Screening of Positive Controls for Environmental Safety Assessment of RNAi Products
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Strain and Rearing
2.2. Isolation of Total RNA and cDNA Synthesis
2.3. miRNA Agomir, Mimics NC, dsRNA Preparation
2.4. Effects of miRNA and dsRNA on Larval Development
2.5. Real-Time Quantitative PCR
2.6. Data Analysis
3. Results
3.1. Effect of miRNA on Larval Survival Rate
3.2. Effect of dsRNA on Larval Survival Rate
3.3. The Expression Levels of Target Genes of dsRNA
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Jadhav, V.; Vaishnaw, A.; Fitzgerald, K.; Maier, M.A. RNA interference in the era of nucleic acid therapeutics. Nat. Biotechnol. 2024, 42, 394–405. [Google Scholar] [CrossRef] [Scilit]
- Luo, X.; Nanda, S.; Zhang, Y.J.; Zhou, X.G.; Yang, C.X.; Pan, H.P. Risk assessment of RNAi-based biopesticides. New Crops 2024, 1, 100019. [Google Scholar] [CrossRef] [Scilit]
- Zotti, M.; Dos Santos, E.A.; Cagliari, D.; Christiaens, O.; Taning, C.N.T.; Smagghe, G. RNA interference technology in crop protection against arthropod pests, pathogens and nematodes. Pest Manag. Sci. 2018, 74, 1239–1250. [Google Scholar] [CrossRef] [Scilit]
- Guan, R.B.; Li, H.C.; Miao, X.X. Commercialization Status and Existing Problems of RNA. Sci. Agric. Sin. 2022, 55, 2949–2960. [Google Scholar] [CrossRef]
- Schiemann, J.; Dietz-Pfeilstetter, A.; Hartung, F.; Kohl, C.; Romeis, J.; Sprink, T. Risk assessment and regulation of plants modified by modern biotechniques: Current status and future challenges. Annu. Rev. Plant Biol. 2019, 70, 699–726. [Google Scholar] [CrossRef] [Scilit]
- Papadopoulou, N.; Devos, Y.; Álvarez-Alfageme, F.; Lanzoni, A.; Waigmann, E. Risk assessment considerations for genetically modified RNAi plants: Efsa’s activities and perspective. Front. Plant Sci. 2020, 11, 445. [Google Scholar] [CrossRef] [Scilit]
- Camastra, F.; Ciaramella, A.; Giovannelli, V.; Lener, M.; Rastelli, V.; Staiano, A.; Staiano, G.; Starace, A. TÉRA: A tool for the environmental risk assessment of genetically modified plants. Ecol. Inform. 2014, 24, 186–193. [Google Scholar] [CrossRef] [Scilit]
- Meyer, H. Systemic risks of genetically modified crops: The need for new approaches to risk assessment. Environ. Sci. Eur. 2011, 23, 7. [Google Scholar] [CrossRef] [Scilit]
- Yahaya, U.; Suleiman, R.A.; Hussaini, Y.; Hamidu, S.T.; Odey, B.O.; Adaaja, B.O. Environmental risk and biosafety of genetically modified plants. Niger. J. Biotechnol. 2024, 41, 104–108. [Google Scholar] [CrossRef] [Scilit]
- Kearns, P.; Suwabe, K.; Dagallier, B.; Hermans, W.; Oladini-James, C. Genetically modified organisms, environmental risk assessment and regulations. J. Verbraucherschutz Leb. 2014, 9, 25–29. [Google Scholar] [CrossRef] [Scilit]
- Evans, E.W. Lady beetles as predators of insects other than Hemiptera. Biol. Control 2009, 51, 255–267. [Google Scholar] [CrossRef] [Scilit]
- Lu, B.R. Potential commercialization of genetically modified rice in China: Key questions for environmental biosafety assessments. Nongye Shengwu Jishu Xuebao (J. Agric. Biotechnol.) 2008, 5, 547–554. [Google Scholar] [CrossRef]
- Roberts, A.F.; Devos, Y.; Lemgo, G.N.Y.; Zhou, X.G. Biosafety research for non-target organism risk assessment of RNAi-based GE plants. Front. Plant Sci. 2015, 6, 958. [Google Scholar] [CrossRef] [Scilit]
- Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.L.; Barthel, A.; et al. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [Scilit]
- Head, G.P.; Carroll, M.W.; Evans, S.P.; Rule, D.M.; Willse, A.R.; Clark, T.L.; Storer, N.P.; Flannagan, R.D.; Samuel, L.W.; Meinke, L.J. Evaluation of SmartStax and SmartStax PRO maize against western corn rootworm and northern corn rootworm: Efficacy and resistance management. Pest Manag. Sci. 2017, 73, 1883–1899. [Google Scholar] [CrossRef] [Scilit]
- Bachmann, P.M.; Huizinga, K.M.; Jensen, P.D.; Mueller, G.; Tan, J.; Uffman, J.P. Ecological risk assessment for DvSnf7 RNA: A plant-incorporated protectant with targeted activity against western corn rootworm. Regul. Toxicol. Pharmacol. 2016, 81, 77–88. [Google Scholar] [CrossRef] [Scilit]
- Rodrigues, T.B.; Mishra, S.K.; Sridharan, K.; Barnes, E.R.; Alyokhin, A.; Tuttle, R.; Narva, K.E. First sprayable double-stranded RNA-based biopesticide product targets proteasome subunit beta type-5 in Colorado potato beetle (Leptinotarsa decemlineata). Front. Plant Sci. 2021, 12, 728652. [Google Scholar] [CrossRef] [Scilit]
- Wenninger, E.J.; Degrey, S.P.; Insinga, J.; Knopf, E.; Alyokhin, A.; Barnes, E.R.; Piaskowski, J. Responses of non-target arthropods to the dsRNA bioinsecticide Calantha™ and conventional insecticides targeting Colorado potato beetle, Leptinotarsa decemlineata (Say). Am. J. Potato Res. 2025, 102, 129–151. [Google Scholar] [CrossRef] [Scilit]
- Romeis, J.; Widmer, F. Assessing the risks of topically applied dsRNA-based products to non-target arthropods. Front. Plant Sci. 2020, 11, 679. [Google Scholar] [CrossRef] [Scilit]
- Romeis, J.; Hellmich, R.L.; Candolfi, M.P.; Carstens, K.; De Schrijver, A.; Gatehouse, A.M.R.; Herman, R.A.; Huesing, J.E.; McLean, M.A.; Raybould, A.; et al. Recommendations for the design of laboratory studies on non-target arthropods for risk assessment of genetically engineered plants. Transgenic Res. 2011, 20, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Vélez, A.M.; Jurzenski, J.; Matz, N.; Zhou, X.; Wang, H.; Ellis, M. Developing an in vivo toxicity assay for RNAi risk assessment in honey bees, Apis mellifera L. Chemosphere. 2016, 144, 1083–1090. [Google Scholar] [CrossRef] [Scilit]
- Haller, S.; Widmer, F.; Siegfried, B.D.; Zhou, X.; Romeis, J. Responses of two ladybird beetle species (Coleoptera: Coccinellidae) to dietary RNAi. Pest Manag. Sci. 2019, 75, 2652–2662. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.; Yang, X.; Bidne, K.; Hellmich, R.L.; Siegfried, B.D.; Zhou, X. Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae. Front. Plant Sci. 2017, 8, 242. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.; Yang, X.; Romeis, J.; Siegfried, B.D.; Zhou, X. Dietary RNAi toxicity assay exhibits differential responses to ingested dsRNAs among ladybeetles. Pest Manag. Sci. 2020, 76, 3606–3614. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.; Xu, L.; Noland, J.E.; Li, H.; Siegfried, B.D.; Zhou, X. Assessment of potential risks of dietary RNAi to a soil micro-arthropod, Sinella curviseta Brook (Collembola: Entomobryidae). Front. Plant Sci. 2016, 7, 1028. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Q.L.; Han, L.G.; Li, Y.H.; Li, J.; Yang, X.W. Neutral dietary effects of two microRNAs, Csu-Novel-260 and Csu-Mir-14, on the non-target arthropod Folsomia candida. Plants 2023, 12, 1885. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.J.; Wang, H.L.; Yang, X.W.; Chen, G.; Du, L.X.; Chen, H.; Li, Y.H.; Peng, Y.F.; Han, L.Z. Consumption of miRNA-mediated insect-resistant transgenic rice pollen does not harm Apis mellifera adults. J. Agric. Food Chem. 2021, 69, 4234–4242. [Google Scholar] [CrossRef] [Scilit]
- Chen, R.; Zhuang, Y.T.; Wang, M.L.; Yu, J.; Chi, D.F. Transcriptomic analysis of the response of the Dioryctria abietella larva midgut to Bacillus thuringiensis 2913 infection. Int. J. Mol. Sci. 2024, 25, 10921. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Cui, H.W.; Duan, W.Y. Ecotoxicity of chlorpyrifos to aquatic organisms: A review. Ecotoxicol. Environ. Safe 2020, 200, 110731. [Google Scholar] [CrossRef] [Scilit]
- Slotkin, T.A.; Levin, E.D.; Seidler, F.J. Comparative developmental neurotoxicity of organophosphate insecticides: Effects on brain development are separable from systemic toxicity. Environ. Health Perspect. 2006, 114, 746–751. [Google Scholar] [CrossRef] [Scilit]
- Zhong, X.; Yu, X.D.; Zhang, J.H.; Xu, J.J.; Qin, M.C.; Cao, M.X.; Francis, F.; Xia, L.Q. RNAi technologies for insect control in crop protection. Crop J. 2025, 5, 6. [Google Scholar] [CrossRef] [Scilit]
- Zhu, K.Y.; Palli, S.R. Mechanisms, applications, and challenges of insect RNA interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef] [Scilit]
- Joga, M.R.; Zotti, M.J.; Smagghe, G.; Christiaens, O. RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: What we know so far. Front. Physiol. 2016, 7, 553. [Google Scholar] [CrossRef] [Scilit]
- Guven-Ozkan, T.; Busto, G.U.; Jung, J.Y.; Drago, I.; Davis, R.L. Mir-92a suppresses mushroom body-dependent memory consolidation in Drosophila. eNeuro 2020, 7, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Delanoue, R.; Legent, K.; Godefroy, N.; Flagiello, D.; Dutriaux, A.; Vaudin, P.; Becker, J.L.; Silber, J. The Drosophila wing differentiation factor vestigial-scalloped is required for cell proliferation and cell survival at the dorso-ventral boundary of the wing imaginal disc. Cell Death Differ. 2004, 11, 110–122. [Google Scholar] [CrossRef] [Scilit]
- Powell, M.; Pyati, P.; Cao, M.; Bell, H.; Gatehouse, J.A.; Fitches, E. Insecticidal effects of dsRNA targeting the Diap1 gene in Dipteran pests. Sci. Rep. 2017, 7, 15147. [Google Scholar] [CrossRef] [Scilit]
- Chikami, Y.; Kawaguchi, H.; Suzuki, T.; Yoshioka, H.; Sato, Y.; Yaginuma, T.; Niimi, T. Oral RNAi of diap1 results in rapid reduction of damage to potatoes in Henosepilachna vigintioctopunctata. J. Pest Sci. 2021, 94, 505–515. [Google Scholar] [CrossRef] [Scilit]
- Koči, J.; Ramaseshadri, P.; Bolognesi, R.; Segers, G.; Flannagan, R.; Park, Y. Ultrastructural changes caused by Snf7 RNAi in larval enterocytes of western corn rootworm (Diabrotica virgifera virgifera Le Conte). PLoS ONE 2014, 9, e83985. [Google Scholar] [CrossRef] [Scilit]
- Ramaseshadri, P.; Segers, G.; Flannagan, R.; Wiggins, E.; Clinton, W.; Ilagan, O.; McNulty, B.; Clark, T.; Bolognesi, R. Physiological and cellular responses caused by RNAi- mediated suppression of Snf7 orthologue in western corn rootworm (Diabrotica virgifera virgifera) larvae. PLoS ONE 2013, 8, e54270. [Google Scholar] [CrossRef] [Scilit]
