Next Article in Journal
Solving Phosphorus Fertilization-Related Drip Irrigation Emitter Clogging by Adding Mn2+
Next Article in Special Issue
Widely Targeted Metabolomics and Transcriptomics Analysis of the Response and Adaptation Mechanisms of Trifolium ambiguum to Low-Temperature Stress
Previous Article in Journal
Evaluation of Models for Describing Photosynthetic Light–Response Curves and Estimating Parameters in Rice Leaves at Various Canopy Positions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cross-Stressful Adaptation to Drought and High Salinity Is Related to Variable Antioxidant Defense, Proline Metabolism, and Dehydrin b Expression in White Clover

College of Grassland Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2025, 15(1), 126; https://doi.org/10.3390/agronomy15010126
Submission received: 12 December 2024 / Revised: 31 December 2024 / Accepted: 4 January 2025 / Published: 7 January 2025

Abstract

A previous exposure to drought priming (DP) or salt priming (SP) could significantly improve future tolerance to both the same and different abiotic stresses, which is an effective mitigation strategy for plants to adapt to changing environmental conditions. If the type of stress priming is different from subsequent abiotic stress, this indicates that plants are trained to acquire cross tolerance. The objective of this study was to explore DP-regulated cross tolerance to salt stress and SP-induced cross tolerance to drought associated with changes in growth, antioxidant defense, proline metabolism, and the expression of the dehydration-responsive gene Dehydrin b involved in the stabilization of membrane systems, cryoprotection of intracellular proteins, and enhancement in water retention capacity in white clover (Trifolium repens). Plants were pretreated by initial DP or SP and then subjected to subsequent salt stress or drought stress for 10 days, respectively. The results demonstrated that DP significantly increased number of roots during subsequent salt stress, whereas SP significantly improved stem length, root length, and number of roots under drought stress, which indicated that the SP exhibited more pronounced and positive effects on mitigating subsequent drought-induced growth retardant. Both salt stress and drought resulted in significant increases in electrolyte leakage and contents of superoxide anion, hydrogen peroxide, and malonaldehyde due to reduced superoxide dismutase, peroxide, and catalase, as well as key enzyme activities in the ascorbate–glutathione cycle. SP or DP could significantly enhance these enzyme activities to alleviate subsequent drought- or salt-induced oxidative damage. SP or DP also significantly improved the accumulation of proline contributing to better water homeostasis by promoting biosynthetic enzyme activities (Δ1-pyrroline-5-carboxylate synthetase and aminotransferase) and restricting proline dehydrogenase activity for proline degradation under drought or salt stress, respectively. In addition, SP significantly up-regulated the expression of dehydrin b under drought stress, but DP failed to induce the expression of dehydrin b in response to subsequent salt stress. The current findings proved that the pre-exposure of white clover plants to DP or SP could effectively mitigate the negative effects of subsequent salt stress or drought related to some common and different pathways. Plants pretreated by initial DP or SP exhibited better adaption to subsequent different stress by regulating growth, physiological, metabolic, and transcriptional changes.

1. Introduction

Global climate change is exacerbating extreme weather events, resulting in increasing drought and soil salinization worldwide [1,2]. Drought causes crop growth retardation and yield loss as a result of the limitation of water intake for photosynthesis [3]. A high concentration of salt ions in soil solutions not only reduces osmotic potential to induce hyperosmotic stress but also restricts the uptake of nutrient elements as a result of hyperionic stress [4]. It is well known that prior exposure to repeat mild abiotic stress induces stress memory in many plant species, which lets plants have a faster and better response to subsequent more severe stress [5]. In general, this process is often called “stress priming”, where plants experience a recurrent abiotic stress and recovery [6]. If the type of stress priming is the same as subsequent abiotic stress, it is defined as “cis-priming” [6]. For example, drought priming (DP) could significantly improve the tolerance to subsequent more severe drought stress in many gramineous and leguminous plant species [7,8,9,10]. Salt priming (SP) could also induce the improvement in future salt tolerance of sugarcane (Saccharum officinarum) seedlings, sweet sorghum (Sorghum bicolor), wheat (Triticum aestivum) plants, and melon (Cucumis melo) seedlings [11,12,13,14]. If the type of stress priming is different from subsequent abiotic stress, it is called “trans-priming”, which indicates that plants acquire cross tolerance [6]. For example, DP induced a significant increase in salt tolerance of creeping bentgrass (Agrostis stolonifera) and wheat [15,16]. Moreover, SP could also effectively enhance the drought tolerance of white clover (Trifolium repens), walnut (Juglans regia), and rice (Oryza sativa) plants [17,18,19].
Plants combat diverse environmental stresses, including drought and salt stress, by regulating microstructural and functional trait modifications as well as various physiological and molecular mechanisms such as antioxidant defense systems, osmotic adjustment (OA), and transcriptional regulation [20,21,22,23]. It has been reported that initial stress priming induced tolerance to future abiotic stress associated with changes in antioxidant capacity, proline metabolism, and stress-defensive gene reprograming [5,7,24]. The imbalance between the generation and scavenging of reactive oxygen species (ROS) leads to cellular oxidative damage in plants under drought and salt stress [25]. The overproduction of ROS is derived from chloroplasts due to the increase in photorespiration and mitochondria because of an impaired electron transport chain [26]. Various antioxidant enzymes, such as superoxide dismutase (SOD), peroxide (POD), and catalase (CAT), as well as many enzymes, such as ascorbate peroxidase (APX), glutathione reductase (GR), dehydroascorbate reductase (DHAR), and monodehydroascorbate reductase (MHAR) in the ascorbate–glutathione cycle, are of great significance to antioxidant defense systems for the detoxification of ROS [25]. It has been found that improvements in various antioxidant enzyme activities for ROS scavenging were closely related to enhanced drought tolerance or salt tolerance in white clover [27,28,29]. Previously, many studies have found that stress priming regulates subsequent tolerance to different abiotic stresses associated with enhanced antioxidant defense. For example, DP activated SOD and CAT activities to reduce accumulations of superoxide anion (O2·−) and hydrogen peroxide (H2O2), contributing to the drought tolerance of wheat [7]. DP-pretreated white clover plants could maintain significantly higher activities of SOD, CAT, POD, and APX to mitigate subsequent drought-induced oxidative damage than those plants without DP pretreatment [8]. As compared with wheat plants without DP treatment, the DP-treated plants maintained significantly higher antioxidant systems and lower oxidative injuries in response to subsequent low-temperature stress [30]. DP also triggered antioxidant systems to detoxify the overaccumulation of ROS when winter wheat was subsequently exposed to high-temperature stress [31]. In addition, wheat plants pretreated with a low dose of NaCl (30 mM) enhanced their tolerance to subsequent more severe salt stress (500 mM NaCl) by improving CAT and APX activities to reduce H2O2 content [13]. However, only a small amount of research has focused on investigating the critical role of antioxidant systems in cross tolerance induced by DP or SP, especially for those key enzymes in the ascorbate–glutathione cycle.
As a stress-responsive and water-soluble amino acid, proline has a strong ability to regulate osmotic potential, ROS scavenging, and metabolic homeostasis in plant cells [32]. In higher plants, the biosynthesis of proline depends on two main pathways [33]. For the glutamate pathway, Δ1-pyrroline-5-carboxylate synthetase (P5CS) catalyzes the biosynthesis of glutamate-γ-semialdehyde (GSA) by using the glutamate as a substrate. The GSA is then converted into pyroline-5-carboxylate (P5C), which is further catalyzed by pyroline-5-carboxylate reduction (P5CR) to form the proline. For the ornithine pathway, the aminotransferase (OAT) catalyzes the transamination of ornithine to form GSA. The degradation of proline depends on proline dehydrogenase (ProDH), which oxidizes proline to P5C [34]. It has been proven that increased activities of P5CS and OAT, as well as reduced ProDH activity, promoted proline content in plants under drought or salt stress [34,35,36,37]. The accumulation of proline was related to the enhanced drought tolerance of TaP5CS1-transgenic wheat [38]. Increased expression of NtP5CS for proline synthesis was a key factor for the drought tolerance of tobacco (Nicotiana tabacum) plants [39]. Overexpression of VyP5CR effectively enhanced drought tolerance due to a higher accumulation of proline related to increased expression levels of P5CS and OAT, as well as depressed expression of ProDH in transgenic grapevine (Vitis vinifera) under drought stress [40]. The exogenous supply of an appropriate dose of zinc also effectively alleviated salt damage to millet (Panicum miliaceum), associated with the increased accumulation of proline via the activation of P5CS and OAT activities, as well as the inhibition of ProDH activity [41]. It has been found that moderate DP regulated many genes involved in proline metabolism in response to severe recurrent drought in wheat and Medicago ruthenica [42,43]. The SP induced the accumulation of organic solutes such as proline in melon seedlings in response to subsequent salt stress [14]. These multiple studies indicate that the proline could act as a prominent regulator for DP- and SP-induced stress tolerance in plants. However, the underlying role of the proline metabolism in DP- and SP-induced cross tolerance remains largely unclear.
White clover is a perennial forage with high protein content and is also used as an important ground cover plant for urban greening [44,45,46]. Drought and salt stress are the primary limiting factors for white clover growth and yield in agricultural systems and grazing ecosystems [47,48]. Although an increasing number of studies have found that the antioxidant defense system and the accumulation of proline could contribute to DP-enhanced drought tolerance or SP-induced tolerance to subsequent salt stress in plants, little attention has been paid to addressing cross tolerance between DP-regulated salt tolerance and SP-regulated drought tolerance. The objectives of the current study were to examine the effects of DP or SP on alleviating growth retardant in response to subsequent salt stress or drought stress and to further reveal the DP- and SP-induced cross tolerance associated with changes in the antioxidant defense system, proline metabolism, and dehydrin b expression involved in the stabilization of membrane systems, cryoprotection of intracellular proteins, and enhancement in water retention capacity in white clover [49,50]. The findings will be conducive to a better understanding of the underlying mechanism of cross tolerance to salt stress and drought stress in plants.

2. Materials and Methods

2.1. Plant Materials and Treatments

White clover seeds (cv. Haifa) were sown evenly in a rectangular seed tray (18 cm breadth, 24 cm length, and 9 cm deep) after being surface-sterilized by using 0.1% HgCl2 solution. The seeding rate was 1.5 g·m2. All seeds were first germinated in distilled water for 7 days and were then cultivated in half-strength Hoagland’s solution for 27 days in growth chambers (23/19 °C day/night, 65% relative humidity, 14 h photoperiod, and 650 μmol·m−2·s−1 PAR) [51]. Plants with similar sizes were selected and removed to new containers for the hydroponic culture. Plants without stress priming (NP) were cultivated in half-strength Hoagland’s solution for 8 days and then divided into three treatments (Figure 1). The first treatment (NP-C) was continued in the normal Hoagland’s solution for 10 days. For the second treatment (NP-S), plants were subjected to 100 mM NaCl solution for the first day, 150 mM NaCl solution for the second day, 200 mM NaCl solution for the third day, and 250 mM NaCl for the subsequent 7 days. For the third treatment (NP-D), plants were subjected to drought stress induced by 18% polyethylene glycol (PEG) for 10 days (Figure 1).
For the DP, the 27-day-old plants were firstly cultivated in 15% PEG solution for 2 days and then recovered in normal half-strength Hoagland’s solution for 2 days. The process was repeated once. The DP-pretreated plants were then subjected to subsequent salt stress for 10 days, as mentioned above (DP-S). For the SP, the 27-day-old plants were firstly cultivated in 50 mM NaCl solution for 2 days and then recovered in normal half-strength Hoagland’s solution for 2 days. The process was also repeated once. The SP-pretreated plants were then subjected to subsequent drought stress for 10 days, as mentioned above (SP-D). The NaCl and PEG were dissolved in half-strength Hoagland’s solution and refreshed every day. Each treatment included three independent biological replications (three containers), and each container had 21 plants (Figure 1). Leaf samples were collected for the determination of stem length, root length, number of roots of each plant, relative water content (RWC), chlorophyll (Chl) content, superoxide anion radical (O2·−) content, hydrogen peroxide (H2O2) content, malondialdehyde (MDA) content, and electrolyte leakage (EL) on day 0 and on day 10. Similarly, leaf samples were collected for the determination of antioxidant enzyme activities (SOD, POD, CAT, APX, GR, DHAR, and MHAR), proline content, key enzyme activities (OAT, P5CS, and ProDH) for proline metabolism, and expression level of dehydrin b on day 0, day 5, and day 10.

2.2. Growth, Leaf Relative Water Content, and Chlorophyll Content

The stem length and root length of each plant were measured using a rule. The number of roots of each plant was then counted. A total of 12 plants were selected randomly from each treatment. The RWC was used to evaluate water status in leaves [52]. Fresh leaves were first detached from plants, and then the fresh weight (FW) of these leaves was recorded using an electronic balance. After being immerged in deionized water for 12 h at 4 °C, these leaves were taken out, and then the water on the leaf surface was wiped away gently. The saturated fresh weight (TW) of leaves was weighed immediately. The dry weight (DW) of leaves was weighted after oven drying. The RWC was calculated by using the formula RWC (%) = (FW − DW)/(TW − DW) × 100%. For the determination of Chl content in leaves, a total of 0.1 g fresh leaves were immerged in 15 mL of dimethyl sulfoxide for 72 h, and the absorbance of the extract was measured at 663 nm and 645 nm. The Chl content was then calculated based on the assay method of Barnes et al. [53].

2.3. Oxidative Damage, Cell Membrane Stability, and Antioxidant Enzyme Activity

To detect the O2·− content in leaves, 1.5 mL of 65 mM phosphate buffered saline (PBS) (pH 7.8) was mixed with 0.1 g of fresh leaves, and then the mixture was ground into homogenate, which was then centrifuged at 10,000× g for 30 min at 4 °C. An amount of 0.5 mL of supernatant was mixed with 0.5 mL of PBS and 0.1 mL of 10 mM hydrochloride and then incubated at 25 °C for 20 min. After 1 mL of 58 mM sulfanilamide and 7 mM a-naphthylamine were added, the mixture was incubated at 25 °C for another 20 min. Then, 2 mL of chloroform was added into the mixture, and the absorbance of pink supernatant was measured at 530 nm [54]. The H2O2 content was determined according to the assay method of potassium phosphate. The absorbance of the reaction mixture was detected at 390 nm [55]. To detect EL, fresh leaves (0.1g) were collected and cleaned in deionized water. These leaves were then soaked in 15 mL of deionized water at 25 °C for 24 h, and the initial conductivity (Cinitial) was detected using a conductivity meter. After being autoclaved at 120 °C for 20 min, the solution was cooled to 25 °C, and the maximum conductivity (Cmax) of the solution was detected. The EL was calculated based on the formula EL (%) = Cinitial/Cmax × 100% [56]. A total of 0.2 g of fresh leaves were ground with 2 mL of 150 mM cold PBS into homogenate at 4 °C. The supernatant was collected for the determination of MDA content and antioxidant enzyme activities via centrifugation for 15 min at 4 °C. The assay method of Dhindsa et al. was used to detect the MDA content [57]. The assay methods of Giannopolitis and Ries, Chance and Maehly, Nakano and Asada, and Cakmak et al. were used to detect SOD [58], CAT [59], POD [59], APX [60], GR [61], DHAR [61], and MHAR [61] activities. More details have been recorded in our pervious study [27]. Protein content was detected using Bradford’s method [62].

2.4. Proline Content and Metabolic Enzyme Activity

For the determination of free proline content, 0.1 g of fresh leaves was homogenized in 10 mL of 3% aqueous sulfosalicylic acid. After being filtered through filter paper, 2 mL of filtrate was mixed with 2 mL of acid-ninhydrin and 2 mL of glacial acetic acid. The mixture was incubated at 100 °C for 1 h and then cooled to room temperature, and then 4 mL of toluene was added to the mixture and mixed vigorously. The absorbance of chromophore containing toluene was read at 520 nm [63].
An amount of 0.1 g of fresh leaves was ground in 50 mM Tris-HCl buffer (pH 7.4) containing 7 mM MgCl2, 0.6 M KCl, 3 mM EDTA, 1 mM dithiothreitol, and 5% insoluble polyvinylpyrrolidone (w/v). Homogenates were centrifuged at 39,000× g for 20 min. The supernatants were then desalted on a sephadex G-25 column and eluted with 50 mM Tris-HCl (pH 7.4) containing 10% glycerol. For the determination of P5CS activity, 0.5 mL of supernatant was mixed with 0.5 mL of mixture containing 50 mM L-glutamate, 20 mM MgCl2, 10 mM ATP, 100 mM hydroxamate-HCl, and 50 mM Tris. After being incubated at 37 °C for 5 min, the reaction mixture was mixed with 0.5 mL of HCl 2.5 N containing 2.5% of FeCl3 and 6% of trichloracetic acid. The P5CS activity was evaluated based on the Pi concentration using a sensitive malachite-green assay [64]. For the determination of ProDH activity, 0.5 mL of supernatant was mixed with 0.15 M Na2CO3-HCl buffer (pH 10.3) containing 15 mM L-proline and 1.5 mM NADP+. The absorbance of the reaction mixture was detected at 340 nm [65].
For the extraction of OAT, 0.1 g of fresh leaves was ground in 100 mM K-Pi buffer (pH 7.9) containing 1 mM EDTA, 15% glycerol, and 10 mM 2-mercaptoethanol. After being centrifuged at 15,000× g for 15 min, the supernatant was treated with 60% (NH4)2SO4 for 45 min. An amount of 0.2 mL of enzyme extract was mixed with 2 mL of 0.2 M Tris-KOH buffer (pH 8.0) containing 5 mM ornithine, 10 mM α-ketogluta rate, and 0.25 mM NADH. The absorbance of the reaction mixture was monitored at 340 nm [65].

2.5. Analysis of Dehydrin b Expression Level

Total RNAs in fresh leaves (0.1 g) were extracted using an RNA Extraction Kit (Magen) following the manufacturer’s instruction. Highly purified RNAs were then reverse-transcribed into cDNA using a Reverse Transcription Kit (MonScriptTM RTIII All-in-one Mix). Primers (F: TCCAGTCATCCAGCCTGTTG and R: CCAGCCACAACACTTGTCA) of the Dehysrin b gene (GeneBank accession number GU443960.1) were used for real-time quantitative fluorescent PCR (qRT-PCR) amplification (iCycler iQ qRT-PCR detection system with SYBR Green Supermix, Bio-Rad, Hercules, CA, USA). The β-actin was used as an internal reference gene (GeneBank accession number JF968419) with available primers (F: TTACAATGAATTGCGTGTTG and R: AGAGGACAGCCTGAATGG). Primer Premier 6.0 (PREMIER Biosoft, Palo Alto, CA, USA 2002) was used to design the primers. The PCR procedures for those two genes were as follows: Pre-deformation for 30 s at 95 °C, deformation for 10 s at 95 °C, annealing at 58 °C for 10 s, extension at 72 °C for 30 s (40 cycles from step 2 to step 4). The formula 2−ΔΔCt was used for calculating the transcript level of the gene [66].

2.6. Statistics and Data Analysis

Significant differences between different treatments were detected using SPSS 20.0 (SPSS Institute, IBM, Armonk, NY, USA, 2018) based on multi-factor analysis of variance, together with the Tukey Test (p < 0.05) [67].

3. Results

3.1. Cross-Stressful Effect on Plant Growth

SP, NP, and DP had the longest, the second longest, and the shortest stems on day 0 (Figure 2A). Subsequent salt stress or drought induced a significant decline in stem length (Figure 2A). There was no significant difference in stem length between NP-S and DP-S, but SP-D exhibited significantly longer stems than NP-D on day 10 (Figure 2A). Root length was not significantly different between NP, DP, and SP on day 0 before subsequent salt stress or drought stress (Figure 2B). Root length significantly reduced in NP-S and DP-S on day 10 of salt stress (Figure 2B). Drought stress induced a significant increase in root length of SP-D, but a decline in root length of NP-D on day 10 (Figure 2B). SP, DP, and NP exhibited the most, the second most, and the least number of roots, respectively, on day 0 (Figure 2C). In response to subsequent salt stress, the number of roots of NP-S significantly declined, but the number of roots of DP-S remained unchanged compared with NP-C on day 10 (Figure 2C). No significant difference in number of roots was detected between NP-C and NP-D, but the number of roots of SP-D significantly increased compared with the number of roots of NP-C on day 10 (Figure 2C).

3.2. Cross-Stressful Effect on Relative Water Content and Chlorophyll Content

Leaf RWC was not significantly different between the three treatments (NP, DP, and SP) on day 0 before they were subjected to subsequent drought or salt stress (Figure 3A). After 10 d of drought or salt stress, leaf RWC declined significantly in all treatments, but DP-S or SP-D had significantly higher leaf RWC than NP-S or NP-D, respectively (Figure 3A). Similarly, Chl content did not show a significant difference between NP, DP, and SP on day 0 (Figure 3B). Although drought or salt stress significantly reduced Chl content in all treatments, DP-S or SP-D exhibited a 33% or 55% increase in Chl content than NP-S or NP-D on day 10, respectively (Figure 3B).

3.3. Cross-Stressful Effect on Oxidative Damage, Cell Membrane Stability, and Antioxidant Enzyme Activity

O2·−, H2O2, MDA, and EL were not significantly different between NP, DP, and SP on day 0 (Figure 4A–D). A significant increase in O2·− content in all treatments was induced by drought stress or salt stress, but DP-S or SP-D had a 37% or 29% decline in O2·− content than NP-S or NP-D on day 10, respectively (Figure 4A). H2O2 content was the highest and the second highest in NP-D and SP-D on day 10 (Figure 4B). DP-S exhibited a 24% decrease in H2O2 content compared with NP-S (Figure 4B). MDA content significantly increased in NP-S, DP-S, NP-D, and SP-D compared with NP-C on day 10 (Figure 4C). A significantly lower MDA content was detected in DP-S and SP-D than in NP-S and NP-D, respectively (Figure 4C). EL significantly increased in all treatments in response to subsequent drought or salt stress (Figure 4D). The increased level of EL was the highest and the second highest in NP-D and NP-S on day 10, respectively (Figure 4D). DP-S and SP-D maintained significantly lower EL than NP-S and NP-D, respectively (Figure 4D).
Drought or salt stress inhibited SOD activity in NP-S and NP-D but improved SOD activity in DP-S and SP-D on day 5 and day 10 (Figure 5A). DP-S and SP-D had 1.5 times higher SOD activity than NP-S and NP-D on day 10 (Figure 5A). Stress induced a gradual decline in POD activity in NP-S and NP-D from day 5 to day 10, but the POD activity increased gradually in DP-S and SP-D from day 5 to day 10 compared with NP-C (Figure 5B). Similarly, drought or salt stress significantly reduced CAT activity in NP-S and NP-D but significantly promoted CAT activity in DP-S and SP-D on day 5 and day 10 (Figure 5C).
The activities of APX, GR, and MHAR were not significantly different between NP, DP, and SP, whereas DP and SP showed significantly higher DHAR activity compared with NP on day 0 (Figure 6A–D). No significant difference in APX activity was detected between NP-C, NP-S, DP-S, and SP-D on day 5, but APX activity was significantly lower in NP-D compared with the other four treatments at this time (Figure 6A). SP-D exhibited a 33% increase in APX activity compared with NP-D on day 5 (Figure 6A). On day 10, salt stress significantly promoted APX activity in DP-S but did not significantly affect APX activity in NP-S (Figure 6A). Drought stress significantly decreased APX activity in NP-D and SP-D, but SP-D maintained a 77% increase in APX activity compared with NP-D on day 10 (Figure 6A). DP-S and SP-D exhibited significantly higher GR activity than NP-S and NP-D in response to subsequent salt stress or drought (Figure 6B). On day 10, DP-S had a 30% increase in DHAR activity compared with NP-S (Figure 6C). Drought significantly reduced DHAR activity in NP-D but significantly improved DHAR activity in SP-D on day 5 and day 10 (Figure 6C). Stress induced a significant increase in MHAR activity in all treatments on day 5 (Figure 6D). DP-S exhibited 1.5 times higher MHAR than NP-S on day 5 and day 10 (Figure 6D). Similarly, SP-D exhibited 1.9 or 2.5 times higher MHAR than NP-D on day 5 and day 10 (Figure 6D).

3.4. Cross-Stressful Effect on Proline Metabolism

DP and SP maintained significantly higher proline content than NP on day 0 (Figure 7A). Salt stress significantly improved proline content in NP-S and DP-S on day 5 and day 10, and the increased level was more pronounced in DP-S than in NP-S (Figure 7A). SP-D had 3.5 and 4.0 times higher proline content than NP-D on day 5 and day 10, respectively (Figure 7A). Salt stress or drought did not induce the change in OAT activity in NP-S or NP-D, but it significantly promoted OAT activity in DP-S and SP-D on day 5 and day 10 (Figure 7B). Similarly, salt stress or drought did not significantly affect P5CS activity in NP-S or in NP-D, but it significantly promoted P5CS activity in DP-S and SP-D on day 5 (Figure 7C). Stress significantly activated P5CS activity in all treatments (NP-S, DP-S, NP-D, and SP-D) on day 10 (Figure 7C). DP-S and SP-D had a 32% and 30% increase in P5CS activity than NP-S and NP-D on day 10, respectively (Figure 7C). Significantly lower ProDH activity was detected in DP and SP compared with NP on day 0 (Figure 7D). Salt stress-induced decline in ProDH activity was more pronounced in DP-S compared with NP-S on day 5 and day 10 (Figure 7D). Drought also significantly decreased ProDH activity in NP-D and SP-D on day 5 and day 10 (Figure 7D). SP-D maintained a 23% and 29% decline in ProDH activity than NP-D on day 5 and on day 10, respectively (Figure 7D).

3.5. Cross-Stressful Effect on Expression Level of Dehydrin b

The expression level of Dehydrin b was not significantly different between NP, DP, and SP on day 0 (Figure 8). Salt stress did not significantly induce the expression of Dehydrin b in NP-S and DP-S on day 5 but significantly promoted the expression of Dehydrin b in NP-S and DP-S on day 10 (Figure 8). However, no significant difference in the expression of Dehydrin b was detected between NP-S and DP-S on day 5 and day 10 (Figure 8). Drought stress significantly upregulated the expression of Dehydrin b to an extremely high level in NP-D and SP-D on day 5 and day 10 (Figure 8). SP-D exhibited 1.5 and 2.7 times higher the expression of Dehydrin b than NP-D on day 5 and on day 10, respectively (Figure 8).

4. Discussion

Drought and salt stress are two major limiting factors for plant growth and crop productivity, especially in semi-arid and drought-stricken areas [2,3,68]. It has been recognized that prior exposure to drought or salt stress could significantly improve plant growth in response to subsequent same or different abiotic stress. For example, drought-induced inhibition of wheat growth could be effectively mitigated by DP [69]. DP-treated cowpea (Vigna unguiculata) plants acquired tolerance to subsequent drought stress, as reflected by better water status and growth than those plants without the DP treatment [10]. Maize (Zea mays) seedlings pretreated by DP exhibited better growth of leaf and root after being subjected to later drought stress [70]. For trans-priming, DP significantly alleviated subsequent salt-induced declines in wheat growth and water uptake [16,71]. Our previous study also found that DP-treated creeping bentgrass plants could maintain significantly higher aboveground growth and a higher number of roots than untreated plants during subsequent salt stress because the DP effectively improved water balance and photochemical efficiency [15]. In addition, SP was beneficial to the better growth of white clover plants under drought stress, which was related to the SP-induced improvements in water homeostasis and Chl content [17]. In the current study, DP eliminated subsequent salt-induced decline in the number of roots, and SP further increased the number of roots when white clover plants were subjected to subsequent drought stress. It is worth noting that drought reduced the stem length and root length of white clover plants, which could be significantly mitigated by the SP. However, there were no significant differences in stem length and root length between NP-S and DP-S under salt stress. These findings indicated that the SP exhibited more pronounced effects on alleviating the drought-driven growth retardant.
The activation of antioxidant systems is a common adaptive response to drought and salt stress in most plant species, since those abiotic stresses induced the over-production of ROS, resulting in cellular oxidative damage and metabolic disturbance [25]. In enzymatic antioxidant systems, the SOD is responsible for the disproportionation reaction of O2·− into O2 and H2O2, which is further scavenged by POD, CAT, and key enzymes in the ascorbate–glutathione cycle, such as APX, GR, DHAR, and MHAR [72]. It has been reported that DP-pretreated winter wheat exhibited enhanced drought tolerance associated with improved SOD and APX activities for ROS scavenging [73]. The DP also triggered SOD, POD, and CAT activities against the drought-induced imbalance of ROS in maize seedlings [70]. In addition, the SP significantly alleviated the drought-induced accumulation of ROS in walnut plants by improving CAT and APX activities [18]. For rice plants, pre-exposure to a mild salt stress significantly conferred subsequent drought tolerance related to changes in hormonal signaling, osmotic balance, and antioxidant systems [19]. Similar findings showed that DP and SP significantly mitigated accumulations of O2·−, H2O2, and MDA by enhancing SOD, CAT, and POD activities in white clover during subsequent salt stress or drought stress, respectively. Furthermore, key enzymes (APX, GR, DHAR, and MHAR) in the ascorbate–glutathione cycle were also significantly improved by DP or SP when white clover plants were subjected to salt stress or drought. These results indicated that a rapid mobilization of various antioxidant enzymes and the ascorbate–glutathione cycle induced by DP or SP in white clover could contribute to the mitigation of the adverse effects of ROS in response to later salt stress or drought. However, the SP failed to activating SOD, CAT, and APX when sweet sorghum plants were subjected to subsequent salt stress [12]. SP-regulated antioxidant enzyme activities could play a more important role in cross tolerance in plants.
Proline has multiple functions in plants, including being an important component of proteins and a nitrogen resource for metabolic homeostasis, a main osmolyte for OA, and an ROS scavenger for redox equilibrium [74]. The accumulation of proline is an efficient way to protect plants from drought and salt stress [75]. It has been well demonstrated that exogenous proline significantly mitigated the detrimental effects of drought stress on rice growth through enhancing osmoprotectant and antioxidant defense systems for water and redox equilibrium [76]. Both the exogenous application of proline and VaP5CSF129A overexpression could significantly promote proline content to mitigate the negative impact of drought stress on tobacco plants by improving the transcript level of P5CS but inhibiting the expression of ProDH [77]. Proline-biosynthetic genes (MsP5CSs and MsOATs) were significantly up-regulated, but catabolic genes (MsProDHs and MsP5CDH) were down-regulated in alfalfa (Medicago sativa) during salt stress, thereby helping to maintain higher proline content for OA [34]. Black wolfberry (Lycium ruthenicum) plants significantly promoted P5CS and OAT activities to accelerate the accumulation of proline, which was beneficial to better OA and cell membrane stability under salt stress [78]. On the contrary, the down-regulation of P5CS1a via RNAi interference significantly restricted P5CS activity and proline content in alfalfa plants, resulting in growth retardation under salt stress [34]. The accumulation of proline was also found to be related to DP- and SP-induced stress tolerance. It has been reported that SP induced the accumulation of proline associated with enhanced water balance in sweet sorghum plants under salt stress [12]. DP significantly improved proline content for OA in wheat, contributing to enhanced tolerance to later severe drought stress [7,73]. Further findings showed that the DP-induced accumulation of proline mainly depended on the improved P5CS expression and P5CS activity under drought stress [7,73,79]. In the current study, DP- or SP-induced accumulation of proline was not only related to enhanced P5CS activity but also due to the improvement in OAT activity in the leaves of white clover under salt stress or drought, respectively. In addition, Wang et al. found that the downregulation of ProDH was also beneficial to the accumulation of proline under drought stress [79]. DP and SP further reduced stress-induced decline in ProDH activity, which could effectively slow down proline degradation.
In addition to metabolic regulations, stress priming also induces transcriptional memory to more quickly and better regulate plant adaptation to subsequent stress [80]. Many LEAs encoding late embryogenesis abundant proteins in maize, Arabidopsis thaliana, and soybean (Glycine soja) have been identified as DP-regulated stress memory genes associated with adaptive response to subsequent dehydration stress [81,82]. Dehydrins, commonly known as group 2 members of the LEA, exhibit multiple protective roles against dehydration-related stress, including the protection of membrane systems, cryoprotection of intracellular proteins, enhancement in water retention capacity, and ROS detoxification [83]. The overexpression of dehydrin genes could significantly enhance tolerance to drought and salt stress in different plant species [84,85]. The exogenous application of spermine significantly up-regulated the expression of many dehydrin genes, contributing to better water balance and ROS homeostasis in creeping bentgrass under salt stress [86]. Our previous studies also found that white clover seeds primed with exogenous diethyl aminoethyl hexanoate or γ-aminobutyric acid significantly improved germination and seedling growth, related to the increased expression of dehydrin b under drought stress [49,50]. Moreover, spermidine induced drought tolerance of white clover, associated with the accumulation of dehydrin b [87]. In the current study, SP could further improve drought-induced an increase in the expression of dehydrin b, but no significant difference in the expression of dehydrin b was detected between NP-S and DP-S in response to subsequent salt stress. These results indicated that dehydrin b might only be involved in SP-regulated cross tolerance in white clover.

5. Conclusions

White clover plants pretreated by initial DP had more roots than NP in response to subsequent salt stress. SP significantly improved stem length, root length, and number of roots under drought stress, which indicated that SP exhibited pronounced and positive effects on mitigating subsequent drought-induced growth retardation. Salt stress and drought resulted in a significant increase in EL and accumulations of O2·−, H2O2, and MDA due to reduced antioxidant enzyme activities (SOD, CAT, and POD) and key enzyme activities (APX, GR, DHAR, and MHAR) in the ascorbate–glutathione cycle. SP and DP significantly enhanced these enzyme activities to alleviate subsequent drought- or salt-induced oxidative damage. SP and DP also significantly improved the accumulation of proline, contributing to better water homeostasis by promoting OAT and P5CS activities as well as restricting ProDH activity under drought or salt stress, respectively. In addition, SP could significantly up-regulate the expression of dehydrin b under later drought stress, but DP failed to induce the expression of dehydrin b in response to subsequent salt stress. The current findings proved that the pre-exposure of white clover plants to DP or SP could effectively mitigate the negative effects of subsequent salt stress or drought related to some common pathways, such as enhanced enzymatic antioxidant systems and proline biosynthesis, as well as some different mediations of growth and dehydrin b expression, which will help to better understand the underlying mechanism of cross tolerance to salt stress and drought stress in plant species. DP and SP could be applied to enhancing cross tolerance to varying abiotic stresses in some similar species, such as leguminous crops. However, the ecological and practical implications of SP- and DP-regulated cross tolerance could not be completely explained in the current study due to the short duration of stress exposure and the exclusion of field trials. Further study will be conducted to explore SP- and DP-regulated cross tolerance in white clover and other leguminous plants in the future.

Author Contributions

Y.L., data curation, formal analysis, investigation, writing—original draft; D.W., methodology, formal analysis, resources, investigation, writing—original draft and editing; Y.P., methodology, resources, writing—original draft and editing; D.P., methodology, resources, investigation; Z.L., conceptualization, supervision, formal analysis, resources, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Sichuan Science and Technology Program (2024ZYD0057).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author(s).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Corwin, D.L. Climate change impacts on soil salinity in agricultural areas. Eur. J. Soil Sci. 2021, 72, 842–862. [Google Scholar] [CrossRef]
  2. Chen, H.; Jiang, J.G. Osmotic adjustment and plant adaptation to environmental changes related to drought and salinity. Environ. Rev. 2010, 18, 309–319. [Google Scholar] [CrossRef]
  3. Dietz, K.J.; Zörb, C.; Geilfus, C.M. Drought and crop yield. Plant Biol. 2021, 23, 881–893. [Google Scholar] [CrossRef] [PubMed]
  4. Zhou, H.; Shi, H.; Yang, Y.; Feng, X.; Chen, X.; Xiao, F.; Lin, H.; Guo, Y. Insights into plant salt stress signaling and tolerance. J. Genet. Genom. 2024, 51, 16–34. [Google Scholar] [CrossRef]
  5. Pissolato, M.D.; Martins, T.S.; Fajardo, Y.C.; Souza, G.M.; Machado, E.C.; Ribeiro, R.V. Stress memory in crops: What we have learned so far. Theor. Exp. Plant Physiol. 2024, 36, 535–565. [Google Scholar] [CrossRef]
  6. Nair, A.U.; Bhukya, D.P.N.; Sunkar, R.; Chavali, S.; Allu, A.D. Molecular basis of priming-induced acquired tolerance to multiple abiotic stresses in plants. J. Exp. Bot. 2022, 73, 3355–3371. [Google Scholar] [CrossRef]
  7. Li, Q.; Wang, X.; Sun, Z.; Wu, Y.; Malkodslo, M.M.; Ge, J.; Jing, Z.; Zhou, Q.; Cai, J.; Zhong, Y. DNA methylation levels of TaP5CS and TaBADH are associated with enhanced tolerance to PEG-induced drought stress triggered by drought priming in wheat. Plant Physiol. Biochem. 2023, 200, 107769. [Google Scholar] [CrossRef]
  8. Li, Z.; Shi, P.; Peng, Y. Improved drought tolerance through drought preconditioning associated with changes in antioxidant enzyme activities, gene expression and osmoregulatory solutes accumulation in white clover (Trifolium repens L.). Plant Omics 2013, 6, 481–489. [Google Scholar]
  9. Yuan, Y.; Tan, M.; Zhou, M.; Hassan, M.; Lin, L.; Lin, J.; Zhang, Y.; Li, Z. Drought priming-induced stress memory improves subsequent drought or heat tolerance via activation of γ-aminobutyric acid-regulated pathways in creeping bentgrass. Plant Biol. 2024. [Google Scholar] [CrossRef]
  10. Tankari, M.; Wang, C.; Ma, H.; Li, X.; Li, L.; Soothar, R.K.; Cui, N.; Zaman-Allah, M.; Hao, W.; Liu, F. Drought priming improved water status, photosynthesis and water productivity of cowpea during post-anthesis drought stress. Agric. Water Manag. 2021, 245, 106565. [Google Scholar] [CrossRef]
  11. Patade, V.Y.; Bhargava, S.; Suprasanna, P. Halopriming imparts tolerance to salt and PEG induced drought stress in sugarcane. Agric. Ecosyst. Environ. 2009, 134, 24–28. [Google Scholar] [CrossRef]
  12. Yan, K.; Xu, H.; Cao, W.; Chen, X. Salt priming improved salt tolerance in sweet sorghum by enhancing osmotic resistance and reducing root Na+ uptake. Acta Physiol. Plant. 2015, 37, 203. [Google Scholar] [CrossRef]
  13. Wang, Z.; Li, X.; Zhu, X.; Liu, S.; Song, F.; Liu, F.; Wang, Y.; Qi, X.; Wang, F.; Zuo, Z. Salt acclimation induced salt tolerance is enhanced by abscisic acid priming in wheat. Plant Soil Environ. 2017, 63, 307–314. [Google Scholar] [CrossRef]
  14. Sivritepe, N.; Sivritepe, H.; Eris, A. The effects of NaCl priming on salt tolerance in melon seedlings grown under saline conditions. Sci. Hortic. 2003, 97, 229–237. [Google Scholar] [CrossRef]
  15. Yang, H.; Yuan, Y.; Li, Z. Dehydration priming remodels protein abundance and phosphorylation level regulating tolerance to subsequent dehydration or salt stress in creeping bentgrass. J. Proteom. 2025, 310, 105325. [Google Scholar] [CrossRef]
  16. Singha, A.; Soothar, R.K.; Wang, C.; Marín, E.E.T.; Tankari, M.; Hao, W.; Wang, Y. Drought priming alleviated salinity stress and improved water use efficiency of wheat plants. Plant Growth Regul. 2022, 96, 357–368. [Google Scholar] [CrossRef]
  17. Li, Z.; Peng, D.; Zhang, X.; Peng, Y.; Chen, M.; Ma, X.; Huang, L.; Yan, Y. Na+ induces the tolerance to water stress in white clover associated with osmotic adjustment and aquaporins-mediated water transport and balance in root and leaf. Environ. Exp. Bot. 2017, 144, 11–24. [Google Scholar] [CrossRef]
  18. Karimi, S.; Karami, H.; Vahdati, K.; Mokhtassi-Bidgoli, A. Antioxidative responses to short-term salinity stress induce drought tolerance in walnut. Sci. Hortic. 2020, 267, 109322. [Google Scholar] [CrossRef]
  19. Rossatto, T.; Souza, G.M.; do Amaral, M.N.; Auler, P.A.; Pérez-Alonso, M.-M.; Pollmann, S.; Braga, E.J.B. Cross-stress memory: Salt priming at vegetative growth stages improves tolerance to drought stress during grain-filling in rice plants. Environ. Exp. Bot. 2023, 206, 105187. [Google Scholar] [CrossRef]
  20. Zhu, Y.; Fu, Q.; Zhu, C.; Li, Y.; Yuan, F.; Su, X.; Fu, J. Review on physiological and molecular mechanisms for enhancing salt tolerance in turfgrass. Grass Res. 2024, 4, e024. [Google Scholar] [CrossRef]
  21. Sato, H.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Complex plant responses to drought and heat stress under climate change. Plant J. 2024, 117, 1873–1892. [Google Scholar] [CrossRef] [PubMed]
  22. Iqbal, U.; Azam, A.; Ahmad, K.S.; Mumtaz, S.; Mehmood, A.; Naz, N.; Usman, Z.; Abbas, H.; Akram, M. Unveiling the ecological dominance of button mangrove (Conocarpus erectus L.) through microstructural and functional traits modifications across heterogenic environmental conditions. Bot. Stud. 2024, 65, 36. [Google Scholar] [CrossRef] [PubMed]
  23. Iqbal, U.; Rehman, F.U.; Aslam, M.U.; Gul, M.F.; Farooq, U.; Ameer, A.; Asghar, N.; Mehmood, A.; Ahmad, K.S. Survival tactics of an endangered species Withania coagulans (Stocks) Dunal to arid environments. Environ. Monit. Assess. 2023, 195, 1363. [Google Scholar] [CrossRef] [PubMed]
  24. Hilker, M.; Schmülling, T. Stress priming, memory, and signalling in plants. Wiley Online Libr. 2019, 42, 753–761. [Google Scholar] [CrossRef] [PubMed]
  25. Hasanuzzaman, M.; Bhuyan, M.B.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Mahmud, J.A.; Fujita, M.; Fotopoulos, V. Reactive oxygen species and antioxidant defense in plants under abiotic stress: Revisiting the crucial role of a universal defense regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
  26. Sachdev, S.; Ansari, S.A.; Ansari, M.I.; Fujita, M.; Hasanuzzaman, M. Abiotic stress and reactive oxygen species: Generation, signaling, and defense mechanisms. Antioxidants 2021, 10, 277. [Google Scholar] [CrossRef]
  27. Li, Z.; Zhang, Y.; Zhang, X.; Peng, Y.; Merewitz, E.; Ma, X.; Huang, L.; Yan, Y. The alterations of endogenous polyamines and phytohormones induced by exogenous application of spermidine regulate antioxidant metabolism, metallothionein and relevant genes conferring drought tolerance in white clover. Environ. Exp. Bot. 2016, 124, 22–38. [Google Scholar] [CrossRef]
  28. Geng, W.; Li, Z.; Hassan, M.J.; Peng, Y. Chitosan regulates metabolic balance, polyamine accumulation, and Na+ transport contributing to salt tolerance in creeping bentgrass. BMC Plant Biol. 2020, 20, 506. [Google Scholar] [CrossRef]
  29. Lee, B.; Li, L.; Jung, W.; Jin, Y.; Avice, J.; Ourry, A.; Kim, T. Water deficit-induced oxidative stress and the activation of antioxidant enzymes in white clover leaves. Biol. Plant 2009, 53, 505–510. [Google Scholar] [CrossRef]
  30. Li, X.; Topbjerg, H.B.; Jiang, D.; Liu, F. Drought priming at vegetative stage improves the antioxidant capacity and photosynthesis performance of wheat exposed to a short-term low temperature stress at jointing stage. Plant Soil 2015, 393, 307–318. [Google Scholar] [CrossRef]
  31. Zhang, X.; Wang, X.; Zhong, J.; Zhou, Q.; Wang, X.; Cai, J.; Dai, T.; Cao, W.; Jiang, D. Drought priming induces thermo-tolerance to post-anthesis high-temperature in offspring of winter wheat. Environ. Exp. Bot. 2016, 127, 26–36. [Google Scholar] [CrossRef]
  32. Ghosh, U.; Islam, M.; Siddiqui, M.; Cao, X.; Khan, M. Proline, a multifaceted signalling molecule in plant responses to abiotic stress: Understanding the physiological mechanisms. Plant Biol. 2022, 24, 227–239. [Google Scholar] [CrossRef] [PubMed]
  33. Yan, S.; Zhan, M.; Liu, Z.; Zhang, X. Insight into the transcriptional regulation of key genes involved in proline metabolism in plants under osmotic stress. Biochimie 2024, 228, 8–14. [Google Scholar] [CrossRef] [PubMed]
  34. Min, Y.; Yu, D.; Yang, J.; Zhao, W.; Zhang, L.; Bai, Y.; Guo, C. Bioinformatics and expression analysis of proline metabolism-related gene families in alfalfa under saline-alkali stress. Plant Physiol. Biochem. 2023, 205, 108182. [Google Scholar] [CrossRef]
  35. Lin, S.; Zhang, W.; Wang, G.; Hu, Y.; Zhong, X.; Tang, G. Physiological regulation of photosynthetic-related indices, antioxidant defense, and proline anabolism on drought tolerance of wild soybean (Glycine soja L.). Plants 2024, 13, 880. [Google Scholar] [CrossRef]
  36. Li, Z.; Peng, Y. Photosynthetic characteristics and variation of osmoregulatory solutes in two white clover (Trifolium repens L.) genotypes in response to drought and post-drought recovery. Aust. J. Crop Sci. 2012, 6, 1696–1702. [Google Scholar]
  37. Li, Z.; Peng, Y.; Zhang, X.Q.; Pan, M.H.; Ma, X.; Huang, L.K.; Yan, Y.H. Exogenous spermidine improves water stress tolerance of white clover (Trifolium repens L.) involved in antioxidant defence, gene expression and proline metabolism. Plant Omics 2014, 7, 517–526. [Google Scholar]
  38. Du, L.; Huang, X.; Ding, L.; Wang, Z.; Tang, D.; Chen, B.; Ao, L.; Liu, Y.; Kang, Z.; Mao, H. TaERF87 and TaAKS1 synergistically regulate TaP5CS1/TaP5CR1-mediated proline biosynthesis to enhance drought tolerance in wheat. New Phytol. 2023, 237, 232–250. [Google Scholar] [CrossRef]
  39. Wang, H.; Li, N.; Li, H.; Zhang, S.; Zhang, X.; Yan, X.; Wang, Z.; Yang, Y.; Zhang, S. Overexpression of NtGCN2 improves drought tolerance in tobacco by regulating proline accumulation, ROS scavenging ability, and stomatal closure. Plant Physiol. Biochem. 2023, 198, 107665. [Google Scholar] [CrossRef]
  40. Zhang, P.; Cui, X.; Chen, C.; Zhang, J. Overexpression of the VyP5CR gene increases drought tolerance in transgenic grapevine (V. vinifera L.). Sci. Hortic. 2023, 316, 112019. [Google Scholar] [CrossRef]
  41. Mushtaq, N.U.; Alghamdi, K.M.; Saleem, S.; Tahir, I.; Bahieldin, A.; Henrissat, B.; Alghamdi, M.K.; Rehman, R.U.; Hakeem, K.R. Exogenous zinc mitigates salinity stress by stimulating proline metabolism in proso millet (Panicum miliaceum L.). Front. Plant Sci. 2023, 14, 1053869. [Google Scholar] [CrossRef] [PubMed]
  42. Zi, N.; Ren, W.; Guo, H.; Yuan, F.; Liu, Y.; Fry, E. DNA methylation participates in drought stress memory and response to drought in Medicago ruthenica. Genes 2024, 15, 1286. [Google Scholar] [CrossRef]
  43. Li, Q.; Sun, Z.; Jing, Z.; Wang, X.; Zhong, C.; Wan, W.; Malko, M.M.; Xu, L.; Li, Z.; Zhou, Q. Time-course transcriptomic information unravels the mechanisms of improved drought tolerance by drought-priming in wheat. J. Integr. Agric. 2024. [Google Scholar] [CrossRef]
  44. Caradus, J.; Roldan, M.; Voisey, C.; Woodfield, D. White clover (Trifolium repens L.) benefits in grazed pastures and potential improvements. In Production and Utilization of Legumes: Progress and Prospects; IntechOpen: London, UK, 2023. [Google Scholar]
  45. Sawicka, B.; Krochmal-Marczak, B.; Sawicki, J.; Skiba, D.; Pszczółkowski, P.; Barbaś, P.; Vambol, V.; Messaoudi, M.; Farhan, A.K. White Clover (Trifolium repens L.) cultivation as a means of soil regeneration and pursuit of a sustainable food system model. Land 2023, 12, 838. [Google Scholar] [CrossRef]
  46. Sincik, M.; Acikgoz, E. Effects of white clover inclusion on turf characteristics, nitrogen fixation, and nitrogen transfer from white clover to grass species in turf mixtures. Commun. Soil Sci. Plant Anal. 2007, 38, 1861–1877. [Google Scholar] [CrossRef]
  47. Hassan, M.J.; Zhou, M.; Ling, Y.; Li, Z. Diethyl aminoethyl hexanoate ameliorates salt tolerance associated with ion transport, osmotic adjustment, and metabolite reprograming in white clover. BMC Plant Biol. 2024, 24, 950. [Google Scholar] [CrossRef]
  48. Cheng, B.; Hassan, M.J.; Peng, D.; Huang, T.; Peng, Y.; Li, Z. Spermidine or spermine pretreatment regulates organic metabolites and ions homeostasis in favor of white clover seed germination against salt toxicity. Plant Physiol. Biochem. 2024, 207, 108379. [Google Scholar] [CrossRef]
  49. Zhou, M.; Hassan, M.J.; Peng, Y.; Liu, L.; Liu, W.; Zhang, Y.; Li, Z. γ-Aminobutyric acid (GABA) priming improves seed germination and seedling stress tolerance associated with enhanced antioxidant metabolism, DREB expression, and dehydrin accumulation in white clover under water stress. Front. Plant Sci. 2021, 12, 776939. [Google Scholar] [CrossRef]
  50. Hassan, M.J.; Geng, W.; Zeng, W.; Raza, M.A.; Khan, I.; Iqbal, M.Z.; Peng, Y.; Zhu, Y.; Li, Z. Diethyl aminoethyl hexanoate priming ameliorates seed germination via involvement in hormonal changes, osmotic adjustment, and dehydrins accumulation in white clover under drought stress. Front. Plant Sci. 2021, 12, 709187. [Google Scholar] [CrossRef]
  51. Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Circular. Calif. Agric. Exp. Stn. 1938, 347, 39. [Google Scholar]
  52. Barrs, H.; Weatherley, P. A re-examination of the relative turgidity technique for estimating water deficits in leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef]
  53. Barnes, J.D.; Balaguer, L.; Manrique, E.; Elvira, S.; Davison, A. A reappraisal of the use of DMSO for the extraction and determination of chlorophylls a and b in lichens and higher plants. Environ. Exp. Bot. 1992, 32, 85–100. [Google Scholar] [CrossRef]
  54. Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef] [PubMed]
  55. Velikova, V.; Yordanov, I.; Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 2000, 151, 59–66. [Google Scholar] [CrossRef]
  56. Blum, A.; Ebercon, A. Cell membrane stability as a measure of drought and heat tolerance in wheat 1. Crop Sci. 1981, 21, 43–47. [Google Scholar] [CrossRef]
  57. Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef]
  58. Giannopolitis, C.N.; Ries, S.K. Superoxide dismutases: I. Occurrence in higher plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef]
  59. Chance, B.; Maehly, A.C. Assay of Catalases and Peroxidases. Method Enzymol. 1955, 2, 764–775. [Google Scholar]
  60. Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
  61. Cakmak, I.; Strbac, D.; Marschner, H. Activities of hydrogen peroxide-scavenging enzymes in germinating wheat seeds. J. Exp. Bot. 1993, 44, 127–132. [Google Scholar] [CrossRef]
  62. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
  63. Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
  64. Geladopoulos, T.P.; Sotiroudis, T.G.; Evangelopoulos, A.E. A malachite green colorimetric assay for protein phosphatase activity. Anal. Biochem. 1991, 192, 112–116. [Google Scholar] [CrossRef]
  65. Sánchez, E.; López-Lefebre, L.R.; García, P.C.; Rivero, R.M.; Ruiz, J.M.; Romero, L. Proline metabolism in response to highest nitrogen dosages in green bean plants (Phaseolus vulgaris L. cv. Strike). J. Plant Physiol. 2001, 158, 593–598. [Google Scholar] [CrossRef]
  66. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  67. Okagbue, H.I.; Oguntunde, P.E.; Obasi, E.C.; Akhmetshin, E.M. Trends and usage pattern of SPSS and Minitab Software in Scientific research. J. Phys. Conf. Ser. 2021, 1734, 012017. [Google Scholar] [CrossRef]
  68. Zörb, C.; Geilfus, C.M.; Dietz, K.J. Salinity and crop yield. Plant Biol. 2019, 21, 31–38. [Google Scholar] [CrossRef]
  69. Wang, X.; Li, Q.; Xie, J.; Huang, M.; Cai, J.; Zhou, Q.; Dai, T.; Jiang, D. Abscisic acid and jasmonic acid are involved in drought priming-induced tolerance to drought in wheat. Crop J. 2021, 9, 120–132. [Google Scholar] [CrossRef]
  70. Ru, C.; Hu, X.; Chen, D.; Wang, W.; Song, T. Heat and drought priming induce tolerance to subsequent heat and drought stress by regulating leaf photosynthesis, root morphology, and antioxidant defense in maize seedlings. Environ. Exp. Bot. 2022, 202, 105010. [Google Scholar] [CrossRef]
  71. Singha, A.; Karim, J.; Prince, A.A.; Akter, N.; Runa, K.A.; Naqib, M.; Islam, A.M.; Roy, S.; Hasan, J. Drought priming enhanced grain yield of wheat against salinity stress. Water Conserv. Sci. Eng. 2024, 9, 42. [Google Scholar] [CrossRef]
  72. Fujita, M.; Hasanuzzaman, M. Approaches to enhancing antioxidant defense in plants. Antioxidants 2022, 11, 925. [Google Scholar] [CrossRef] [PubMed]
  73. Wang, X.; Mao, Z.; Zhang, J.; Hemat, M.; Huang, M.; Cai, J.; Zhou, Q.; Dai, T.; Jiang, D. Osmolyte accumulation plays important roles in the drought priming induced tolerance to post-anthesis drought stress in winter wheat (Triticum aestivum L.). Environ. Exp. Bot. 2019, 166, 103804. [Google Scholar] [CrossRef]
  74. Renzetti, M.; Bertolini, E.; Trovato, M. Proline metabolism genes in transgenic plants: Meta-analysis under drought and salt stress. Plants 2024, 13, 1913. [Google Scholar] [CrossRef]
  75. Kaur, G.; Asthir, B. Proline: A key player in plant abiotic stress tolerance. Biol. Plant. 2015, 59, 609–619. [Google Scholar] [CrossRef]
  76. Urmi, T.A.; Islam, M.M.; Zumur, K.N.; Abedin, M.A.; Haque, M.M.; Siddiqui, M.H.; Murata, Y.; Hoque, M.A. Combined effect of salicylic acid and proline mitigates drought stress in rice (Oryza sativa L.) through the modulation of physiological attributes and antioxidant enzymes. Antioxidants 2023, 12, 1438. [Google Scholar] [CrossRef]
  77. Cacefo, V.; Ribas, A.F.; Vieira, L.G.E. Proline metabolism as a mechanism for the energy dissipation in VaP5CSF129A transgenic tobacco plants under water deficit. J. Plant Physiol. 2023, 283, 153964. [Google Scholar] [CrossRef]
  78. Tiika, R.J.; Duan, H.; Yang, H.; Cui, G.; Tian, F.; He, Y.; Ma, Y.; Li, Y. Proline metabolism process and antioxidant potential of Lycium ruthenicum Murr. in response to NaCl treatments. Int. J. Mol. Sci. 2023, 24, 13794. [Google Scholar] [CrossRef]
  79. Wang, X.; Zhang, J.; Song, J.; Huang, M.; Cai, J.; Zhou, Q.; Dai, T.; Jiang, D. Abscisic acid and hydrogen peroxide are involved in drought priming-induced drought tolerance in wheat (Triticum aestivum L.). Plant Biol. 2020, 22, 1113–1122. [Google Scholar] [CrossRef]
  80. Zuo, D.D.; Ahammed, G.J.; Guo, D.L. Plant transcriptional memory and associated mechanism of abiotic stress tolerance. Plant Physiol. Biochem. 2023, 201, 107917. [Google Scholar] [CrossRef]
  81. Ding, Y.; Virlouvet, L.; Liu, N.; Riethoven, J.-J.; Fromm, M.; Avramova, Z. Dehydration stress memory genes of Zea mays; comparison with Arabidopsis thaliana. BMC Plant Biol. 2014, 14, 141. [Google Scholar] [CrossRef]
  82. Sintaha, M.; Man, C.-K.; Yung, W.-S.; Duan, S.; Li, M.-W.; Lam, H.-M. Drought stress priming improved the drought tolerance of soybean. Plants 2022, 11, 2954. [Google Scholar] [CrossRef] [PubMed]
  83. Riyazuddin, R.; Nisha, N.; Singh, K.; Verma, R.; Gupta, R. Involvement of dehydrin proteins in mitigating the negative effects of drought stress in plants. Plant Cell Rep. 2022, 41, 519–533. [Google Scholar] [CrossRef] [PubMed]
  84. Saavedra, L.; Svensson, J.; Carballo, V.; Izmendi, D.; Welin, B.; Vidal, S. A dehydrin gene in Physcomitrella patens is required for salt and osmotic stress tolerance. Plant J. 2006, 45, 237–249. [Google Scholar] [CrossRef] [PubMed]
  85. Kumar, M.; Lee, S.-C.; Kim, J.-Y.; Kim, S.-J.; Aye, S.S.; Kim, S.-R. Over-expression of dehydrin gene, OsDhn1, improves drought and salt stress tolerance through scavenging of reactive oxygen species in rice (Oryza sativa L.). J. Plant Biol. 2014, 57, 383–393. [Google Scholar] [CrossRef]
  86. Geng, W.; Qiu, Y.; Peng, Y.; Zhang, Y.; Li, Z. Water and oxidative homeostasis, Na+/K+ transport, and stress-defensive proteins associated with spermine-induced salt tolerance in creeping bentgrass. Environ. Exp. Bot. 2021, 192, 104659. [Google Scholar] [CrossRef]
  87. Li, Z.; Zhang, Y.; Xu, Y.; Zhang, X.; Peng, Y.; Ma, X.; Huang, L.; Yan, Y. Physiological and iTRAQ-based proteomic analyses reveal the function of spermidine on improving drought tolerance in white clover. J. Proteome Res. 2016, 15, 1563–1579. [Google Scholar] [CrossRef]
Figure 1. Schematic diagram of NP-, DP-, and SP-pretreated white clover plants in response to subsequent drought or salt stress. Red indicates five different treatments. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, DP-pretreated plants were subjected to subsequent salt stress; SP-D, SP-pretreated plants were subjected to subsequent drought stress.
Figure 1. Schematic diagram of NP-, DP-, and SP-pretreated white clover plants in response to subsequent drought or salt stress. Red indicates five different treatments. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, DP-pretreated plants were subjected to subsequent salt stress; SP-D, SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g001
Figure 2. Cross-stressful effect on (A) stem length, (B) root length, and (C) number of roots of each plant. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 2. Cross-stressful effect on (A) stem length, (B) root length, and (C) number of roots of each plant. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g002
Figure 3. Cross-stressful effect on (A) relative water content (RWC) and (B) chlorophyll (Chl) content in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 3. Cross-stressful effect on (A) relative water content (RWC) and (B) chlorophyll (Chl) content in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g003
Figure 4. Cross-stressful effect on (A) superoxide anion radical (O2·−) content, (B) hydrogen peroxide (H2O2) content, (C) malondialdehyde (MDA) content, and (D) electrolyte leakage (EL) in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 4. Cross-stressful effect on (A) superoxide anion radical (O2·−) content, (B) hydrogen peroxide (H2O2) content, (C) malondialdehyde (MDA) content, and (D) electrolyte leakage (EL) in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g004
Figure 5. Cross-stressful effect on (A) superoxide dismutase (SOD) activity, (B) peroxide (POD) activity, and (C) catalase (CAT) activity in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 5. Cross-stressful effect on (A) superoxide dismutase (SOD) activity, (B) peroxide (POD) activity, and (C) catalase (CAT) activity in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g005
Figure 6. Cross-stressful effect on (A) ascorbate peroxidase (APX) activity, (B) glutathione reductase (GR) activity, (C) dehydroascorbate reductase (DHAR) activity, and (D) monodehydroascorbate reductase (MHAR) activity in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 6. Cross-stressful effect on (A) ascorbate peroxidase (APX) activity, (B) glutathione reductase (GR) activity, (C) dehydroascorbate reductase (DHAR) activity, and (D) monodehydroascorbate reductase (MHAR) activity in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g006
Figure 7. Cross-stressful effect on (A) proline content, (B) ornithine aminotransferase (OAT) activity, (C) Δ1-pyrroline-5-carboxylate synthetase (P5CS) activity, and (D) proline dehydrogenase (ProDH) activity in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 7. Cross-stressful effect on (A) proline content, (B) ornithine aminotransferase (OAT) activity, (C) Δ1-pyrroline-5-carboxylate synthetase (P5CS) activity, and (D) proline dehydrogenase (ProDH) activity in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g007
Figure 8. Cross-stressful effect on relative expression level of Dehydrin b in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Figure 8. Cross-stressful effect on relative expression level of Dehydrin b in the leaves of white clover. Vertical bars indicate positive and negative standard deviation of means (n = 3). Different lowercase letters represent significant differences at p < 0.05. NP, non-priming; DP, drought priming; SP, salt priming. NP-C, plants without stress priming were well cultivated under normal conditions; NP-S, plants without stress priming were subjected to subsequent salt stress; NP-D, plants without stress priming were subjected to subsequent drought stress; DP-S, the DP-pretreated plants were subjected to subsequent salt stress; SP-D, the SP-pretreated plants were subjected to subsequent drought stress.
Agronomy 15 00126 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ling, Y.; Wang, D.; Peng, Y.; Peng, D.; Li, Z. Cross-Stressful Adaptation to Drought and High Salinity Is Related to Variable Antioxidant Defense, Proline Metabolism, and Dehydrin b Expression in White Clover. Agronomy 2025, 15, 126. https://doi.org/10.3390/agronomy15010126

AMA Style

Ling Y, Wang D, Peng Y, Peng D, Li Z. Cross-Stressful Adaptation to Drought and High Salinity Is Related to Variable Antioxidant Defense, Proline Metabolism, and Dehydrin b Expression in White Clover. Agronomy. 2025; 15(1):126. https://doi.org/10.3390/agronomy15010126

Chicago/Turabian Style

Ling, Yao, Duo Wang, Yan Peng, Dandan Peng, and Zhou Li. 2025. "Cross-Stressful Adaptation to Drought and High Salinity Is Related to Variable Antioxidant Defense, Proline Metabolism, and Dehydrin b Expression in White Clover" Agronomy 15, no. 1: 126. https://doi.org/10.3390/agronomy15010126

APA Style

Ling, Y., Wang, D., Peng, Y., Peng, D., & Li, Z. (2025). Cross-Stressful Adaptation to Drought and High Salinity Is Related to Variable Antioxidant Defense, Proline Metabolism, and Dehydrin b Expression in White Clover. Agronomy, 15(1), 126. https://doi.org/10.3390/agronomy15010126

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop