Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material, Growth Conditions, and Stress Treatment
2.2. RNA Isolation and cDNA Synthesis
2.3. Primer Design and Selection for qPCR Analysis
2.4. RT-qPCR Analysis
2.5. Biochemical Parameters
2.5.1. Quantification of H2O2
2.5.2. Extraction and Quantification of Photosynthetic Pigments
2.5.3. Quantification of Reduced Glutathione (GSH)
2.6. Quantification of Ni Accumulated
2.7. Biometric Parameters
2.8. Statistical Analysis
3. Results
3.1. RT-qPCR
Gene Expression Study of the MTs and PCS1
3.2. Effect of the Increasing Concentrations of Ni in the Accumulation of This HM
3.3. Biochemical Parameters
3.3.1. Effect of the Increasing Concentrations of Ni in the H2O2 Levels
3.3.2. Effect of the Increasing Concentrations of Ni in the Photosynthetic Pigment’s Levels
3.3.3. Effect of the Increasing Concentrations of Ni on the GSH Levels
3.4. Effect of the Increasing Concentrations of Ni in Biometric Parameters
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghous, M.; Iqbal, S.; Bakhtavar, M.A.; Nawaz, F.; Haq, T.u.; Khan, S. Halophyte quinoa: A potential hyperaccumulator of heavy metals for phytoremediation. Asian. J. Agric. Biol. 2022, 4, 1–9. [Google Scholar] [CrossRef]
- Sall, M.L.; Diaw, A.K.D.; Gningue-Sall, D.; Efremova Aaron, S.; Aaron, J.J. Toxic heavy metals: Impact on the environment and human health, and treatment with conducting organic polymers, a review. Environ. Sci. Pollut. Res. Int. 2020, 27, 29927–29942. [Google Scholar] [CrossRef]
- Alengebawy, A.; Abdelkhalek, S.T.; Qureshi, S.R.; Wang, M.Q. Heavy Metals and Pesticides Toxicity in Agricultural Soil and Plants: Ecological Risks and Human Health Implications. Toxics 2021, 9, 42. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, T.; Noman, M.; Ijaz, M.; Ali, S.; Rizwan, M.; Ijaz, U.; Hameed, A.; Ahmad, U.; Wang, Y.; Sun, G.; et al. Current trends and future prospective in nanoremediation of heavy metals contaminated soils: A way forward towards sustainable agriculture. Ecotoxicol. Environ. Saf. 2021, 227, 112888. [Google Scholar] [CrossRef]
- Tumanyan, A.F.; Seliverstova, A.P.; Zaitseva, N.A. Effect of Heavy Metals on Ecosystems. Chem. Technol. Fuels Oils 2020, 56, 390–394. [Google Scholar] [CrossRef]
- Kiran; Bharti, R.; Sharma, R. Effect of heavy metals: An overview. Mater. Today: Proc. 2022, 51, 880–885. [Google Scholar] [CrossRef]
- Radocaj, D.; Velić, N.; Jurišić, M.; Merdic, E. The remediation of agricultural land contaminated by heavy metals. Poljoprivreda 2020, 26, 30–42. [Google Scholar] [CrossRef]
- Rai, R.; Agrawal, M.; Agrawal, S.B. Impact of Heavy Metals on Physiological Processes of Plants: With Special Reference to Photosynthetic System. In Plant Responses to Xenobiotics; Singh, A., Prasad, S.M., Singh, R.P., Eds.; Springer: Singapore, 2016; pp. 127–140. [Google Scholar] [CrossRef]
- Sandeep, G.; Vijayalatha, K.R.; Anitha, T. Heavy metals and its impact in vegetable crops. Int. J. Chem. Stud. 2018, 7, 1612–1621. [Google Scholar]
- Chen, Y.-G.; He, X.-L.-S.; Huang, J.-H.; Luo, R.; Ge, H.-Z.; Wołowicz, A.; Wawrzkiewicz, M.; Gładysz-Płaska, A.; Li, B.; Yu, Q.-X.; et al. Impacts of heavy metals and medicinal crops on ecological systems, environmental pollution, cultivation, and production processes in China. Ecotoxicol. Environ. Saf. 2021, 219, 112336. [Google Scholar] [CrossRef]
- Hassan, M.U.; Chattha, M.U.; Khan, I.; Chattha, M.B.; Aamer, M.; Nawaz, M.; Ali, A.; Khan, M.A.U.; Khan, T.A. Nickel toxicity in plants: Reasons, toxic effects, tolerance mechanisms, and remediation possibilities—A review. Environ. Sci. Pollut. Res. Int. 2019, 26, 12673–12688. [Google Scholar] [CrossRef]
- Nowicka, B. Heavy metal–induced stress in eukaryotic algae—Mechanisms of heavy metal toxicity and tolerance with particular emphasis on oxidative stress in exposed cells and the role of antioxidant response. Environ. Sci. Pollut. Res. Int. 2022, 29, 16860–16911. [Google Scholar] [CrossRef] [PubMed]
- Buxton, S.; Garman, E.; Heim, K.E.; Lyons-Darden, T.; Schlekat, C.E.; Taylor, M.D.; Oller, A.R. Concise Review of Nickel Human Health Toxicology and Ecotoxicology. Inorganics 2019, 7, 89. [Google Scholar] [CrossRef]
- Nualla-Ong, A.; Phongdara, A.; Buapet, P. Copper and zinc differentially affect root glutathione accumulation and phytochelatin synthase gene expression of Rhizophora mucronata seedlings: Implications for mechanisms underlying trace metal tolerance. Ecotoxicol. Environ. Saf. 2020, 205, 111175. [Google Scholar] [CrossRef] [PubMed]
- Filiz, E.; Saracoglu, I.; Ozyigit, I.; Yalcin, B. Comparative analyses of phytochelatin synthase (PCS) genes in higher plants. Biotechnol. Biotechnol. Equip. 2019, 33, 178–194. [Google Scholar] [CrossRef]
- Peterson, A.G.; Oliver, D.J. Leaf-targeted phytochelatin synthase in Arabidopsis thaliana. Plant Physiol. Biochem. 2006, 44, 885–892. [Google Scholar] [CrossRef] [PubMed]
- Dubey, A.K.; Kumar, A.; Kumar, N.; Kumar, S.; Meenakshi; Gautam, A.; Ansari, M.A.; Manika, N.; Lal, S.; Behera, S.K.; et al. Over-expression of chickpea metallothionein 1 gene confers tolerance against major toxic heavy metal stress in Arabidopsis. Physiol. Mol. Biol. Plants 2021, 27, 2665–2678. [Google Scholar] [CrossRef] [PubMed]
- Zhigang, A.; Cuijie, L.; Yuangang, Z.; Yejie, D.; Wachter, A.; Gromes, R.; Rausch, T. Expression of BjMT2, a metallothionein 2 from Brassica juncea, increases copper and cadmium tolerance in Escherichia coli and Arabidopsis thaliana, but inhibits root elongation in Arabidopsis thaliana seedlings. J. Exp. Bot. 2006, 57, 3575–3582. [Google Scholar] [CrossRef] [PubMed]
- Xiong, W.; Wang, P.; Yan, T.; Cao, B.; Xu, J.; Liu, D.; Luo, M. The rice “fruit-weight 2.2-like” gene family member OsFWL4 is involved in the translocation of cadmium from roots to shoots. Planta 2018, 247, 1247–1260. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Zhao, D.-X.; Miao, Q.; Xue, T.-T.; Li, X.-Z.; Zheng, C.-C. Arabidopsis thaliana Metallothionein, AtMT2a, Mediates ROS Balance during Oxidative Stress. J. Plant. Biol. 2009, 52, 585–592. [Google Scholar] [CrossRef]
- Jin, S.; Sun, D.; Wang, J.; Li, Y.; Wang, X.; Liu, S. Expression of the rgMT gene, encoding for a rice metallothionein-like protein in Saccharomyces cerevisiae and Arabidopsis thaliana. J. Genet. 2014, 93, 709–718. [Google Scholar] [CrossRef]
- Guo, W.J.; Meetam, M.; Goldsbrough, P.B. Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance. Plant Physiol. 2008, 146, 1697–1706. [Google Scholar] [CrossRef]
- Sekhar, K.; Priyanka, B.; Reddy, V.D.; Rao, K.V. Metallothionein 1 (CcMT1) of pigeonpea (Cajanus cajan, L.) confers enhanced tolerance to copper and cadmium in Escherichia coli and Arabidopsis thaliana. Environ. Exp. Bot. 2011, 72, 131–139. [Google Scholar] [CrossRef]
- Gu, C.S.; Liu, L.Q.; Deng, Y.M.; Zhu, X.D.; Huang, S.Z.; Lu, X.Q. The heterologous expression of the Iris lactea var. chinensis type 2 metallothionein IlMT2b gene enhances copper tolerance in Arabidopsis thaliana. Bull. Environ. Contam. Toxicol. 2015, 94, 247–253. [Google Scholar] [CrossRef]
- Guo, W.-J.; Bundithya, W.; Goldsbrough, P.B. Characterization of the Arabidopsis metallothionein gene family: Tissue-specific expression and induction during senescence and in response to copper. New Phytol. 2003, 159, 369–381. [Google Scholar] [CrossRef] [PubMed]
- Cazalé, A.C.; Clemens, S. Arabidopsis thaliana expresses a second functional phytochelatin synthase. FEBS Lett. 2001, 507, 215–219. [Google Scholar] [CrossRef] [PubMed]
- Vatamaniuk, O.K.; Mari, S.; Lang, A.; Chalasani, S.; Demkiv, L.O.; Rea, P.A. Phytochelatin synthase, a dipeptidyltransferase that undergoes multisite acylation with gamma-glutamylcysteine during catalysis: Stoichiometric and site-directed mutagenic analysis of Arabidopsis thaliana PCS1-catalyzed phytochelatin synthesis. J. Biol. Chem. 2004, 279, 22449–22460. [Google Scholar] [CrossRef]
- Fan, W.; Guo, Q.; Liu, C.; Liu, X.; Zhang, M.; Long, D.; Xiang, Z.; Zhao, A. Two mulberry phytochelatin synthase genes confer zinc/cadmium tolerance and accumulation in transgenic Arabidopsis and tobacco. Gene 2018, 645, 95–104. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
- Noor, I.; Sohail, H.; Sun, J.; Nawaz, M.A.; Li, G.; Hasanuzzaman, M.; Liu, J. Heavy metal and metalloid toxicity in horticultural plants: Tolerance mechanism and remediation strategies. Chemosphere 2022, 303, 135196. [Google Scholar] [CrossRef] [PubMed]
- Thakur, M.; Praveen, S.; Divte, P.R.; Mitra, R.; Kumar, M.; Gupta, C.K.; Kalidindi, U.; Bansal, R.; Roy, S.; Anand, A.; et al. Metal tolerance in plants: Molecular and physicochemical interface determines the “not so heavy effect” of heavy metals. Chemosphere 2022, 287, 131957. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Fujita, M. Plant Oxidative Stress: Biology, Physiology and Mitigation. Plants 2022, 11, 1185. [Google Scholar] [CrossRef] [PubMed]
- Helaoui, S.; Hattab, S.; Mkhinini, M.; Boughattas, I.; Majdoub, A.; Banni, M. The Effect of Nickel Exposure on Oxidative Stress of Vicia faba Plants. Bull. Environ. Contam. Toxicol. 2022, 108, 1074–1080. [Google Scholar] [CrossRef] [PubMed]
- Nisar, N.; Li, L.; Lu, S.; Khin, N.C.; Pogson, B.J. Carotenoid Metabolism in Plants. Mol. Plant 2015, 8, 68–82. [Google Scholar] [CrossRef] [PubMed]
- Roukas, T. The role of oxidative stress on carotene production by Blakeslea trispora in submerged fermentation. Crit. Rev. Biotechnol. 2016, 36, 424–433. [Google Scholar] [CrossRef] [PubMed]
- Hasanuzzaman, M.; Bhuyan, M.; Anee, T.I.; Parvin, K.; Nahar, K.; Mahmud, J.A.; Fujita, M. Regulation of Ascorbate-Glutathione Pathway in Mitigating Oxidative Damage in Plants under Abiotic Stress. Antioxidants 2019, 8, 384. [Google Scholar] [CrossRef]
- Woodward, A.W.; Bartel, B. Biology in Bloom: A Primer on the Arabidopsis thaliana Model System. Genetics 2018, 208, 1337–1349. [Google Scholar] [CrossRef]
- Cobbett, C.; Goldsbrough, P. Phytochelatins and metallothioneins: Roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant Biol. 2002, 53, 159–182. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Goldsbrough, P.B. Functional homologs of fungal metallothionein genes from Arabidopsis. Plant Cell 1994, 6, 875–884. [Google Scholar] [CrossRef]
- Zhou, J.; Goldsbrough, P.B. Structure, organization and expression of the metallothionein gene family in Arabidopsis. Mol. Genet. Genom 1995, 248, 318–328. [Google Scholar] [CrossRef] [PubMed]
- Clemens, S.; Kim, E.J.; Neumann, D.; Schroeder, J.I. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast. EMBO J. 1999, 18, 3325–3333. [Google Scholar] [CrossRef] [PubMed]
- Zheng, T.; Wu, G.; Tao, X.; He, B. Arabidopsis SUMO E3 ligase SIZ1 enhances cadmium tolerance via the glutathione-dependent phytochelatin synthesis pathway. Plant Sci. 2022, 322, 111357. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.O.; Kang, H.; Ahn, S.J. Overexpression of phytochelatin synthase AtPCS2 enhances salt tolerance in Arabidopsis thaliana. J. Plant Physiol. 2019, 240, 153011. [Google Scholar] [CrossRef] [PubMed]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
- Pessoa, A.M.; Pereira, S.; Teixeira, J. PrimerIdent: A web based tool for conserved primer design. Bioinformation 2010, 5, 52–54. [Google Scholar] [CrossRef]
- Kim, Y.O.; Kang, H. Comparative expression analysis of genes encoding metallothioneins in response to heavy metals and abiotic stresses in rice (Oryza sativa) and Arabidopsis thaliana. Biosci. Biotechnol. Biochem. 2018, 82, 1656–1665. [Google Scholar] [CrossRef] [PubMed]
- Brunetti, P.; Zanella, L.; Proia, A.; De Paolis, A.; Falasca, G.; Altamura, M.M.; Sanità di Toppi, L.; Costantino, P.; Cardarelli, M. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1. J. Exp. Bot. 2011, 62, 5509–5519. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, H.; Higashiyama, T. A species-specific cluster of defensin-like genes encodes diffusible pollen tube attractants in Arabidopsis. PLoS Biol. 2012, 10, e1001449. [Google Scholar] [CrossRef]
- Ferreira, M.J.; Silva, J.; Pinto, S.C.; Coimbra, S. I Choose You: Selecting Accurate Reference Genes for qPCR Expression Analysis in Reproductive Tissues in Arabidopsis thaliana. Biomolecules 2023, 13, 463. [Google Scholar] [CrossRef]
- Remans, T.; Smeets, K.; Opdenakker, K.; Mathijsen, D.; Vangronsveld, J.; Cuypers, A. Normalisation of real-time RT-PCR gene expression measurements in Arabidopsis thaliana exposed to increased metal concentrations. Planta 2008, 227, 1343–1349. [Google Scholar] [CrossRef] [PubMed]
- Alves, A.; Ribeiro, R.; Azenha, M.; Cunha, M.; Teixeira, J. Effects of Exogenously Applied Copper in Tomato Plants’ Oxidative and Nitrogen Metabolisms under Organic Farming Conditions. Horticulturae 2023, 9, 323. [Google Scholar] [CrossRef]
- Tosin, R.; Pôças, I.; Novo, H.; Teixeira, J.; Fontes, N.; Graça, A.; Cunha, M. Assessing predawn leaf water potential based on hyperspectral data and pigment’s concentration of Vitis vinifera L. in the Douro Wine Region. Sci. Hortic. 2021, 278, 109860. [Google Scholar] [CrossRef]
- Martins, M.; Lopes, J.; Sousa, B.; Soares, C.; Valente, I.M.; Rodrigues, J.A.; Fidalgo, F.; Teixeira, J. Cr (VI)-induced oxidative damage impairs ammonia assimilation into organic forms in Solanum lycopersicum L. Plant Stress 2021, 2, 100034. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Renella, G.; Chaudri, A.M.; Brookes, P.C. Fresh additions of heavy metals do not model long-term effects on microbial biomass and activity. Soil. Biol. Biochem. 2002, 34, 121–124. [Google Scholar] [CrossRef]
- Giller, K.E.; Witter, E.; McGrath, S.P. Heavy metals and soil microbes. Soil. Biol. Biochem. 2009, 41, 2031–2037. [Google Scholar] [CrossRef]
- Smolders, E.; McGrath, S.P.; Lombi, E.; Karman, C.C.; Bernhard, R.; Cools, D.; Van den Brande, K.; van Os, B.; Walrave, N. Comparison of toxicity of zinc for soil microbial processes between laboratory-contamined and polluted field soils. Environ. Toxicol. Chem. 2003, 22, 2592–2598. [Google Scholar] [CrossRef]
- Khandekar, S.; Leisner, S. Soluble silicon modulates expression of Arabidopsis thaliana genes involved in copper stress. J. Plant Physiol. 2011, 168, 699–705. [Google Scholar] [CrossRef]
- Jaskulak, M.; Rorat, A.; Grobelak, A.; Chaabene, Z.; Kacprzak, M.; Vandenbulcke, F. Bioaccumulation, antioxidative response, and metallothionein expression in Lupinus luteus L. exposed to heavy metals and silver nanoparticles. Environ. Sci. Pollut. Res. Int. 2019, 26, 16040–16052. [Google Scholar] [CrossRef] [PubMed]
- Boominathan, R.; Doran, P.M. Ni-induced oxidative stress in roots of the Ni hyperaccumulator, Alyssum bertolonii. New Phytol. 2002, 156, 205–215. [Google Scholar] [CrossRef]
- Maheshwari, R.; Dubey, R.S. Nickel-induced oxidative stress and the role of antioxidant defence in rice seedlings. Plant Growth Regul. 2009, 59, 37–49. [Google Scholar] [CrossRef]
- Sun, Q.; Ye, Z.H.; Wang, X.R.; Wong, M.H. Cadmium hyperaccumulation leads to an increase of glutathione rather than phytochelatins in the cadmium hyperaccumulator Sedum alfredii. J. Plant Physiol. 2007, 164, 1489–1498. [Google Scholar] [CrossRef]
- Kukkola, E.; Rautio, P.; Huttunen, S. Stress indications in copper- and nickel-exposed Scots pine seedlings. Environ. Exp. Bot. 2000, 43, 197–210. [Google Scholar] [CrossRef]
- Freeman, J.L.; Persans, M.W.; Nieman, K.; Albrecht, C.; Peer, W.; Pickering, I.J.; Salt, D.E. Increased glutathione biosynthesis plays a role in nickel tolerance in thlaspi nickel hyperaccumulators. Plant Cell 2004, 16, 2176–2191. [Google Scholar] [CrossRef] [PubMed]
- Gajewska, E.; Skłodowska, M. Effect of nickel on ROS content and antioxidative enzyme activities in wheat leaves. Biometals 2007, 20, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Bazihizina, N.; Redwan, M.; Taiti, C.; Giordano, C.; Monetti, E.; Masi, E.; Azzarello, E.; Mancuso, S. Root based responses account for Psidium guajava survival at high nickel concentration. J. Plant Physiol. 2015, 174, 137–146. [Google Scholar] [CrossRef]
- Shukla, R.; Gopal, R. Excess Nickel Alters Growth, Metabolism, and Translocation of Certain Nutrients in Potato. J. Plant Nutr. 2009, 32, 1005–1014. [Google Scholar] [CrossRef]
- Pandey, N.; Sharma, C.P. Effect of heavy metals Co2+, Ni2+ and Cd2+ on growth and metabolism of cabbage. Plant Sci. 2002, 163, 753–758. [Google Scholar] [CrossRef]
- Kersten, W.J.; Brooks, R.R.; Reeves, R.D.; Jaffré, A. Nature of nickel complexes in Psychotria douarrei and other nickel-accumulating plants. Phytochemistry 1980, 19, 1963–1965. [Google Scholar] [CrossRef]
- Lee, J.; Reeves, R.D.; Brooks, R.R.; Jaffré, T. Isolation and identification of a citrato-complex of nickel from nickel-accumulating plants. Phytochemistry 1977, 16, 1503–1505. [Google Scholar] [CrossRef]
- Montargès-Pelletier, E.; Chardot, V.; Echevarria, G.; Michot, L.J.; Bauer, A.; Morel, J.L. Identification of nickel chelators in three hyperaccumulating plants: An X-ray spectroscopic study. Phytochemistry 2008, 69, 1695–1709. [Google Scholar] [CrossRef]
Gene | Primer | Sequence | Reference | E (%) | R2 | Slope | Melting Tm (°C) |
---|---|---|---|---|---|---|---|
MT1A | Forward | CCTGCAAATGTGGTGACTCT | [46] | 100.1 | 0.975 | −3.320 | 78.5 |
Reverse | ACCCACAGCTGCAGTTTGAT | ||||||
MT1B | Forward | AGAGATGTGTGTGTTGTTGG | This work | 109.1 | 0.98 | −3.121 | 78 |
Reverse | TTGGTGAGAGTGGGACTTG | ||||||
MT1C | Forward | CCTGCAAATGTGGTGATTCGT | [46] | 105.3 | 0.992 | −3.200 | 79 |
Reverse | ACAGTTACAGCTTGACCCGCA | ||||||
MT2A | Forward | GGTTGCAAAATGTACCCTGAC | This work | 96.1 | 0.998 | −3.419 | 81 |
Reverse | TCTCAGCGTTGTTACTCTCC | ||||||
MT2B | Forward | GTGGAAGCTGTGGTTGTGG | [46] | 105.9 | 0.998 | −3.188 | 83.5 |
Reverse | AACGAAAGTCTCGCCGGAAG | ||||||
MT3 | Forward | ACAAGACCCAGTGCGTAAAG | This work | 100.0 | 0.999 | −3.322 | 79 |
Reverse | ATGGCCTCCTTGTAGCTCTC | ||||||
PCS1 | Forward | TGCGTGATGGGAATGAACAA | [47] | 132.2 | 0.998 | −2.734 | 60 |
Reverse | TTTGCGTCGATGGCACTAAC | ||||||
ACT2 | Forward | CTTGCACCAAGCAGCATGAA | [48] | 103.8 | 0.999 | −3.233 | 77 |
Reverse | CCGATCCAGACACTGTACTTCCTT | ||||||
YLS8 | Forward | AAGATCAACTGGGCTCTCAAGG | [49] | 90.0 | 0.996 | −3.587 | 82.5 |
Reverse | TGGGAAGCTCGATTAGTAACGG | ||||||
SAND | Forward | AACTCTATGCAGCATTTGATCCACT | [50] | 99.5 | 0.997 | −3.335 | 60 |
Reverse | TGATTGCATATCTTTATCGCCATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Afonseca, A.; Mota, I.; Vasques, G.; Soares, L.; Flores, M.; Azenha, M.; Teixeira, J. Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses. Agronomy 2024, 14, 3026. https://doi.org/10.3390/agronomy14123026
Afonseca A, Mota I, Vasques G, Soares L, Flores M, Azenha M, Teixeira J. Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses. Agronomy. 2024; 14(12):3026. https://doi.org/10.3390/agronomy14123026
Chicago/Turabian StyleAfonseca, Ana, Inês Mota, Gonçalo Vasques, Leonel Soares, Mafalda Flores, Manuel Azenha, and Jorge Teixeira. 2024. "Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses" Agronomy 14, no. 12: 3026. https://doi.org/10.3390/agronomy14123026
APA StyleAfonseca, A., Mota, I., Vasques, G., Soares, L., Flores, M., Azenha, M., & Teixeira, J. (2024). Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses. Agronomy, 14(12), 3026. https://doi.org/10.3390/agronomy14123026