- Vatanparast, M.; Merkel, L.; Amari, K. Exogenous application of dsRNA in plant protection: Efficiency, safety concerns and risk assessment. Int. J. Mol. Sci. 2024, 25, 6530. [Google Scholar] [CrossRef] [Scilit]
- Shtam, T.A.; Kovalev, R.A.; Varfolomeeva, E.Y.; Makarov, E.M.; Kil, Y.V.; Filatov, M.V. Exosomes are natural carriers of exogenous siRNA to human cells in vitro. Cell Commun. Signal. 2013, 11, 88. [Google Scholar] [CrossRef] [Scilit]
- Baum, J.A.; Bogaert, T.; Clinton, W.; Heck, G.R.; Feldmann, P.; Ilagan, O.; Johnson, S.; Plaetinck, G.; Munyikwa, T.; Pleau, M.; et al. Control of Coleopteran Insect Pests through RNA Interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef] [Scilit]
- Brown, P.M.J.; Ingels, B.; Wheatley, A.; Rhule, E.L.; De Clercq, P.; Van Leeuwen, T.; Thomas, A. Intraguild predation by Harmonia axyridis (Coleoptera: Coccinellidae) on native insects in Europe: Molecular detection from field samples. Entomol. Sci. 2015, 18, 130–133. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Pan, H.; Yuan, L.; Zhou, X. Reference gene selection for RT-qPCR analysis in Harmonia axyridis, a global invasive lady beetle. Sci. Rep. 2018, 8, 2689. [Google Scholar] [CrossRef] [Scilit]
- Gong, Q.T. Harmonia axyridis: A natural enemy in orchards. Deciduous Fruits 2020, 52, 61. [Google Scholar] [CrossRef]
- Wang, S.; Zhang, R.Z.; Zhang, F. Research advances in the bioecology of Harmonia axyridis. China J. Appl. Ecol. 2007, 18, 2117–2126. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Swift, M.L. GraphPad Prism, Data Analysis, and Scientific Graphing. J. Chem. Inf. Comput. Sci. 1997, 37, 411–412. [Google Scholar] [CrossRef] [Scilit]
- Arpaia, S.; Christiaens, O.; Krogh, P.H.; Parker, K.M. Environmental safety assessment of plants expressing RNAi for pest control. In RNAi for Plant Improvement and Protection; Mezzetti, B., Sweet, J., Burgos, L., Eds.; CABI: Wallingford, UK, 2021; pp. 117–130. [Google Scholar]
- Choudry, M.W.; Nawaz, P.; Jahan, N.; Riaz, R.; Ahmed, B.; Raza, M.H.; Fayyaz, Z.; Malik, K.; Afzal, S. RNA based gene silencing modalities to control insect and fungal plant pests–Challenges and future prospects. Physiol. Mol. Plant Pathol. 2024, 130, 102241. [Google Scholar] [CrossRef] [Scilit]
- Li, K.; Chen, T.T.; Li, Y.L.; Sun, K.; Pang, K.; Yu, X.P.; Hao, P.Y. Risk assessment of RNAi-based potential pesticide dsNlAtg3 and its homologues for Nilaparvata lugens and non-target organisms. Insects 2025, 16, 225. [Google Scholar] [CrossRef] [Scilit]
- Lyu, Z.; Chen, J.X.; Lyu, J.; Guo, P.P.; Liu, J.H.; Liu, J.H.; Zhang, W.Q. Spraying double-stranded RNA targets UDP-N-acetylglucosamine pyrophosphorylase in the control of Nilaparvata lugens. Int. J. Biol. Macromol. 2024, 271, 132455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasan, W.; Ramesha, N.M.; Archana, B.R.; Saivamsireddy, G.; Choudhuri, S.; Parmar, S.; Charitha, K.; Pandey, S.K. Advancing RNAi-based strategies for eco-friendly and targeted insect pest management in sustainable agriculture. Exp. Agric. Int. 2024, 46, 833–863. [Google Scholar] [CrossRef] [Scilit]
- Hanamasagar, Y.; Ramesha, N.M.; Mahapatra, S.; Panigrahi, C.K.; Vidhya, C.S.; Agnihotri, N.; Satapathy, S.N. Advancing RNAi for sustainable insect management: Targeted solutions for eco-friendly pest control. J. Exp. Agric. Int. 2024, 46, 740–775. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.P.; Yan, R.; Xu, Z.Y.; Qian, J.L.; Yu, Y.F.; Zhu, S.S.; Wu, H.M.; Zhu, G.N.; Chen, M.L. Silencing of dre4 Contributes to Mortality of Phyllotreta striolata. Insects 2022, 13, 1072. [Google Scholar] [CrossRef] [Scilit]
- Silver, K.; Cooper, A.M.; Zhu, K.Y. Strategies for enhancing the efficiency of RNA interference in insects. Pest Manag. Sci. 2021, 77, 2645–2658. [Google Scholar] [CrossRef] [Scilit]
- Lü, J.; Liu, Z.Q.; Guo, W.; Guo, M.J.; Chen, S.M.; Li, H.L.; Yang, C.X.; Zhang, Y.J.; Pan, H.P. Feeding delivery of dsHvSnf7 is a promising method for management of the pest Henosepilachna vigintioctopunctata (Coleoptera: Coccinellidae). Insects 2019, 11, 34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, D.; Mao, J.; Li, C.; Zhang, W.Q. Screening of safe and efficient RNAi target genes in Nilaparvata lugens and pest control effect of Snf7 homologous gene. J. Sun Yat-Sen Univ. 2020, 59, 1–11. [Google Scholar] [CrossRef]
- Singh, S.; Gupta, M.; Pandher, S.; Kaur, G.; Goel, N.; Rathore, P.; Palli, S.R. RNA sequencing, selection of reference genes and demonstration of feeding RNAi in Thrips tabaci (Lind.) (Thysanoptera: Thripidae). BMC Mol. Biol. 2019, 20, 6. [Google Scholar] [CrossRef] [Scilit]
- Christiaens, O.; Prentice, K.; Pertry, I.; Ghislain, M.; Bailey, A.; Niblett, C.; Gheysen, G.; Smagghe, G. RNA interference: A promising biopesticide strategy against the African Sweetpotato Weevil Cylas brunneus. Sci. Rep. 2016, 6, 38836. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Primer Name | Sequence (5′-3′) |
|---|---|
| HaSnf7-F | T7-CGGATGAAGCACCAAGTACG |
| HaSnf7-R | T7-TCAGGAAGTTTGTTTGTAGGCA |
| HaDiap1-F | T7-AAACCCATAGACCTGGCTGC |
| HaDiap1-R | T7-TCAAGGCTGACGCACAATCT |
| Primer Name | Sequence (5′-3′) |
|---|---|
| HaSnf7-F | TGGGCCTCATAAGGACAAAT |
| HaSnf7-R | ATTCATAATGAGGCAACGTTCT |
| HaDiap1-F | GCAGCAGTACACTCATTCCT |
| HaDiap1-R | GGTCTTCAGTCGGTCTATTGTT |
| HaRP49-F | GCGATCGCTATGGAAAACTC |
| HaRP49-R | TACGATTTTGCATCAACAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, K.; Yang, X.; Zhou, Q.; Chen, G.; Chen, F.; Tan, Y.; Li, J.; Han, L. Screening of Positive Controls for Environmental Safety Assessment of RNAi Products. Agronomy 2025, 15, 2399. https://doi.org/10.3390/agronomy15102399
Ding K, Yang X, Zhou Q, Chen G, Chen F, Tan Y, Li J, Han L. Screening of Positive Controls for Environmental Safety Assessment of RNAi Products. Agronomy. 2025; 15(10):2399. https://doi.org/10.3390/agronomy15102399
Chicago/Turabian StyleDing, Kaixuan, Xiaowei Yang, Qinli Zhou, Geng Chen, Fengping Chen, Yao Tan, Jing Li, and Lanzhi Han. 2025. "Screening of Positive Controls for Environmental Safety Assessment of RNAi Products" Agronomy 15, no. 10: 2399. https://doi.org/10.3390/agronomy15102399
APA StyleDing, K., Yang, X., Zhou, Q., Chen, G., Chen, F., Tan, Y., Li, J., & Han, L. (2025). Screening of Positive Controls for Environmental Safety Assessment of RNAi Products. Agronomy, 15(10), 2399. https://doi.org/10.3390/agronomy15102399

