Next Article in Journal
Endophytic Bacterial Communities in Wild Rice (Oryza eichingeri) and Their Effects on Cultivated Rice Growth
Next Article in Special Issue
Epidemiology of Xylella fastidiosa in Ibiza and Formentera: A Comprehensive Study of Insect Vectors and Transmission Dynamics
Previous Article in Journal
Effect of Light Intensity and Two Different Nutrient Solutions on the Yield of Flowers and Cannabinoids in Cannabis sativa L. Grown in Controlled Environment
Previous Article in Special Issue
Deletion of the 3′ End of the Introduced cry1Ac Gene Retains the Insecticidal Activity in Transgenic Cotton
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae)

1
College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 311121, China
2
Zhongyuan Research Center, Chinese Academy of Agricultural Sciences, Xinxiang 453500, China
3
State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China
4
Guizhou Mountainous Meteorological Science Research Institute, Guiyang 550002, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2024, 14(12), 2958; https://doi.org/10.3390/agronomy14122958 (registering DOI)
Submission received: 29 October 2024 / Revised: 28 November 2024 / Accepted: 10 December 2024 / Published: 12 December 2024

Abstract

In the context of climate change, characterized by an increase in average precipitation, agricultural pests have demonstrated enhanced adaptability to high humidity and other challenging environmental conditions, thereby intensifying the need for effective prevention and control measures. Among these pests, Megoura crassicauda (Hemiptera: Aphididae) represents a significant threat to both crop yield and quality. The aim of this study was to investigate the physiological behavioral changes and the regulatory mechanisms of trehalose metabolism in M. crassicauda under conditions of high-humidity stress. Additionally, we sought to explore the survival strategies and water regulation mechanisms employed by this insect, with the goal of identifying new biological targets for its management. The findings indicated that, despite an increase in environmental humidity, there was no significant difference in the survival rate of M. crassicauda. However, a reduction in developmental duration and reproductive capacity was observed. Increased humidity correlated with elevated trehalose levels and decreased glycogen content. Notably, although the relative expression levels of trehalase (TRE) and Trehalose-6-phosphate synthase (TPS) were downregulated, Trehalose-6-phosphate phosphatase (TPP) expression was upregulated. These results suggest that high humidity environments significantly influence the growth, development, and trehalose metabolism of M. crassicauda. It appears that adaptations to high-humidity conditions in M. crassicauda are facilitated by modulations in the types and distribution of sugars within their bodies, achieved through alterations in the expression of genes associated with trehalose metabolism. In summary, the results of this study indicate that high humidity significantly affects the development and sugar metabolism of M. crassicauda. These changes may represent one of the potential mechanisms underlying its environmental adaptation and migration. This insight provides valuable assistance for predicting the occurrence and migration of the pest M. crassicauda.

1. Introduction

In recent years, the phenomenon of global climate change has led to an increase in the frequency of extreme weather events such as heatwaves, heavy rainfall, droughts, and tropical cyclones [1]. These events have had a substantial impact on agricultural production and insect populations. The decline in food crop yields attributable to pest infestations poses a significant threat to global food production [2]. Climate change will have a vast impact on the fitness and ranges of current species. Increasing temperature is the most frequently considered variable, yet other attributes, such as changes in rainfall and the frequency and duration of extreme events, can lead to changes in insect populations, migration, and behavior [3,4]. Humidity is essential for the water necessary for normal physiological activities in insects, such as digestion, metabolism, and excretion [5]. However, the body structure of insects makes it challenging for them to retain water [6]. Consequently, they are highly sensitive to changes in humidity and seek out optimal microclimates to regulate their water balance [7].
Related studies have demonstrated that long-term exposure to high humidity can promote the proliferation and spread of insect pathogenic microorganisms, as well as disrupt the normal activities of their natural predators. This can significantly affect pest control efforts [8]. Furthermore, high humidity can negatively affect respiration by causing an accumulation of water in the tracheal system, which hinders efficient respiratory gas exchange [9]. High humidity is advantageous for extending the flight duration of Sitobion avenae (Homoptera: Aphididae), whereas low humidity negatively impacts its survival and flight speed [10]. Temperature and relative humidity have a marked effect on the egg development time and larval survival of Dermacentor variabilis (Ixodida: Ixodidae) [11]. Arthropods have gradually evolved a range of behavioral coping strategies as well as physiological and molecular regulatory mechanisms over time to adapt to the humidity of the surrounding environment [12]. Compared to drought conditions, the reproduction of Bradysia odoriphaga (Diptera: Sciaridae) adults and larvae significantly increase under high soil moisture levels [13]. Humidity can significantly influence the hibernation behavior of Vespa magnifica (Hymenoptera: Vespidae). As the relative humidity decreases, both the survival rate and hibernation rate of the queen bee decline [14]. Insects also use local variations in humidity as cues for foraging and oviposition site selection. For example, both nectar- and blood-feeding species use minute short-range local variations in humidity to guide them to food sources and optimal locations for laying eggs [15,16]. The humidity-sensing neurons in insects detect changes in humidity, enabling them to gather information about external humidity fluctuations and respond with appropriate behavioral and physiological adjustments [14]. Some insects can utilize their ability to perceive humidity to guide specific behavioral changes. For the biting insects of Anopheles gambiae (Diptera: Culicidae), increased humidity and temperature can enhance their attacking and biting behaviors [17]. Arthropods utilize their ability to perceive humidity for environmental navigation, while Macroglossum stellatarum (Lepidoptera: Sphingidae) uses humidity to assess the nectar content in flowers [18]. Related studies have demonstrated that humidity exhibits a strong nonlinear relationship with the intrinsic population growth rate of Dermatophagoides farinae (Acariformes: Pyroglyphidae), with peak values occurring at approximately 28 °C and 85% relative humidity [19].
Trehalose serves as a source of energy and sugar, and it is the primary carbohydrate found in insect hemolymph, commonly referred to as blood sugar [20]. Previous studies have indicated that trehalose metabolism is associated with the adaptation to changes in environmental water content [21]. This regulation of trehalose metabolism highlights the indispensability of its dynamics for overall insect fitness and survival [22]. As the most synthesized disaccharide in response to stress, the mixtures of trehalose with highly hydrophilic proteins enter a vitrification process to maintain the stability of cells and proteins under challenging conditions and acts as a stabilizer for biological proteins [23,24]. Like many organisms that produce trehalose, insects synthesize trehalose through the TPP/TPS pathway. The synthesis of trehalose in insect adipose tissues relies on the catalytic activity of Trehalose-6-phosphate synthase (TPS) and Trehalose-6-phosphate phosphatase (TPP). Trehalose is then hydrolyzed into two molecules of glucose by the specialized hydrolase, trehalase (TRE) [8,25]. Finally, it is transported to the hemolymph through specific transmembrane transporters, thereby maintaining the balance of carbohydrate metabolism in the body [26]. There are two types of trehalase in insects: soluble trehalase (TRE1), which primarily decomposes trehalose within cells, and membrane-bound trehalase (TRE2), which features a transmembrane structure on the N-hydroxyl group and primarily hydrolyzes the trehalose in food [22].
Megoura crassicauda feeds selectively on a variety of fabaceous plants in the genus Vicia [27]. Their feeding is mainly focused on the inner side of plant leaves and fruit ears, and they suck out the sap through the sieve tube of the phloem [28]. In instances of substantial damage caused by aphids, soybean yields may experience reductions of up to 40% [29].
Trehalose is crucial for maintaining normal physiological activities of M. crassicauda, but there is currently limited research on the association between humidity and M. crassicauda, and the mechanism by which high humidity affects trehalose metabolism in M. crassicauda is not yet clear. Therefore, exploring the expression changes in trehalose metabolism in response to high-humidity stress is of great significance. In this study, we monitored the growth and development characteristics and the content of carbohydrates in the body of M. crassicauda under high-humidity stress, and conducted in-depth research on the expression of related genes in the trehalose metabolism pathway. This research provides a foundation for understanding the adaptive mechanisms of M. crassicauda to high-humidity environments and offers insights into the prediction and control of M. crassicauda occurrences.

2. Materials and Methods

2.1. Test Materials and Grouping

The broad bean (Vicia faba) variety used in this experiment was Qingcan No. 14, and the aphid species studied was M. crassicauda. Broad bean seedlings were cultivated to provide a food source for M. crassicauda. The feeding conditions for both the broad beans and aphids were maintained at 19 ± 1 °C with a photoperiod of 16 h of light and 8 h of darkness. Under this condition, M. crassicauda always remains in a state of viviparity and parthenogenesis. The control group was kept in an artificial climate chamber with a relative humidity (RH) of 60%, while two experimental groups were established with RH levels of 75% and 90% in incubators.
The newly born aphids produced by adult female aphids under RH65% were placed under conditions of RH60%, RH75%, and RH90% for cultivation; this generation of aphids is referred to as F1. The newly born aphids produced by the adult aphids of the F1 generation were then separated and further cultivated under their respective humidity conditions, with these aphids being the F2 generation. Similarly, the third-generation aphids produced by the adult aphids of the F2 generation were separated and continued to be cultivated under their corresponding humidity conditions, with these aphids forming the F3 generation.

2.2. Survival Rates, Development, and Reproductive Detection of M. crassicauda

One hundred newly hatched nymphs from each humidity condition of the F1 generation were isolated and reared in nylon net cages containing young broad bean seedlings, with their survival rates recorded every 24 h. The survival rate recording methods for the F2 and F3 generations were consistent with those for the F1 generation. The developmental period of the M. crassicauda refers to the time from newly born nymph to adult (considered an adult after completing the fourth molt). For the statistical analysis of the developmental period, 10 newly born nymphs from each humidity treatment were selected for each generation. For the fertility statistics, 100 female adults from each humidity condition were chosen for each generation, and the number of newly hatched aphids they produced was counted daily over a period of 10 days.

2.3. Determination of Carbohydrate Content and Trehalose Enzyme Activity in M. crassicauda

Adult aphids collected from three humidity groups were subjected to long-term stable high-humidity stress, using 15 aphids per biological replicate for a total of three biological replicates. Three biological replicates were established and three generations were continuously monitored. This portion of the experiment was conducted following the methodology of previous researchers [30].

2.4. Total RNA Extraction and Real-Time Fluorescence Quantitative PCR (qRT-PCR)

The samples used for RT-qPCR were derived from the F3 generation, with 45 adult aphids collected from each humidity treatment group. Each treatment group had three biological replicates, with each replicate consisting of 15 adult aphids.
According to the manufacturer’s instructions, the total RNA was extracted using an RNAiso Plus kit (Takara, Kyoto, Japan). A NanoDrop™ 2000 (Waltham, MA, USA) was used to determine the concentration and purity of the extracted RNA. A PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Kyoto, Japan) was used for the reverse transcription of the cDNA.
The RT-qPCR reaction system (TaKaRa TB Green® Premix Ex TaqTM, Takara, Kyoto, Japan) was used as follows: 1 µL of cDNA, 5 µL of TB Green, 0.4 µL of forward primer, 0.4 µL of reverse primer, and 3.2 µL of ddH2O. The RT-qPCR reaction procedure was pre-denaturation at 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 55–60 °C for 30 s, using M. crassicauda β-Actin (GenBank accession number: AB627775.1) as an internal reference gene. The primer sequences are shown in Table 1. The RT-qPCR data were analyzed using the 2−∆∆CT method [31].

2.5. Statistical Analysis

The results were expressed as the standard error of the mean (SEM) of independent replicates (n ≥ 3). The experimental data were analyzed using IBM SPSS Statistics version 20 statistical software. The survival curves were analyzed using GraphPad Prism 9 software with the Kaplan–Meier method to assess differences. Statistical significance was defined as p < 0.05. Tukey’s post hoc test following one-way ANOVA was performed to assess the significance of differences among the treatments. All figures and tables were produced using Office 2021 and GraphPad Prism 9.0 software.

3. Results

3.1. Transcriptome Expression Analysis of Differential Enzyme Genes Related to Trehalose Metabolism

RNA sequencing (RNA-seq) was conducted on three humidity groups of M. crassicauda subjected to long-term stable stress. This was followed by transcriptome clustering and correction, as well as Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. Statistical analysis revealed that differentially expressed genes were primarily enriched in molecular function, metabolism, cellular processes, and genetic information processing. Differentially expressed enzyme gene sequences associated with trehalose metabolism were identified and compared using NCBI BLAST. As shown in Table 2, the analysis yielded differentially expressed genes, including six TRE1 genes, two TRE2 genes, two TPS genes, and one TPP gene. These genes were selected as target genes for quantitative detection under the three humidity treatments.

3.2. Statistical Analysis of Survival Rate, Developmental Duration, and Reproductive Capacity of M. crassicauda

There was no significant difference (p > 0.05) among the groups across the three consecutive generations; however, it was observed that the survival rate decreased with increasing humidity (Figure 1A–C). The three generations exposed to 75% relative humidity (RH75%) exhibited the longest developmental period, while no significant difference was found in the developmental period of M. crassicauda between the F2 and F3 humidity groups. As the number of generations increased, the developmental period for each humidity group displayed a decreasing trend (Figure 1D). There was no significant difference in the reproductive capacity of M. crassicauda between RH60% and RH75%. However, under RH90% conditions, the offspring number of M. crassicauda was significantly lower compared to the other two groups (Figure 1E).

3.3. Changes in Carbohydrate Content and Two Seaweed Enzyme Activities of M. crassicauda Under Different Humidity Stress Conditions

The research results indicated a significant difference in trehalose content between the control group at 60% relative humidity (RH60%) and the groups at 75% (RH75%) and 90% (RH90%). Furthermore, the trehalose content exhibited an upward trend with increasing humidity (Figure 2A). In contrast, there was no significant difference in glucose content among the three humidity groups (Figure 2B). A significant difference in glycogen content was observed between the RH75% and RH90% groups compared to the RH60% group. Additionally, as the humidity increased, the glycogen content demonstrated a decreasing trend (Figure 2C). There was a significant difference in soluble trehalase activity between the RH75% and RH90% groups (Figure 2D), while no significant difference was found in terms of membrane-bound trehalase activity among the three humidity groups. However, as the humidity increased, the membrane-bound trehalase activity showed a decreasing trend (Figure 2E).

3.4. Response of TRE Gene Expression in M. crassicauda Under Long-Term Stable High-Humidity Stress Conditions

According to the qRT-PCR results, the relative expression levels of TRE1 genes in the RH90% group were lower than those in the RH60% and RH75% groups. With the exception of TRE1-1 and TRE1-5, the relative expression levels of TRE1 genes in the RH60% group were higher than those in the RH75% group. Overall, the TRE1 gene group exhibited a trend of decreasing relative expression levels with increasing humidity, and significant differences were observed in the TRE1-2, TRE1-3, TRE1-5, and TRE1-6 groups (p < 0.05) (Figure 3). Compared with the control group (RH60%), the relative expression level of TRE2-1 in the RH75% and RH90% groups decreased significantly, while no significant difference was noted in the expression level of TRE2-2 (Figure 3).

3.5. Response of TPS and TPP Gene Expression in M. crassicauda Under Long-Term Stable High-Humidity Stress Conditions

The qPCR results indicated that as humidity increased, the expression level of TPS exhibited a trend of initially decreasing and then increasing. However, when compared to the control group, both the RH75% and RH90% groups demonstrated varying degrees of downregulation. The RH75% group showed a significant decrease in expression levels, while the RH90% group also exhibited a notable reduction in the TPS1 expression level (p < 0.05; Figure 4). Additionally, the relative expression level of the TPP gene was positively correlated with humidity, revealing a significant difference between the RH90%, RH60%, and RH75% groups (p < 0.05; Figure 4).

3.6. Response of Trehalose-Metabolizing Enzyme Gene Expression in M. crassicauda Under 24 H Emergency Stress Conditions

Under the conditions of 24 h emergency high-humidity stress, the expression levels at RH75% were significantly elevated (p < 0.05) in comparison to the control group at RH60%, with the exception of the TRE1-1 group. In the TRE1-1, TRE1-2, and TRE1-3 groups, the expression levels at RH90% were found to be lower than those of the control group, whereas the TRE1-4, TRE1-5, and TRE1-6 groups exhibited higher expression levels than the control group at RH90%. Overall, the TRE1 genome demonstrated an increase in expression levels at RH75%, while the response at RH 90% was variable (Figure 5). The TRE2 genome showed the highest expression level at RH75%, with a statistically significant difference observed between RH75% and RH90%. Although no significant differences were found in the expression of the TPS gene, the TPP gene displayed a trend of a relative increase in expression levels as the humidity increased (Figure 5).

4. Discussion

Humidity is a critical climatic variable that exerts a significant influence on both crops and the arthropods that inhabit them. Relative humidity (RH) plays a pivotal role in modulating the physiological activities and other related parameters of arthropods. Arthropods have the ability to extract information about their surroundings via humidity sensation [32]. The experimental findings revealed that, while there were no statistically significant differences in survival rates across the various humidity groups, a trend was observed wherein the survival rates diminished with increasing humidity levels (Figure 1A–C). This observation implies that humidity has a discernible effect on the survival rates of M. crassicauda. This conclusion is consistent with prior research on Halyomorpha halys (Hemiptera: Pentatomidae), which indicated that exposure to low humidity (17% RH) significantly decreased H. halys survival compared with exposure to higher humidity at 40 °C [33]. In the present study, it was noted that the developmental duration of the F1 generation at 90% RH was significantly shortened (Figure 1D), further underscoring the substantial impact of high humidity on insect developmental timelines. Additionally, the previous literature demonstrated that the developmental periods of H. halys increased at temperatures above 30 °C [34]. The 90% RH condition exhibited a marked inhibitory effect on the reproductive capacity of M. crassicauda, which was particularly pronounced in the F2 and F3 generations (Figure 1E). Previous investigations have established that male insects suffer from decreased fertility in response to increased temperature [35], indicating that extreme humidity levels significantly disrupt the reproductive behaviors of some insects. As the number of generations progresses, the reproductive potential of M. crassicauda appears to converge under the two humidity environments of 60% RH and 75% RH. This observation is corroborated by evidence suggesting that cadmium (Cd) stress has negligible effects on the fourth and fifth generations of M. crassicauda [36]. This suggests that the diminution in reproductive capacity is contingent upon the specific type of environmental stressor, with conditions characterized by elevated humidity exerting a more pronounced influence on the reproductive performance of M. crassicauda.
M. crassicauda is classified as a hemimetabolous insect, wherein trehalose serves not only as an energy source, but also as a vital metabolite that enhances stress resistance during insect diapause and other stress-related processes [20]. In investigations focused on drought resistance in Belgica antarctica (Diptera: Chironomidae) and Chironomus ramosus (Diptera: Chironomidae), it was noted that the trehalose levels in the insect body significantly increase under drought stress, comprising a considerable portion of its overall body mass [37]. Furthermore, studies have demonstrated that insects can adapt to heavy metal stress by regulating their trehalose metabolism pathways [36]. Drosophila melanogaster (Diptera: Drosophilidae) also exhibits a marked rise in trehalose levels in its hemolymph when subjected to drought and water-deficient conditions, forming a protective layer on the cell surface that shields biomolecular structures from potential damage [38]. Experimental findings indicate a correlation between increased humidity and elevated trehalose content in M. crassicauda (Figure 2A), suggesting that insects can enhance their metabolic processes by augmenting trehalose levels to adapt to challenging environmental conditions. Additionally, research has established a close association between elevated trehalose levels and the molting process in Periplaneta americana (Blattodea: Blattidae) [39], which may also contribute to the observed reduction in developmental duration in M. crassicauda. Importantly, no significant differences were detected in the total glucose content of M. crassicauda across three humidity conditions during prolonged humidity exposure (Figure 2B). As a hemimetabolous insect, it is hypothesized that related hormones, such as 20-hydroxyecdysone [40], may also play a role in regulating glucose homeostasis. Notably, as humidity levels rise, the glycogen content in M. crassicauda exhibits a decreasing trend (Figure 2C). This suggests that insects can endure external stressors through the metabolic consumption of glycogen.
In this study, under long-term stable high-humidity stress, the relative expression level of the TRE1 gene in the RH90% group decreased, the activity of soluble trehalose decreased, and the content of trehalose increased (Figure 2D). Related studies have demonstrated that the pine wood nematode Bursaphelenchus xylophilus (Aphelenchida: Aphelenchoididae) responds to low-temperature stress, causing the downregulation of Bx-tre-1 expression, a stress-induced increase in trehalose content, and the promotion of low-temperature stress resistance in B. xylophilus [41]. This suggests that the TRE1 gene can modulate trehalose levels within the organism by altering its expression, thereby facilitating adaptation to growth and development. However, despite the significant downregulation of TRE2-1 expression levels in the RH75% and RH90% groups, there was no significant change in TRE2 activity (Figure 2E and Figure 3). In a study on Conopomorpha sinensis (Lepidoptera: Gracillariidae), it was also demonstrated that TRE genes play a crucial role in trehalose metabolism [42]. Another study found that trehalose supplementation significantly enhanced the heat tolerance of Ocymyrmex robustior (Hymenoptera: Formicidae) workers and increased the metabolic levels of trehalose under conditions of heat stress [43]. Under long-term Cd stress, the trehalose content in Aedes albopictus (Diptera: Culicidae) increased [44]. In environments containing the heavy metals Cd and Pb, the content of trehalose in aphids increases to resist stress [36], indicating that, under adverse environmental conditions, insects can adapt to environmental changes by regulating intracellular trehalose content. At the same time, studies have shown that TRE1 mainly decomposes intracellular trehalose, while TRE2 mainly hydrolyzes trehalose in food [45]. It is speculated that, due to the fact that aphids under different treatments all feed on fava bean seedlings and have consistent food sources, there is no significant difference in trehalose content in the food. Therefore, there is no significant difference in TRE2 content. In addition, previous studies have found that interference with Tre2-like and Tre2 genes in Harmonia axyridis (Coleoptera: Coccinellidae) not only leads to their death, but also causes molting disorders [46]. Consequently, the membrane-bound trehalase enzyme TRE2 appears to exert a limited direct influence on the ability of M. crassicauda to withstand high-humidity stress and maintain internal water balance. Instead, it may regulate the metabolism of sugars, including trehalose, through the modulation of related gene expression within the insulin signaling pathway.
After rapid cold acclimation, the expression level of the LoTPS gene in Lissorhoptrus oryzophilus (Coleoptera: Curculionidae) increased. LoTPS can enhance survival ability by regulating trehalose metabolism [47]. A study demonstrated that TPS1 increases the trehalose content in D. melanogaster, reduces protein aggregation caused by hypoxia, and increases tolerance to hypoxia [48]. The expression levels of TPS exhibited a pattern of initial decline followed by an increase as humidity levels rose, while the expression of Trehalose-6-phosphate phosphatase (TPP) consistently increased (Figure 4), ultimately resulting in an elevation of trehalose content (Figure 2A). Additionally, research indicates that TPS genes can regulate trehalose levels within the organism by modulating TPS expression, thereby facilitating adaptation during growth and development [20]. Transcriptomic and metabolomic analyses of Arabidopsis thaliana (Brassicaceae) have revealed a correlation between the expression levels of TPS and TPP genes and trehalose content under heat stress [49]. These findings suggest that the regulation of trehalose metabolism through the expression changes in TPP, TPS, and TRE is a relatively widespread strategy employed in nature for coping with environmental stress. This strategy is observed not only in higher organisms such as plants and insects, but also in lower organisms such as fungi.
The experiment concurrently demonstrated notable variations in the expression levels of different genes when comparing 24 h stress to long-term stable stress. This suggests that M. crassicauda experiences adaptive evolution as a response to high-humidity stress. These results align with prior research that has explored the intricate and dynamic natural and anthropogenic environments, illustrating that arthropods have developed a variety of adaptive strategies to rapidly acclimate to their local habitats [50].
Climate change has a significant impact on the prediction and early prevention of pest outbreaks. Changes in atmospheric humidity can affect the migration and reproduction of pests such as M. crassicauda. This study found that M. crassicauda can adapt to changes in environmental humidity by regulating its trehalose metabolism. Furthermore, changes in humidity influence its survival, development, and reproduction. These findings are important for monitoring and controlling pests like M. crassicauda and also contribute to understanding the adaptive mechanisms of insects in response to increased humidity due to climate warming.

5. Conclusions

In this study, high humidity was found to significantly reduce the reproductive capacity of M. crassicauda and affect its trehalose metabolism, while having minimal impact on survival rate and developmental duration. These findings suggest that changes in trehalose metabolism may serve as one of the mechanisms by which M. crassicauda adapts to high-humidity environments. As humidity levels rise, there is an observed increase in the expression of TPP, accompanied by a decrease in the expression of TRE1. This intricate regulatory mechanism results in an elevated trehalose content, which aids in the organism’s ability to endure high-humidity conditions.

Author Contributions

W.M.: Formal analysis, methodology and writing—original draft; H.S.: Investigation, methodology and writing—original draft; S.W.: Data curation, visualization and writing—review and editing; Q.Z.: Formal analysis and investigation; Y.H.: Formal analysis and investigation; W.Z.: Investigation and validation; W.W.: Investigation and validation; Y.X.: Validation and visualization; X.T.: Methodology and supervision; S.S.: Project administration, resources and writing—review and editing; B.T.: Project administration, funding acquisition and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by National Key R&D Program of China (2017YFD0201000), Guizhou Provincial Basic Research Program (Natural Science) ZK [2021]. General 210, and Hangzhou Science and Technology Development Program of China (Grant No. 20190101A01).

Data Availability Statement

Data will be made available on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Roos, J.; Hopkins, R.; Kvarnheden, A.; Dixelius, C. The impact of global warming on plant diseases and insect vectors in Sweden. Eur. J. Plant Pathol. 2010, 129, 9–19. [Google Scholar] [CrossRef]
  2. Newman, J.A. Climate change and the fate of cereal aphids in Southern Britain. Glob. Chang. Biol. 2005, 11, 940–944. [Google Scholar] [CrossRef]
  3. Kellermann, V.; van Heerwaarden, B. Terrestrial insects and climate change: Adaptive responses in key traits. Physiol. Entomol. 2019, 44, 99–115. [Google Scholar] [CrossRef]
  4. Skendžić, S.; Zovko, M.; Zivković, I.P.; Vinko, L.; Darija, L. The impact of climate change on agricultural insect pests. Insects 2021, 12, 440. [Google Scholar] [CrossRef] [PubMed]
  5. Huberty, A.F.; Denno, R.F. Plant water stress and its consequences for herbivorous insects: A new synthesis. Ecology 2004, 85, 1383–1398. [Google Scholar] [CrossRef]
  6. Kühsel, S.; Brückner, A.; Schmelzle, S.; Heethoff, M.; Blüthgen, N. Surface area-volume ratios in insects. Insect Sci. 2017, 24, 829–841. [Google Scholar] [CrossRef]
  7. O’Donnell, M.J. A perspective on insect water balance. J. Exp. Biol. 2022, 225, jeb242358. [Google Scholar] [CrossRef]
  8. Shukla, E.; Thorat, L.J.; Nath, B.B.; Gaikwad, S.M. Insect trehalase: Physiological significance andpotential applications. Glycobiology 2015, 25, 357–367. [Google Scholar] [CrossRef]
  9. Herren, P.; Hesketh, H.; Meyling, N.V.; Dunn, A.M. Environment-host-parasite interactions in mass-reared insects. Trends Parasitol. 2023, 39, 588–602. [Google Scholar] [CrossRef]
  10. Simmons, L.W.; Lovegrove, M.; Du, X.B.; Ren, Y.; Thomas, M.L. Humidity stress and its consequences for male pre- and post-copulatory fitness traits in an insect. Ecol. Evol. 2023, 13, e10244. [Google Scholar] [CrossRef]
  11. Diyes, C.P.; Dergousoff, S.J.; Yunik, M.E.; Chilton, N.B. Reproductive output and larval survival of American dog ticks from a population at the northern distributional limit. Exp. Appl. Acarol. 2021, 83, 257–270. [Google Scholar] [CrossRef]
  12. Giri, G.; Nagloo, N.; Enjin, A. A dynamic humidity arena to explore humidity-related behaviours in insects. J. Exp. Biol. 2024, 227, jeb247195. [Google Scholar] [CrossRef] [PubMed]
  13. Shi, C.H.; Hu, J.R.; Zhang, Y.J. The effects of temperature and humidity on a field population of Bradysia odoriphaga (Diptera: Sciaridae). J. Econ. Entomol. 2020, 113, 1927–1932. [Google Scholar] [CrossRef] [PubMed]
  14. Abou-Shaara, H.F.; Owayss, A.A.; Ibrahim, Y.Y.; Basuny, N.K. A review of impacts of temperature and relative humidity on various activities of honey bees. Insectes Sociaux 2017, 64, 455–463. [Google Scholar] [CrossRef]
  15. Laursen, W.J.; Budelli, G.; Tang, R.; Chang, E.C.; Busby, R.; Shankar, S.; Garrity, P.A. Humidity sensors that alert mosquitoes to nearby hosts and egg-laying sites. Neuron 2023, 111, 874–887.e8. [Google Scholar] [CrossRef] [PubMed]
  16. Salzman, S.; Dahake, A.; Kandalaft, W.; Valencia-Montoya, W.A.; Calonje, M.; Specht, C.D.; Raguso, R.A. Cone humidity is a strong attractant in an obligate cycad pollination system. Curr. Biol. 2023, 33, 1654–1664.e4. [Google Scholar] [CrossRef]
  17. Okal, M.N.; Francis, B.; Herrera-Varela, M.; Fillinger, U.; Lindsay, S.W. Water vapour is a pre-oviposition attractant for the malaria vector Anopheles gambiae sensu stricto. Malar. J. 2013, 12, 365. [Google Scholar] [CrossRef]
  18. Arx, M.V.; Goyret, J.; Davidowitz, G.; Raguso, R.A. Floral humidity as a reliable sensory cue for profitability assessment by nectar-foraging hawkmoths. Proc. Natl. Acad. Sci. USA 2012, 109, 947. [Google Scholar]
  19. Vackova, T.; Pekar, S.; Klimov, P.B.; Hubert, J. Population growth and respiration in the dust mite Dermatophagoides farinae under different temperature and humidity regimes. Exp. Appl. Acarol. 2023, 89, 157–169. [Google Scholar] [CrossRef]
  20. Tang, B.; Xu, Q.Y.; Zhao, L.N.; Wang, S.G.; Zhang, F. Progress in research on the characteristics and functions of trehalose and the TPS gene in insects. Chin. J. Appl. Entomol. 2014, 51, 1397–1405. [Google Scholar]
  21. Cornette, R.; Kanamori, Y.; Watanabe, M.; Nakahara, Y.; Gusev, O.; Mitsumasu, K.; Kadono-Okuda, K.; Shimomura, M.; Mita, K.; Kikawada, T.; et al. Identification of anhydrobiosis-related genes from an expressed sequence tag database in the cryptobiotic midge Polypedilum vanderplanki (Diptera: Chironomidae). J. Biol. Chem. 2010, 358, 89–99. [Google Scholar] [CrossRef] [PubMed]
  22. Tellis, M.B.; Kotkar, H.M.; Joshi, R.S. Regulation of trehalose metabolism in insects: From genes to the metabolite window. Glycobiology 2023, 33, 262–273. [Google Scholar] [CrossRef] [PubMed]
  23. Jiang, L.; Tian, Y.; Zhang, H.; Liu, S. Molecular-level insight into the effects of low moisture and trehalose on the thermostability of β-glucosidase. Food Chem. 2024, 460 Pt 2, 140607. [Google Scholar] [CrossRef] [PubMed]
  24. Toxopeus, J.; Sinclair, B.J. Mechanisms underlying insect freeze tolerance. Biol. Rev. Camb. Philos. Soc. 2018, 93, 1891–1914. [Google Scholar] [CrossRef]
  25. Becker, A.; Schlöder, P.; Steele, J.E.; Wegener, G. The regulation of trehalose metabolism in insects. Experientia 1996, 52, 433–439. [Google Scholar] [CrossRef]
  26. Leyria, J.E.; Mawed, H.; Orchard, I.; Lange, A.B. Regulation of a trehalose–Specific facilitated transporter (Tret) by insulin and adipokinetic hormone in Rhodnius prolixus, a vector of chagas disease. Front. Physiol. 2021, 12, 624165. [Google Scholar] [CrossRef]
  27. Ohta, N.; Mori, N.; Kuwahara, Y.; Nishida, R. A hemiterpene glucoside as a probing deterrent of the bean aphid, Megoura crassicauda, from a non-host vetch, Vicia hirsuta. Phytochemistry 2006, 67, 584–588. [Google Scholar] [CrossRef]
  28. Rusin, M.; Gospodarek, J.; Nadgórska-Socha, A.; Barczyk, G. Effect of petroleum-derived substances on life history traits of black bean aphid (Aphis fabae Scop.) and on the growth and chemical composition of broad bean. Ecotoxicology 2017, 26, 308–319. [Google Scholar] [CrossRef]
  29. Ragsdale, D.W.; Mccornack, B.P.; Venette, R.C.; Potter, B.D.; MacRae, I.V.; Hodgson, E.W.; Cullen, E.M. Economic threshold for soybean aphid (Hemiptera:Aphididae). J. Econ. Entomol. 2007, 100, 1258–1267. [Google Scholar] [CrossRef]
  30. Wang, X.Z.; Wan, S.J.; He, B.E.; Wang, S.L.; Wang, T.W.; Yu, L.H.; Wang, S.G.; Wang, H.Z.; Tang, B.; Lu, J.J. Physalis floridana suppresses the expression of trehalase gene HvTREs in Henosepilachna vigintioctopunctata (Coleoptera: Coccinellidae) for defense against herbivorous insects. J. Pest Sci. 2024. [Google Scholar] [CrossRef]
  31. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  32. Li, S.; Li, B.; Gao, L.; Wang, J.; Yan, Z. Humidity response in Drosophila olfactory sensory neurons requires the mechanosensitive channel TMEM63. Nat. Commun. 2022, 13, 3814. [Google Scholar] [CrossRef] [PubMed]
  33. Fisher, J.J.; Rijal, J.P.; Zalom, F.G. Temperature and Humidity Interact to Influence Brown Marmorated Stink Bug (Hemiptera: Pentatomidae), Survival. Environ. Entomol. 2021, 50, 390–398. [Google Scholar] [CrossRef] [PubMed]
  34. Mermer, S.; Maslen, E.A.; Dalton, D.T.; Nielsen, A.L.; Rucker, A.; Lowenstein, D.; Wiman, N.; Bhattarai, M.; Soohoo-Hui, A.; Harris, E.T.; et al. Temperature-Dependent Life Table Parameters of Brown Marmorated Stink Bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae) in the United States. Insects 2023, 14, 248. [Google Scholar] [CrossRef] [PubMed]
  35. Baur, J.; Jagusch, D.; Michalak, P.; Koppik, M.; Berger, D. The mating system affects the temperature sensitivity of male and female fertility. Funct. Ecol. 2022, 36, 92–106. [Google Scholar] [CrossRef]
  36. Wang, S.S.; Li, Q.M.; Li, Y.; Wan, S.; Yin, Z.; Zhao, S.; Dai, X.; Wang, R.; Wang, S.; Zhai, Y.; et al. Stress Response of Aphid Population Under Combined Stress of Cadmium and Lead and Its Effects on Development of Harmonia axyridis. Int. J. Mol. Sci. 2024, 25, 11145. [Google Scholar] [CrossRef]
  37. Baumgart, L.; Wittke, M.; Morsbach, S.; Abou, B.; Menzel, F. Why do ants differ in acclimatory ability biophysical mechanisms behind cuticular hydrocarbon acclimation across species. J. Exp. Biol. 2022, 225, 196–199. [Google Scholar] [CrossRef]
  38. Thorat, L.J.; Gaikwad, S.M.; Nath, B.B. Trehalose as an indicator of desiccation stress in Drosophila melanogaster larvae: A potential marker of anhydrobiosis. Biochem. Biophys. Res. Commun. 2012, 419, 638–642. [Google Scholar] [CrossRef]
  39. Steele, J.E. Evidence that ecdysis in the larval cockroach, Periplaneta americana L. is triggered by an increase in the concentration of hemolymph sugar. Arch. Insect Biochem. Physiol. 2016, 92, 159–172. [Google Scholar] [CrossRef]
  40. Wang, X.P.; Huang, Z.; Li, Y.L.; Jin, K.Y.; Dong, D.J.; Wang, J.X.; Zhao, X.F. Krüppel-like factor 15 integrated autophagy and gluconeogenesis to maintain glucose homeostasis under 20-hydroxyecdysone regulation. PLoS Genet. 2022, 18, e1010229. [Google Scholar] [CrossRef]
  41. Chen, Z.T.; Chen, Q.L.; Zhang, R.Z.; Li, D.F.; Wang, F. Bx-daf-2 and Bx-tre-1 synergistically regulate trehalose to promote low-temperature stress resistance in Bursaphelenchus xylophilus. J. Hunan Agric. Univ. (Nat. Sci. Ed.) 2020, 46, 21–27. [Google Scholar]
  42. Yao, Q.; Liang, Z.T.; Duan, S.G.; Dong, Y.Z.; Xu, S.; Li, W.J. Cloning and Bioinformatics Analysis of Trehalase Genes in Conopomorpha sinensis Bradley. Guangdong Agric. Sci. 2024, 51, 13–21. [Google Scholar]
  43. Perez, R.; Aron, S. Protective role of trehalose in the Namib desert ant, Ocymyrmex robustior. J. Exp. Biol. 2023, 226, jeb245149. [Google Scholar] [CrossRef] [PubMed]
  44. Yu, L.Y.; Wei, Y.; Chen, X.M.; Ding, Y.J.; Hu, Y.W.; Tang, B.; Wang, S.G. Effects of heavy metal cadmium on the trehalose metabolism in Aedes albopictus (Diptera: Culicidae) larvae. J. Entomol. 2019, 62, 11. [Google Scholar]
  45. Tang, B.; Wei, P.; Chen, J.; Wang, S.; Zhang, W. Progress in gene features and functions of insect trehalases. Acta Entomol. Sin. 2012, 55, 1315–1321. [Google Scholar]
  46. Li, Y.; Chen, X.; Wang, S.S.; Pan, B.Y.; Wang, S.G.; Wang, S.; Tang, B. Evaluation of the Expression and Function of the TRE2-like and TRE2 Genes in Ecdysis of Harmonia axyridis. Front. Physiol. 2019, 10, 1371. [Google Scholar] [CrossRef]
  47. Zhang, J.; Qi, L.; Chen, B.; Li, H.; Hu, L.; Wang, Q.; Wang, S.; Xi, J. Trehalose-6-Phosphate Synthase Contributes to Rapid Cold Hardening in the Invasive Insect Lissorhoptrus oryzophilus (Coleoptera: Curculionidae) by Regulating Trehalose Metabolism. Insects 2023, 14, 903. [Google Scholar] [CrossRef]
  48. Chen, Q.; Ma, E.; Behar, K.L.; Xu, T.; Haddad, G.G. Role of trehalose phosphate synthase in anoxia tolerance and development in Drosophila melanogaster. J. Biol. Chem. 2002, 277, 3274–3279. [Google Scholar] [CrossRef]
  49. Kaplan, F.; Kopka, J.; Haskell, D.W.; Zhao, W.; Schiller, K.C.; Gatzke, N.; Sung, D.Y.; Guy, C.L. Exploring the temperature-stress metabolome of Arabidopsis. Plant Physiol. 2004, 136, 4159–4168. [Google Scholar] [CrossRef]
  50. Rodrigues, Y.K.; Beldade, P. Thermal plasticity in insects’ response to climate change and to multifactorial environments. Front. Ecol. Evol. 2020, 8, 271. [Google Scholar] [CrossRef]
Figure 1. Growth and development of M. crassicauda under different humidity stress conditions. (A), (B) and (C) represent the survival rate of aphids in the first, second, and third generations, respectively. (D): developmental duration (in hours) of M. crassicauda in different generations. (E): number of offspring of M. crassicauda in different generations. Black, orange, and blue lines, columns, and boxes indicate treatments with 60%, 75%, and 90% relative humidity, respectively. The data are expressed as mean ± standard error. Kaplan–Meier survival curves were drawn using Prism software using the log rank test method (p < 0.05 level). Different letters indicate significant differences in aphids (Tukey test, p < 0.05 level).
Figure 1. Growth and development of M. crassicauda under different humidity stress conditions. (A), (B) and (C) represent the survival rate of aphids in the first, second, and third generations, respectively. (D): developmental duration (in hours) of M. crassicauda in different generations. (E): number of offspring of M. crassicauda in different generations. Black, orange, and blue lines, columns, and boxes indicate treatments with 60%, 75%, and 90% relative humidity, respectively. The data are expressed as mean ± standard error. Kaplan–Meier survival curves were drawn using Prism software using the log rank test method (p < 0.05 level). Different letters indicate significant differences in aphids (Tukey test, p < 0.05 level).
Agronomy 14 02958 g001
Figure 2. Under long-term stable high-humidity stress, the trehalose content (A), glucose content (B), glycogen content (C), soluble trehalase enzyme activity (D), and membrane-bound trehalase enzyme activity (E) of different groups of M. crassicauda were measured. RH—relative humidity. The data are expressed as mean ± standard error from three independent measurements. Different letters indicate significant differences in the developmental period or reproductive capacity of aphids, and the differences are all intragenerational comparisons. Bars with different letters indicate significant differences (Tukey test, p < 0.05 level).
Figure 2. Under long-term stable high-humidity stress, the trehalose content (A), glucose content (B), glycogen content (C), soluble trehalase enzyme activity (D), and membrane-bound trehalase enzyme activity (E) of different groups of M. crassicauda were measured. RH—relative humidity. The data are expressed as mean ± standard error from three independent measurements. Different letters indicate significant differences in the developmental period or reproductive capacity of aphids, and the differences are all intragenerational comparisons. Bars with different letters indicate significant differences (Tukey test, p < 0.05 level).
Agronomy 14 02958 g002
Figure 3. Relative expression levels of TRE1 (AF) and TRE2 (G,H) genes under long-term stable high-humidity stress: TRE1, soluble trehalase; TRE2, membrane-bound trehalase. Expression levels were measured via quantitative real-time PCR, with 18S RNA as the internal control. Values are means ± standard error from three independent measurements. Different letters indicate significant differences according to Tukey’s test (p < 0.05).
Figure 3. Relative expression levels of TRE1 (AF) and TRE2 (G,H) genes under long-term stable high-humidity stress: TRE1, soluble trehalase; TRE2, membrane-bound trehalase. Expression levels were measured via quantitative real-time PCR, with 18S RNA as the internal control. Values are means ± standard error from three independent measurements. Different letters indicate significant differences according to Tukey’s test (p < 0.05).
Agronomy 14 02958 g003
Figure 4. Relative expression levels of TPS (A,B) and TPP (C) genes under long-term stable high-humidity stress. TPS—Trehalose-6-phosphate synthase; TPP—Trehalose-6-phosphate phosphatase. Expression levels were measured via quantitative real-time PCR, with 18S RNA as the internal control. Values are means ± standard error from three independent measurements. Different letters indicate significant differences according to Tukey’s test (p < 0.05).
Figure 4. Relative expression levels of TPS (A,B) and TPP (C) genes under long-term stable high-humidity stress. TPS—Trehalose-6-phosphate synthase; TPP—Trehalose-6-phosphate phosphatase. Expression levels were measured via quantitative real-time PCR, with 18S RNA as the internal control. Values are means ± standard error from three independent measurements. Different letters indicate significant differences according to Tukey’s test (p < 0.05).
Agronomy 14 02958 g004
Figure 5. Relative expression levels of trehalose-metabolism-related enzyme genes under 24 h emergency stress. TRE1 (AF)—soluble trehalase; TRE2 (G,H)—membrane-bound trehalase; TPS (I,J)—Trehalose-6-phosphate synthase; TPP (K)—Trehalose-6-phosphate phosphatase. Expression levels were measured via quantitative real-time PCR, with 18S RNA as the internal control. Values are means ± standard error from three independent measurements. Different letters indicate significant differences according to Tukey’s test (p < 0.05).
Figure 5. Relative expression levels of trehalose-metabolism-related enzyme genes under 24 h emergency stress. TRE1 (AF)—soluble trehalase; TRE2 (G,H)—membrane-bound trehalase; TPS (I,J)—Trehalose-6-phosphate synthase; TPP (K)—Trehalose-6-phosphate phosphatase. Expression levels were measured via quantitative real-time PCR, with 18S RNA as the internal control. Values are means ± standard error from three independent measurements. Different letters indicate significant differences according to Tukey’s test (p < 0.05).
Agronomy 14 02958 g005
Table 1. Primers used for real-time fluorescent quantitative PCR (qRT-PCR).
Table 1. Primers used for real-time fluorescent quantitative PCR (qRT-PCR).
Gene IDForward Primer (5′-3′)Reverse Primer (5′-3′)Notes
AB627775.1GATCATTGCCCCACCAGAACTTTACGGTGGACAATGCCTGActin
PB.1523.1GTGACATGAAGGACACGGCTTCAGGTAGTACACCCGTCCATRE1-1
PB.5448.1GGTCCTTACCATTCACCGCATCACGTTTGAAGTTTGGACTGCTRE1-2
PB.11546.1TGGCGTATCAACTCTGGTGGCGTCTTTGTTGCCTGTGCTGTRE1-3
PB.13951.1AGGTGGTCGATTCCGTGAAGTGCTGATTACCCCTTTTGCTGTTRE1-4
PB.14734.1TGAAGACATACCAACTACTTTGAGCATATGTACTGAAGTGGGGGCCATRE1-5
PB.25140.1GGGACAAACCAAATGCGTGGTGTGAGCAATGTTTGACGCCTRE1-6
PB.530.1TGCCGCCTGATTTTGTTGAGCCTTGCGGGCCAATCTTTTCTRE2-1
PB.885.1GTGAACAGTGGGACTACCCGGCCCAGTTATCGCCTGAGTTTRE2-2
PB.133.1ACAGGCTTCCGTTCGTTCTCAGTGACTAACCCACCAGCACTPS-1
PB.367.1GCGCCCCTCATCGTAGTATCGACCACCCGCACTTTGTTTCTPS-2
PB.29534.1TATCCACAGCACAGCGTCTCACAGGAGGTTTGGCCTCAATTPP
Table 2. Differentially expressed enzyme genes related to trehalose metabolism.
Table 2. Differentially expressed enzyme genes related to trehalose metabolism.
GeneRH60/RH75RH60/RH90RH75/RH90
log2Foldp-Valuelog2Foldp-Valuelog2Foldp-Value
TRE1-10.387830.033010.11860.451190−0.257980.114360
TRE1-2−0.549570.01578−1.50480.000158−0.949600.030701
TRE1-3−0.102500.39999−0.33950.004930−0.224910.089015
TRE1-40.076760.694140.66370.0002720.598250.001318
TRE1-51.156100.067381.48330.0249380.338810.549570
TRE1-6−0.136100.644960.62560.0832700.769890.042673
TRE2-20.124840.33977−0.24440.066887−0.356370.000320
TRE2-2 −0.230490.24753−1.49921.06 × 10−10−1.256202.48 × 10−11
TPS10.199870.02205−0.34345.97 × 10−5−0.531391.80 × 10−17
TPS20.162730.19375−0.83501.36 × 10−9−0.985397.99 × 10−11
TPP−1.540800.209911.39380.1120102.952400.007052
Note: the bolded parts indicate genes that are significantly differentially expressed in the given comparison, i.e., with a p-value < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ma, W.; Si, H.; Wan, S.; Zhan, Q.; He, Y.; Zhou, W.; Wen, W.; Xie, Y.; Tan, X.; Sun, S.; et al. The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae). Agronomy 2024, 14, 2958. https://doi.org/10.3390/agronomy14122958

AMA Style

Ma W, Si H, Wan S, Zhan Q, He Y, Zhou W, Wen W, Xie Y, Tan X, Sun S, et al. The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae). Agronomy. 2024; 14(12):2958. https://doi.org/10.3390/agronomy14122958

Chicago/Turabian Style

Ma, Wu, Huiru Si, Sijing Wan, Qinwen Zhan, Yanlan He, Wenjing Zhou, Weiwei Wen, Yuhang Xie, Xiaoling Tan, Sisi Sun, and et al. 2024. "The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae)" Agronomy 14, no. 12: 2958. https://doi.org/10.3390/agronomy14122958

APA Style

Ma, W., Si, H., Wan, S., Zhan, Q., He, Y., Zhou, W., Wen, W., Xie, Y., Tan, X., Sun, S., & Tang, B. (2024). The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae). Agronomy, 14(12), 2958. https://doi.org/10.3390/agronomy14122958

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop