D.; González, E.; Angulo, R.; Angel, L.; et al. First Report of Fusarium wilt of Cavendish bananas caused by Fusarium oxysporum f. sp. cubense Tropical Race 4 in Venezuela. Plant Dis. 2023, 107, 3297. [Google Scholar] [CrossRef]
  11. Martínez, G.; Olivares, B.O.; Rey, J.C.; Rojas, J.; Cardenas, J.; Puentes, C.; Dawson, C. The advance of Fusarium wilt Tropical Race 4 in musaceae of Latin America and the Caribbean: Current situation. Pathogens 2023, 12, 277. [Google Scholar] [CrossRef]
  12. Ndayihanzamaso, P.; Karangwa, P.; Mostert, D.; Mahuku, G.; Blomme, G.; Swennen, R.; Viljoen, A. The development of a multiplex PCR assay for the detection of Fusarium oxysporum f. sp. cubense lineage VI strain in East and Central Africa. Eur. J. Plant Pathol. 2020, 158, 495–509. [Google Scholar] [CrossRef]
  13. Dita, M.; Barquero, M.; Heck, D.; Mizubuti, E.S.G.; Staver, C.P. Fusarium Wilt of Banana: Current Knowledge on Epidemiology and Research Needs Toward Sustainable Disease Management. Front. Plant Sci. 2018, 9, 1468. [Google Scholar] [CrossRef]
  14. Fang, H.; Zhong, C.; Sun, J.; Chen, H. Revealing the different mechanisms of banana ‘Guijiao 9’to Fusarium oxysporum f. sp. cubense tropical race 4 using comparative proteomic analysis. J. Proteom. 2023, 283–284, 104937. [Google Scholar] [CrossRef]
  15. Mintoff, S.J.L.; Nguyen, T.V.; Kelly, C.; Cullen, S.; Hearden, M.; Williams, R.; Daniells, J.W.; Tran-Nguyen, T.T. Banana cultivar field screening for resistance to Fusarium oxysporum f. sp. cubense Tropical race 4 in the Northern territory. J. Fungi 2021, 7, 627. [Google Scholar] [CrossRef]
  16. Dale, J.; James, A.; Paul, J.Y.; Khanna, H.; Smith, M.; Peraza-Echeverria, S.; García-Bastidas, F.; Kema, G.; Waterhouse, P.; Mengersen, K.; et al. Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4. Nat. Commun. 2017, 8, 1496. [Google Scholar] [CrossRef] [PubMed]
  17. Izquierdo-García, L.F.; Carmona-Gutierrez, S.L.; Moreno-Velandia, C.A.; Villarreal-Navarrete, A.D.P.; Burbano-David, D.M.; Quiroga-Mateus, R.Y.; Gómez-Marroquín, M.R.; Rodríguez-Yzquierdo, G.A.; Betancourt-Vásquez, M. Microbial based biofungicides mitigate the damage caused by Fusarium oxysporum f. sp. cubense race 1 and improve the physiological performance in banana. J. Fungi 2024, 10, 419. [Google Scholar] [CrossRef]
  18. Wang, J.; Cai, B.; Li, K.; Zhao, Y.; Li, C.; Liu, S.; Xiang, D.; Zhang, L.; Xie, J.; Wang, W. Biological control of Fusarium oxysporum f. sp. cubense Tropical Race 4 in banana plantlets using newly isolated Streptomycin sp. WHL7 from marine soft coral. Plant Dis. 2022, 106, 254–259. [Google Scholar] [CrossRef]
  19. Lopez-Moya, F.; Zorrilla-Fontanesi, Y.; Lozano-Soria, A.; Ganado, N.F.L.; Moreno-Gonzalez, C.M.; Hernández, A.; Torres, A.; Gonzalez-Silvera, D.; Gunsé, B.; López-Jiménez, J.A.; et al. Chitosan induces salicylic acid and methyl salicylate in banana plants and reduces colonization by Fusarium oxysporum f. sp. cubense TR4. Curr. Plant Biol. 2025, 42, 100457. [Google Scholar] [CrossRef]
  20. Yang, J.; Duan, Y.; Liu, X.; Sun, M.; Wang, Y.; Liu, M.; Zhu, Z.; Shen, Z.; Gao, W.; Wang, B.; et al. Reduction of banana Fusarium wilt associated with soil microbiome reconstruction through green mature intercropping. Agric. Ecosyst. Environ. 2022, 337, 108065. [Google Scholar] [CrossRef]
  21. Zhang, H.; Mallik, A.; Zeng, R.S. Control of Panama Disease of banana by rotating and intercropping with Chinese Chive (Allium tuberosum Rottler): Role of plant volatiles. J. Chem. Ecol. 2013, 39, 243–252. [Google Scholar] [CrossRef] [PubMed]
  22. Hong, S.; Ju, H.; Lu, M.; Wang, B.; Zhao, Y.; Ruan, Y. Significant decline in banana Fusarium wilt disease is associated with soil microbiome reconstruction under chili pepper-banana rotation. Eur. J. Soil Biol. 2020, 97, 103154. [Google Scholar] [CrossRef]
  23. Lin, Y.; Zhang, D.; Shan, S.; Zhang, W.; Li, R.; Zhang, A. Fluorine-containing amphiphilic quaternary ammonium salts for the suppression of Banana fusarium wilt. React. Funct. Polym. 2022, 182, 105488. [Google Scholar] [CrossRef]
  24. Salacinas, M.; Meijer, H.J.G.; Mamora, S.H.; Corcolon, B.; Gohari, A.M.; Ghimire, B.; Kema, G.H.J. Efficacy of disinfectants against Tropical Race 4 causing Fusarium wilt in Cavendish bananas. Plant Dis. 2022, 106, 966–974. [Google Scholar] [CrossRef] [PubMed]
  25. Cannon, S.; Kay, W.; Kilaru, S.; Schuster, M.; Gurr, S.J.; Steinberg, G. Multi-site fungicides suppress banana Panama disease, caused by Fusarium oxysporum f. sp. cubense Tropical Race 4. PLoS Pathog. 2022, 18, e1010860. [Google Scholar] [CrossRef]
  26. Calo, J.R.; Crandall, P.G.; O’Bryan, C.A.; Ricke, S.C. Essential oils as antimicrobials in food systems—A review. Food Control 2015, 54, 111–119. [Google Scholar] [CrossRef]
  27. Tariq, S.; Wani, S.; Rasool, W.; Shafi, K.; Bhat, M.A.; Prabhakar, A.; Shalla, A.H.; Rather, M.A. A comprehensive review of the bacterial, antifungal and antiviral potential of essential oils and their chemical constituents against drug-resistant microbial pathogens. Microb. Pathog. 2019, 134, 103580. [Google Scholar] [CrossRef]
  28. Sivakumar, D.; Bautista, B.S. A review on the use of essential oils for post harvest decay control and maintenance of fruit quality during storage. Crop Prot. 2014, 64, 27–37. [Google Scholar] [CrossRef]
  29. Li, Z.; Wang, T.; He, C.; Cheng, K.; Zeng, R.; Song, Y. Control of Panama disease of banana by intercropping with Chinese chive (Allium tuberosum Rottler): Cultivar differences. BMC Plant Biol. 2020, 20, 432. [Google Scholar] [CrossRef] [PubMed]
  30. Paramalingam, P.; Baharum, N.A.; Abdullah, J.O.; Hong, J.K.; Saidi, N.B. Antifungal potential of Melaleuca alternifolia against fungal pathogen Fusarium oxysporum f. sp. cubense Tropical Race 4. Molecules 2023, 28, 4456. [Google Scholar] [CrossRef]
  31. Abdullahi, A.; Khairulmazmi, A.; Yasmeen, S.; Ismail, I.S.; Norhayu, A.; Sulaiman, M.R.; Ahmed, O.H.; Ismail, M.R. Phytochemical profiling and antimicrobial activity of ginger (Zingiber officinale) essential oils against important phytopathogens. Arab. J. Chem. 2020, 13, 8012–8025. [Google Scholar] [CrossRef]
  32. Ramírez-Mejía, J.M.; Aguilera-Galvez, C.; Kema, G.H.J.; Valencia-Riascos, L.M.; Zapata-Henao, S.; Gómez, L.A.; Villegas-Escobar, V. Combining cyclic lipopeptides and cinnamon extract enhance antifungal activity against Fusarium oxysporum strains pathogenic to banana and delay Fusarium wilt under greenhouse conditions. Trop. Plant Pathol. 2024, 49, 838–849. [Google Scholar] [CrossRef]
  33. Goncalves, D.C.; de Queiroz, V.T.; Costa, A.V.; Lima, W.P.; Belan, L.L.; Moraes, W.B.; Iorio, N.L.P.P.; Póvoa, H.C.C. Reduction of Fusarium wilt symptoms in tomato seedlings following seed treatment with Origanum vulgare L. Essential oil and carvacrol. Crop Prot. 2021, 141, 105487. [Google Scholar] [CrossRef]
  34. Sarathambal, C.; Rajagopal, S.; Viswanathan, R. Mechanism of antioxidant and antifungal properties of Pimenta dioica (L.) leaf essential oil on Aspergillus flavus. J. Food Sci. Technol. 2020, 58, 2497–2506. [Google Scholar] [CrossRef]
  35. Kamsu, N.P.; Tchinda, S.E.; Tchamenj, N.S.; Jazet, D.P.M.; Madjouko, M.A.; Youassi, O.Y.; Sameza, M.L.; Tchoumbougnang, F.; Menut, C. Antifungal activities of essential oils of cinnamon (Cinnamomum zeylanicum) and lemongrass (Cymbopogon citratus) on crown rot pathogens of banana. Indian Phytopathol. 2018, 72, 131–137. [Google Scholar] [CrossRef]
  36. Orr, R.; Nelson, P.N. Eucalyptus cloeziana mulch suppresses Fusarium wilt of banana. Crop Prot. 2021, 147, 105694. [Google Scholar] [CrossRef]
  37. Asbahani, A.E.; Miladi, K.; Badri, W.; Sala, M.; Addi, E.H.A.; Casabianca, H.; Mousadik, A.E.; Hartmann, D.; Jilale, A.; Renaud, F.N.R.; et al. Essential oils: From extraction to encapsulation. Int. J. Pharm. 2015, 483, 220–243. [Google Scholar] [CrossRef]
  38. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing: Oxford, UK, 2006. [Google Scholar] [CrossRef]
  39. Li, W.; Dita, M.; Wu, W.; Hu, G.; Xie, J.; Ge, X.J. Resistance sources to Fusarium oxysporum f. sp. cubense tropical race 4 in banana wild relatives. Plant Pathol. 2014, 64, 1061–1067. [Google Scholar] [CrossRef]
  40. Thomidis, T.; Filotheou, A. Evaluation of five essential oils as bio-fungicides on the control of Pilidiella granati rot in pomegranate. Crop Prot. 2017, 89, 66–71. [Google Scholar] [CrossRef]
  41. Pola, C.C.; Medeiros, E.A.A.; Pereira, O.L.; Souza, V.G.L.; Otoni, C.G.; Camilloto, G.P.; Soares, N.F.F. Cellulose acetate active films incorporated with oregano (Origanum vulgare) essential oil and organophilic montmorillonite clay control the growth of phytophatogenic fungi. Food Packag. Shelf Life 2016, 9, 69–78. [Google Scholar] [CrossRef]
  42. Lavin, P.; Gómez, S.S.; Guiamet, P. Scopulariopsis sp. and Fusarium sp, in the documentary heritage: Evaluation of their biodeterioration ability and antifungal effect of two essential oils. Microb. Ecol. 2016, 71, 628–633. [Google Scholar] [CrossRef] [PubMed]
  43. Valente, J.S.; Fonseca, A.O.S.; Denardi, L.B.; Ben, V.S.D.; Filho, F.S.M.; Baptista, C.T.; Braga, C.Q.; Zambrano, C.G.; Alves, S.H.; Botton, S.A.; et al. In vitro susceptibility of Pythium insidiosum to Melaleuca alternifolia, Mentha piperita and Origanum vulgare essential oils combinations. Mycopathologia 2016, 181, 617–622. [Google Scholar] [CrossRef] [PubMed]
  44. Huang, Y.H.; Wang, R.C.; Li, C.H.; Zuo, C.W.; Wei, Y.R.; Zhang, L.; Yi, G.J. Control of Fusarium wilt in banana with Chinese leek. Eur. J. Plant Pathol. 2012, 134, 87–95. [Google Scholar] [CrossRef]
  45. Dima, C.; Cotarlet, M.; Alexe, P.; Dima, S. Reprint of “Microencapsulation of essential oil of pimento (Pimenta dioica (L) Merr.) by chitosan/k-carrageenan complex coacervation method”. Inn. Food Sci. Emerg. Technol. 2014, 25, 97–105. [Google Scholar] [CrossRef]
  46. Monteiro, O.S.; Souza, A.G.; Soledade, L.E.B.; Queiroz, N.; Souza, A.L.; Filho, V.E.M.; Vasconcelos, A.F.F. Chemical evaluation and thermal analysis of the essential oil from the fruits of the vegetable species Pimenta dioica Lindl. J. Therm. Anal. Calorim. 2011, 106, 595–600. [Google Scholar] [CrossRef]
  47. Jiang, Z.T.; Feng, X.; Li, R.; Wang, Y. Composition comparison of essential oils extracted by classical hydro distillation and microwave-assisted hydrodistillation from Pimenta dioica. J. Essent. Oil-Bear. Plants 2013, 16, 45–50. [Google Scholar] [CrossRef]
  48. De Elguea-Culebras, G.O.; Panamá_Tapia, L.A.; Melero-Bravo, E.; Cerro-Ibáñez, N.; Calvo-Martínez, A.; Sánchez-Vioque, R. Comparison of the phenolic composition and biological capacities of wastewater from Origanum vulgare L., Rosmarinus officialIs L., Salvia lavandulifolia Vahl. and Thymus mastichina L. resulting from two hydrostillation systems: Clevenger and MAE. J. Appl. Res. Med. Aromat. Plants 2023, 34, 100480. [Google Scholar] [CrossRef]
  49. Marques, C.S.; Carvalho, S.G.; Bertoli, L.D.; Villanova, J.C.O.; Pinheiro, P.F.; dos Santos, D.C.M.; Yoshida, M.I.; de Freitas, J.C.C.; Cipriano, D.F.; Bernardes, P.C. B-Cyclodextrin inclusion complexes with essential oils: Obtention, characterization, antimicrobial activity and potential application for food preservative sachets. Food Res. Int. 2019, 119, 499–509. [Google Scholar] [CrossRef]
  50. Pezzani, R.; Vitalini, S.; Iriti, M. Bioactivities of Origanum vulgare L.: An update. Phytochem. Rev. 2017, 16, 1253–1268. [Google Scholar] [CrossRef]
  51. Zhang, M.; Ge, J.; Yu, X. Transcriptome analysis reveals the mechanism of fungicidal of thymol against Fusarium oxysporum f. sp. niveum. Curr. Microbiol. 2018, 75, 410–419. [Google Scholar] [CrossRef]
Figure 1. Silk banana plants with wilt Fusarium symptoms. (A) External symptoms on leaves. (B) Internal pseudostem necrosis on vascular tissues. (C) FOC race 1 on PDA medium.
Figure 1. Silk banana plants with wilt Fusarium symptoms. (A) External symptoms on leaves. (B) Internal pseudostem necrosis on vascular tissues. (C) FOC race 1 on PDA medium.
Agronomy 15 02682 g001
Figure 2. Antifungal effect of oregano (Origanum vulgare) essential oil against mycelium growth of FOC race 1. (A) Control; (B) 100; (C) 500; (D) 1000; (E) 3000; and (F) 5000 (μL L−1).
Figure 2. Antifungal effect of oregano (Origanum vulgare) essential oil against mycelium growth of FOC race 1. (A) Control; (B) 100; (C) 500; (D) 1000; (E) 3000; and (F) 5000 (μL L−1).
Agronomy 15 02682 g002
Figure 3. Silk banana vitroplants 84 days after inoculation with Foc race 1 and treated with oregano (Origanum vulgare) essential oil. (A): control; (B): 500; (C): 750; (D): 1000; (E): 3000; and (F): 5000 μL L−1.
Figure 3. Silk banana vitroplants 84 days after inoculation with Foc race 1 and treated with oregano (Origanum vulgare) essential oil. (A): control; (B): 500; (C): 750; (D): 1000; (E): 3000; and (F): 5000 μL L−1.
Agronomy 15 02682 g003
Figure 4. Effect of oregano essential oil treatment on severity index (%) of Fusarium wilt banana on Silk banana plants. Values shown are means ± SE (n = 4).
Figure 4. Effect of oregano essential oil treatment on severity index (%) of Fusarium wilt banana on Silk banana plants. Values shown are means ± SE (n = 4).
Agronomy 15 02682 g004
Table 1. Chemical composition and retention time (TR) of oregano (O. vulgare) essential oil (OEO).
Table 1. Chemical composition and retention time (TR) of oregano (O. vulgare) essential oil (OEO).
CompoundConcentration (%)TR * (min)
1-Methyl-4-(1-methylethenyl)-cyclohexene (D-Limonene)6.197.13
β-cis-Terpineol2.207.85
5-Isopropyl-2-methylphenol (Carvacrol)1.0612.28
3-Allyl-6-methoxyphenol (Eugenol)76.3114.64
α-Bergamotene3.1017.27
3-tert-butil-4-hidroxianisole2.3518.28
Eucalyptol0.2419.18
β-Bisaboleno0.4419.65
β-Tujeno0.806.41
o-Cimeno0.636.95
Borneol0.568.75
3-Tujen-2-ona0.4610.67
Metileugenol0.3915.86
P-thymol0.2114.30
Caryophilen0.2116.82
2-isopropil-5-methylisol0.2310.74
4-tert-Butilcatecol0.2117.62
Caryophilen oxid0.2722.28
β-Bisabolen0.4419.65
α-Cariophylen0.8917.81
β-cis-Ocimen0.397.27
Viridifloreno0.7919.18
* TR. Retention time
Table 2. Inhibition of FOC race 1 mycelial growth by oregano essential oil after eight days of incubation.
Table 2. Inhibition of FOC race 1 mycelial growth by oregano essential oil after eight days of incubation.
Essential OilEO Concentration (μL L−1)/FOC Race 1 Inhibition of Mycelial Growth (%)Pr > F
100500100030005000
O. vulgare34.8 b *100 ± 0.0 a100 a100 a100 a0.0001
* The values are presented as percentage inhibition of mycelial radial growth and correspond to the average of four repetitions ± standard error. Values with the same letter indicate no significant differences according to Tukey’s test (p ≤ 0.05).
Table 3. Determination of minimum inhibitory concentration (MIC) of FOC race 1 to oregano essential oil.
Table 3. Determination of minimum inhibitory concentration (MIC) of FOC race 1 to oregano essential oil.
Essential OilB ± EE &MIC (μL L−1) *P > X2 ***
MIC50 *MIC95 **
O. vulgare2.31 ± 0.11111.2 (104.1–118.9)174.1 (155.9–208.2)0.0001
B = value of the slope; & = standard error of the slope; *** = probability that the log-dose probit line fits to a straight line. * MIC50 = minimum inhibitory concentration 50; ** MIC95 = minimum inhibitory concentration 95.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Oltehua-Vázquez, M.; Martínez-Bolaños, S.S.; López-Martínez, V.; Diaz-Trujillo, C.; Orozco-Santos, M.; Vallejo-Pérez, M.R.; Manzo-Sánchez, G.; Martínez-Bolaños, L. Antifungal Activity of Oregano Essential Oil Against Fusarium oxysporum f. sp. cubense Race 1 and Fusarium Wilt Disease on Silk Banana Plants. Agronomy 2025, 15, 2682. https://doi.org/10.3390/agronomy15122682

AMA Style

Oltehua-Vázquez M, Martínez-Bolaños SS, López-Martínez V, Diaz-Trujillo C, Orozco-Santos M, Vallejo-Pérez MR, Manzo-Sánchez G, Martínez-Bolaños L. Antifungal Activity of Oregano Essential Oil Against Fusarium oxysporum f. sp. cubense Race 1 and Fusarium Wilt Disease on Silk Banana Plants. Agronomy. 2025; 15(12):2682. https://doi.org/10.3390/agronomy15122682

Chicago/Turabian Style

Oltehua-Vázquez, Marisol, Syl Soledad Martínez-Bolaños, Victor López-Martínez, Caucasella Diaz-Trujillo, Mario Orozco-Santos, Moisés Roberto Vallejo-Pérez, Gilberto Manzo-Sánchez, and Luciano Martínez-Bolaños. 2025. "Antifungal Activity of Oregano Essential Oil Against Fusarium oxysporum f. sp. cubense Race 1 and Fusarium Wilt Disease on Silk Banana Plants" Agronomy 15, no. 12: 2682. https://doi.org/10.3390/agronomy15122682

APA Style

Oltehua-Vázquez, M., Martínez-Bolaños, S. S., López-Martínez, V., Diaz-Trujillo, C., Orozco-Santos, M., Vallejo-Pérez, M. R., Manzo-Sánchez, G., & Martínez-Bolaños, L. (2025). Antifungal Activity of Oregano Essential Oil Against Fusarium oxysporum f. sp. cubense Race 1 and Fusarium Wilt Disease on Silk Banana Plants. Agronomy, 15(12), 2682. https://doi.org/10.3390/agronomy15122682

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop