Exploratory Field Case Study of Microbial and Resistance Genes Dynamics in the Maize Phyllosphere Following Fertigation with Anaerobic Digestate
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Site and Climate Context
2.2. Field Design and Agronomic Practices
2.3. Anaerobic Digestate Source and Application
2.4. Use of Antibiotics in Cattle
2.5. Characterization of Anaerobic Digestate
2.6. Plant Sampling
2.7. Screening for Indicators of Fecal Contamination and Pathogens
2.8. Extraction of Total DNA from the Microbial Community
2.9. Analysis of Total Bacteria, Resistance Genes and Integrons
2.10. Statistical Analysis
3. Results
3.1. Detection of Indicators of Fecal Contamination and Pathogens
3.2. Analysis of Antibiotic Resistance Genes
4. Discussion
Limitations and Scope of the Study
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ARG | Antibiotic Resistance Genes |
| AMR | Antimicrobial Resistance |
| WHO | World Health Organization |
| MGEs | Mobile genetic elements |
| MPN | Most Probable Number |
| AD | Sample fertigated with Digestate |
| dai | Days After Fertigation |
| wai | Weeks After Fertigation |
References
- Pitt, S.J.; Gunn, A. The One Health Concept. Br. J. Biomed. Sci. 2024, 81, 12366. [Google Scholar] [CrossRef]
- World Health Organization. Antimicrobial Resistance; Fact Sheet. WHO. 2021. Available online: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance (accessed on 22 January 2025).
- Allegrini, M.; Zabaloy, M.C. Anaerobic digestates in agricultural soils: A systematic review of their effects on antibiotic resistance genes. Rev. Argent. Microbiol. 2024, 56, 394–401. [Google Scholar] [CrossRef]
- Huang, Z.; Hu, L.X.; Yang, J.B.; Liu, Y.S.; He, L.Y.; Zhao, J.L.; Ying, G.G. Comprehensive discovery and migration evaluation of antimicrobial drugs and their transformation products in a swine farm by target, suspect, and nontarget screening. Environ. Int. 2023, 181, 108304. [Google Scholar] [CrossRef]
- Samreen, A.I.; Malak, H.A.; Abulreesh, H.H. Environmental antimicrobial resistance and its drivers: A potential threat to public health. J. Glob. Antimicrob. Resist. 2021, 27, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Hoelzer, K.; Wong, N.; Thomas, J.; Talkington, K.; Jungman, E.; Coukell, A. Antimicrobial drug use in food-producing animals and associated human health risks: What, and how strong, is the evidence? BMC Vet. Res. 2017, 13, 211. [Google Scholar] [CrossRef] [PubMed]
- Forsberg, K.J.; Reyes, A.; Wang, B.; Selleck, E.M.; Sommer, M.O.; Dantas, G. The shared antibiotic resistome of soil bacteria and human pathogens. Science 2012, 337, 1107–1111. [Google Scholar] [CrossRef] [PubMed]
- Ellen MacArthur Foundation. It’s Time for a Circular Economy. 2021. Available online: https://www.ellenmacarthurfoundation.org/topics/circular-economy-introduction/overview (accessed on 3 December 2024).
- Abad-Segura, E.; González-Zamar, M.D.; Belmonte-Ureña, L.J. Effects of circular economy policies on the environment and sustainable growth: Worldwide research. Sustainability 2020, 12, 5792. [Google Scholar] [CrossRef]
- Sathish Kumar, R.K.; Sasikumar, R.; Dhilipkumar, T. Exploiting agro-waste for cleaner production: A review focusing on biofuel generation, bio-composite production, and environmental considerations. J. Clean. Prod. 2024, 435, 140536. [Google Scholar] [CrossRef]
- Hollas, C.E.; Guedes Cubas do Amaral, K.; Valles Lange, M.; Mayumi Higarashi, M.; Radis Steinmetz, R.L.; Barros, E.C.; Ferronato Mariani, L.; Nakano, V.; Kunz, A.; Sanches-Pereira, A.; et al. Life cycle assessment of waste management from the Brazilian pig chain residues in two perspectives: Electricity and biomethane production. J. Clean. Prod. 2022, 354, 131654. [Google Scholar] [CrossRef]
- Iocoli, G.A.; Zabaloy, M.C.; Pasdevicelli, G.; Gómez, M.A. Use of biogas digestates obtained by anaerobic digestion and codigestion as fertilizers: Characterization, soil biological activity and growth dynamic of Lactuca sativa L. Sci. Total Environ. 2019, 647, 11–19. [Google Scholar] [CrossRef]
- Zoui, O.; Baroudi, M.; Drissi, S.; Abouabdillah, A.; Abd-Elkader, O.H.; Plavan, G.; Bourioug, M. Utilization of digestate as an organic manure in corn silage culture: An in-depth investigation of its profound influence on soil’s physicochemical properties, crop growth parameters, and agronomic performance. Agronomy 2023, 13, 1715. [Google Scholar] [CrossRef]
- Cao, H.; Jiao, Q.; Cheng, L.; Song, L.; Xun, M.; Yang, H. Occurrence and prevalence of antibiotic resistance genes in apple orchard after continual application of anaerobic fermentation residues of pig manure. Environ. Sci. Pollut. Res. Int. 2023, 30, 29229–29242. [Google Scholar] [CrossRef] [PubMed]
- Nõlvak, H.; Truu, M.; Kanger, K.; Tampere, M.; Espenberg, M.; Loit, E.; Raave, H.; Truu, J. Inorganic and organic fertilizers impact the abundance and proportion of antibiotic resistance and integron integrase genes in agricultural grassland soil. Sci. Total Environ. 2016, 562, 678–689. [Google Scholar] [CrossRef]
- Methe, B.A.; Hiltbrand, D.; Roach, J.; Xu, W.; Gordon, S.G.; Goodner, B.W.; Stapleton, A.E. Functional gene categories differentiate maize leaf drought-related microbial epiphytic communities. PLoS ONE 2020, 15, e0237493. [Google Scholar] [CrossRef]
- Chen, Q.L.; An, X.L.; Zheng, B.X.; Ma, Y.B.; Su, J.Q. Long-term organic fertilization increased antibiotic resistome in phyllosphere of maize. Sci. Total Environ. 2018, 645, 1230–1237. [Google Scholar] [CrossRef]
- Kaul, J.; Jain, K.; Olakh, O. An overview on role of yellow maize in food, feed and nutrition security. Int. J. Curr. Microbiol. Appl. Sci. 2019, 8, 3037–3048. [Google Scholar] [CrossRef]
- USDA Natural Resources Conservation Service. Soil Survey Staff. In Keys to Soil Taxonomy, 13th ed.; USDA Natural Resources Conservation Service: Washington, DC, USA, 2022. [Google Scholar]
- Cameron, A.; McAllister, T.A. Antimicrobial usage and resistance in beef production. J. Anim. Sci. Biotechnol. 2016, 7, 68. [Google Scholar] [CrossRef]
- Dinos, G.P. The macrolide antibiotic renaissance. Br. J. Pharmacol. 2017, 174, 2967–2983. [Google Scholar] [CrossRef] [PubMed]
- Norma Técnica Para la Aplicación Agrícola de Digerido Proveniente de Plantas de Digestión Anaeróbica. Available online: https://servicios.infoleg.gob.ar/infolegInternet/anexos/315000-319999/319167/res19.pdf (accessed on 27 September 2025).
- Código Alimentario Argentino, Capítulo XI. Alimentos Vegetales. Available online: https://www.argentina.gob.ar/sites/default/files/capitulo_xi_vegetales_actualiz_2025-071.pdf (accessed on 27 September 2025).
- Zhu, B.; Chen, Q.; Chen, S.; Zhu, Y.G. Does organically produced lettuce harbor higher abundance of antibiotic resistance genes than conventionally produced? Environ. Int. 2017, 98, 152–159. [Google Scholar] [CrossRef]
- Pollock, J.; Muwonge, A.; Hutchings, M.R.; Mainda, G.; Bronsvoort, B.M.; Gally, D.; Corbishley, A. Resistance to change: AMR gene dynamics on a commercial pig farm with high antimicrobial usage. Sci. Rep. 2020, 10, 1708. [Google Scholar] [CrossRef]
- Aminov, R.I.; Chee-Sanford, J.C.; Garrigues, N.; Mehboob, A.; Mackie, R.I. Detection of tetracycline resistance genes by PCR methods. Methods Mol. Biol. 2004, 268, 3–13. [Google Scholar] [CrossRef]
- Szczepanowski, R.; Linke, B.; Krahn, I.; Gartemann, K.H.; Gützkow, T.; Eichler, W.; Pühler, A.; Schlüter, A. Detection of 140 clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology 2009, 155, 2306–2319. [Google Scholar] [CrossRef] [PubMed]
- Marti, E.; Jofre, J.; Balcazar, J.L. Prevalence of antibiotic resistance genes and bacterial community composition in a river influenced by a wastewater treatment plant. PLoS ONE 2013, 8, e78906. [Google Scholar] [CrossRef]
- Barraud, O.; Baclet, M.C.; Denis, F.; Ploy, M.C. Quantitative multiplex real-time PCR for detecting class 1, 2 and 3 integrons. J. Antimicrob. Chemother. 2010, 65, 1642–1645. [Google Scholar] [CrossRef] [PubMed]
- Quintela-Baluja, M.; Frigon, D.; Abouelnaga, M.; Jobling, K.; Romalde, J.L.; Gomez Lopez, M.; Graham, D.W. Dynamics of integron structures across a wastewater network—Implications to resistance gene transfer. Water Res. 2021, 206, 117720. [Google Scholar] [CrossRef]
- R—“Pile of Leaves”, version 4.4.2; The R Foundation for Statistical Computing: Vienna, Austria, 2024.
- Reemts, C.M.; Hansen, L.L. Short-term effects of repeated wildfires in oak-juniper woodlands. Fire Ecol. 2013, 9, 64–79. [Google Scholar] [CrossRef]
- Bicudo, J.R.; Goyal, S.M. Pathogens and manure management systems: A review. Environ. Technol. 2003, 24, 115–130. [Google Scholar] [CrossRef]
- Spencer, J.L.; Guan, J. Public health implications related to spread of pathogens in manure from livestock and poultry operations. Methods Mol. Biol. 2004, 268, 503–515. [Google Scholar] [CrossRef]
- Burch, T.R.; Spencer, S.K.; Borchardt, S.S.; Larson, R.A.; Borchardt, M.A. Fate of manure-borne pathogens during anaerobic digestion and solids separation. J. Environ. Qual. 2018, 47, 336–344. [Google Scholar] [CrossRef]
- Gantzer, C.; Gaspard, P.; Galvez, L.; Huyard, A.; Dumouthier, N.; Schwartzbrod, J. Monitoring of bacterial and parasitological contamination during various treatments of sludge. Water Res. 2001, 35, 3763–3770. [Google Scholar] [CrossRef]
- Ndubuisi-Nnaji, U.; Ofon, U.; Asira, A.E.; Dickson, N. Anaerobic digestion of untreated manure: Environmental risk assessment of resultant digestates. World J. Appl. Sci. Technol. 2023, 14, 73–79. [Google Scholar] [CrossRef]
- Albihn, A.; Vinnerås, B. Biosecurity and arable use of manure and biowaste—Treatment alternatives. Livest. Sci. 2007, 112, 232–239. [Google Scholar] [CrossRef]
- Lopatto, E.; Choi, J.; Colina, A.; Ma, L.; Howe, A.; Hinsa-Leasure, S. Characterizing the soil microbiome and quantifying antibiotic resistance gene dynamics in agricultural soil following swine CAFO manure application. PLoS ONE 2019, 14, e0220770. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Lv, T.; Shi, M.; Wu, S.; Carvalho, P.N.; Dong, R. Stabilization of preliminary anaerobically digested slurry in post-storage: Dynamics of chemical characteristics and hygienic quality. Water Air Soil Pollut. 2017, 306, 3493. [Google Scholar] [CrossRef]
- Ben, W.; Wang, J.; Cao, R.; Yang, M.; Zhang, Y.; Qiang, Z. Distribution of antibiotic resistance in the effluents of ten municipal wastewater treatment plants in China and the effect of treatment processes. Chemosphere 2017, 172, 392–398. [Google Scholar] [CrossRef]
- Chen, X.; Tang, R.; Wang, Y.; Yuan, S.; Wang, W.; Ali, I.M.; Hu, Z.H. Effect of ultrasonic and ozone pretreatment on the fate of enteric indicator bacteria and antibiotic resistance genes, and anaerobic digestion of dairy wastewater. Bioresour. Technol. 2021, 320, 124356. [Google Scholar] [CrossRef] [PubMed]
- Pu, C.; Liu, H.; Ding, G.; Sun, Y.; Yu, X.; Chen, J.; Ren, J.; Gong, X. Impact of direct application of biogas slurry and residue in fields: In situ analysis of antibiotic resistance genes from pig manure to fields. J. Hazard. Mater. 2018, 344, 441–449. [Google Scholar] [CrossRef]
- Tran, T.T.; Scott, A.; Tien, Y.C.; Murray, R.; Boerlin, P.; Pearl, D.L.; Liu, K.; Robertson, J.; Nash, J.H.E.; Topp, E. On-farm anaerobic digestion of dairy manure reduces the abundance of antibiotic resistance associated gene targets and the potential for plasmid transfer. Appl. Environ. Microbiol. 2021, 87, e0298020. [Google Scholar] [CrossRef]
- Allegrini, M.; Iocoli, G.A.; Zabaloy, M.C. Combined use of digestate and inorganic fertilizer alleviates the burden of class 1 integrons in perennial ryegrass rhizosphere without compromising aerial biomass production. Environ. Sci. Pollut. Res. Int. 2024, 31, 47132–47143. [Google Scholar] [CrossRef]
- Luby, E.; Ibekwe, A.M.; Zilles, J.; Pruden, A. Molecular methods for assessment of antibiotic resistance in agricultural ecosystems: Prospects and challenges. J. Environ. Qual. 2016, 45, 441–453. [Google Scholar] [CrossRef]
- Zhang, A.N.; Gaston, J.M.; Dai, C.L.; Zhao, S.; Poyet, M.; Groussin, M.; Yin, X.; Li, L.G.; van Loosdrecht, M.C.M.; Topp, E.; et al. An omics-based framework for assessing the health risk of antimicrobial resistance genes. Nat. Commun. 2021, 12, 4765. [Google Scholar] [CrossRef] [PubMed]
- Scott, A.; Tien, Y.C.; Drury, C.F.; Reynolds, W.D.; Topp, E. Enrichment of antibiotic resistance genes in soil receiving composts derived from swine manure, yard wastes, or food wastes, and evidence for multiyear persistence of swine Clostridium spp. Can. J. Microbiol. 2018, 64, 201–208. [Google Scholar] [CrossRef] [PubMed]
- Zeng, J.Y.; Meng, M.; Qi, L.; Li, Y.; Yao, H. Environmental risks in swine biogas slurry-irrigated soils: A comprehensive analysis of antibiotic residues, resistome, and bacterial pathogens. Environ. Int. 2024, 191, 108954. [Google Scholar] [CrossRef]
- Nüesch-Inderbinen, M.; Stephan, R. Epidemiology of extended-spectrum β-lactamase producing Escherichia coli in the human-livestock environment. Curr. Clin. Microbiol. Rep. 2016, 3, 1–9. [Google Scholar] [CrossRef]
- De Mandal, S.; Jeon, J. Phyllosphere Microbiome in Plant Health and Disease. Plants 2023, 12, 3481. [Google Scholar] [CrossRef] [PubMed]
- Huygens, D.; Orveillon, G.; Lugato, E.; Tavazzi, S.; Comero, S.; Jones, A.; Gawlik, B.; Saveyn, H.G.M. Technical Proposals for the Safe Use of Processed Manure Above the Threshold Established for Nitrate Vulnerable Zones by the Nitrates Directive (91/676/EEC); Publications Office of the European Union: Luxembourg, 2020. [Google Scholar] [CrossRef]

| Parameters | |||||||||
| % (Mean ± S.E.) | |||||||||
| TS | VS | C | NTK | N-NH4+ | N-NO3− | ||||
| 6.150 ± 0.007 | 61.060 ± 0.16 | 30.470 ± 0.22 | 6.729 ± 0.288 | 4.947 ± 0.174 | 0.067 ± 0.003 | ||||
| mg/kg | |||||||||
| TP | AP | As | Cd | Cr | Cu | Hg | Ni | Pb | Zn |
| 9790 | 903 | 0.78 | <0.1 | 9.1 | 59.6 | <0.1 | 8.5 | 1.5 | 334 |
| Target | Primer | Sequence (5′–3′) | Amplicon Size (bp) | Annealing (°C) | Reference |
|---|---|---|---|---|---|
| 16S rRNA | 338_F 518_R | ACTCCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG | ~180 | 53 | Pollock et al., 2020 [25] |
| tetW | tetW_F tetW_R | GAGAGCCTGCTATATGCCAGC GGGCGTATCCACAATGTTAAC | 168 | 65 | Aminov et al., 2004 [26] |
| ermB | ermB_F ermB_R | AGCCATGCGTCTGACATCTA CTGTGGTATGGCGGGTAAGT | 193 | 56 | Szczepanowski et al., 2009 [27] |
| blaCTX-M | RTCTX-M-F RTCTX-M-R | CTATGGCACCACCAACGATA ACGGCTTTCTGCCTTAGGTT | 101 | 61 | Marti et al., 2013 [28] |
| intI1 | intI1_LC1 F intI1_LC5 R | GCCTTGATGTTACCCGAGAG GATCGGTCGAATGCGTGT | 196 | 60 | Barraud et al., 2010 [29] |
| a-int1 | aint1_F aint1_R | GCACTAAGCACATAATTG CCAACTATTGCGATAACA | 140 | 50 | Quintela-Baluja et al., 2021 [30] |
| ARG | Mechanisms of Resistance | Class of Antibiotic |
|---|---|---|
| tetW | Protection of the target site (ribosomal protection protein) | Tetracyclines |
| ermB | Modification of the target by methylation (23S rRNA) | Macrolides, lincosamides and group B streptogramins |
| blaCTX-M | Antibiotic deactivation by hydrolysis of beta-lactam ring | Expanded-spectrum cephalosporins and monobactams (not cephamycins or carbapenems) |
| Sampling | Treatment | Coliforms | Salmonella/20 g | |||||
|---|---|---|---|---|---|---|---|---|
| Total Coliforms | Fecal Coliforms | E. coli | ||||||
| MPN/g | CI | MPN/g | CI | MPN/g | CI | |||
| 2 dai | Control | 3 | 0.15–9.6 | <3 | 0–9.5 | <3 | 0–9.5 | absence |
| AD | 1100 | 180–4100 | 3 | 0.15–9.6 | 3 | 0.15–9.6 | presence | |
| 4 wai | Control | <3 | 0–9.5 | <3 | 0–9.5 | <3 | 0–9.5 | absence |
| AD | 43 | 9–180 | <3 | 0–9.5 | <3 | 0–9.5 | absence | |
| Gene or Integron | 16S | tetW | ermB | blaCTX-M | intI1 | a-int1 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| n | Mean | S.E. | n | Mean | S.E. | n | Mean | S.E. | n | Mean | S.E. | n | Mean | S.E. | n | Mean | S.E. | |
| Treatment (T) * | ||||||||||||||||||
| Control | 6 | 8.87 | 0.02 | 6 | 4.35 | 0.16 | 6 | 5.54 | 0.47 | 5 | 4.82 | 0.38 | 6 | 4.04 | 0.12 | 6 | 5.78 | 0.09 |
| AD | 6 | 8.98 | 0.02 | 6 | 5.22 | 0.16 | 6 | 5.57 | 0.47 | 5 | 4.76 | 0.38 | 6 | 4.23 | 0.12 | 6 | 5.33 | 0.09 |
| Sampling (S) | ||||||||||||||||||
| 2 dai | 6 | 8.87 | 0.02 | 6 | 4.79 | 0.16 | 6 | 6.05 | 0.47 | 4 | 4.40 | 0.42 | 6 | 3.98 | 0.12 | 6 | 5.81 | 0.09 |
| 4 wai | 6 | 8.98 | 0.02 | 6 | 4.78 | 0.16 | 6 | 5.06 | 0.47 | 6 | 5.18 | 0.34 | 6 | 4.29 | 0.12 | 6 | 5.30 | 0.09 |
| T × S | ||||||||||||||||||
| Control, 2 dai | 3 | 8.73 | 0.03 | 3 | 4.18 | 0.26 | 3 | 5.99 | 0.63 | 2 | 4.57 | 0.57 | 3 | 4.54 | 0.15 | 3 | 5.78 | 0.14 |
| AD, 2 dai | 3 | 9.00 | 0.03 | 3 | 5.40 | 0.26 | 3 | 6.10 | 0.63 | 2 | 4.23 | 0.57 | 3 | 4.75 | 0.15 | 3 | 5.83 | 0.14 |
| Control, 4 wai | 3 | 9.00 | 0.03 | 3 | 4.52 | 0.26 | 3 | 5.09 | 0.63 | 3 | 5.08 | 0.47 | 3 | 4.22 | 0.15 | 3 | 5.78 | 0.14 |
| AD, 4 wai | 3 | 8.95 | 0.03 | 3 | 5.04 | 0.26 | 3 | 6.04 | 0.63 | 3 | 5.28 | 0.47 | 3 | 4.37 | 0.15 | 3 | 4.83 | 0.14 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fabiani, C.; Valero, M.V.; Basualdo, J.; Allegrini, M.; Iocoli, G.A.; Villamil, M.B.; Zabaloy, M.C. Exploratory Field Case Study of Microbial and Resistance Genes Dynamics in the Maize Phyllosphere Following Fertigation with Anaerobic Digestate. Agronomy 2025, 15, 2398. https://doi.org/10.3390/agronomy15102398
Fabiani C, Valero MV, Basualdo J, Allegrini M, Iocoli GA, Villamil MB, Zabaloy MC. Exploratory Field Case Study of Microbial and Resistance Genes Dynamics in the Maize Phyllosphere Following Fertigation with Anaerobic Digestate. Agronomy. 2025; 15(10):2398. https://doi.org/10.3390/agronomy15102398
Chicago/Turabian StyleFabiani, Camila, María V. Valero, Jessica Basualdo, Marco Allegrini, Gastón A. Iocoli, María B. Villamil, and María C. Zabaloy. 2025. "Exploratory Field Case Study of Microbial and Resistance Genes Dynamics in the Maize Phyllosphere Following Fertigation with Anaerobic Digestate" Agronomy 15, no. 10: 2398. https://doi.org/10.3390/agronomy15102398
APA StyleFabiani, C., Valero, M. V., Basualdo, J., Allegrini, M., Iocoli, G. A., Villamil, M. B., & Zabaloy, M. C. (2025). Exploratory Field Case Study of Microbial and Resistance Genes Dynamics in the Maize Phyllosphere Following Fertigation with Anaerobic Digestate. Agronomy, 15(10), 2398. https://doi.org/10.3390/agronomy15102398

