The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Materials and Grouping
2.2. Survival Rates, Development, and Reproductive Detection of M. crassicauda
2.3. Determination of Carbohydrate Content and Trehalose Enzyme Activity in M. crassicauda
2.4. Total RNA Extraction and Real-Time Fluorescence Quantitative PCR (qRT-PCR)
2.5. Statistical Analysis
3. Results
3.1. Transcriptome Expression Analysis of Differential Enzyme Genes Related to Trehalose Metabolism
3.2. Statistical Analysis of Survival Rate, Developmental Duration, and Reproductive Capacity of M. crassicauda
3.3. Changes in Carbohydrate Content and Two Seaweed Enzyme Activities of M. crassicauda Under Different Humidity Stress Conditions
3.4. Response of TRE Gene Expression in M. crassicauda Under Long-Term Stable High-Humidity Stress Conditions
3.5. Response of TPS and TPP Gene Expression in M. crassicauda Under Long-Term Stable High-Humidity Stress Conditions
3.6. Response of Trehalose-Metabolizing Enzyme Gene Expression in M. crassicauda Under 24 H Emergency Stress Conditions
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Roos, J.; Hopkins, R.; Kvarnheden, A.; Dixelius, C. The impact of global warming on plant diseases and insect vectors in Sweden. Eur. J. Plant Pathol. 2010, 129, 9–19. [Google Scholar] [CrossRef]
- Newman, J.A. Climate change and the fate of cereal aphids in Southern Britain. Glob. Chang. Biol. 2005, 11, 940–944. [Google Scholar] [CrossRef]
- Kellermann, V.; van Heerwaarden, B. Terrestrial insects and climate change: Adaptive responses in key traits. Physiol. Entomol. 2019, 44, 99–115. [Google Scholar] [CrossRef]
- Skendžić, S.; Zovko, M.; Zivković, I.P.; Vinko, L.; Darija, L. The impact of climate change on agricultural insect pests. Insects 2021, 12, 440. [Google Scholar] [CrossRef] [PubMed]
- Huberty, A.F.; Denno, R.F. Plant water stress and its consequences for herbivorous insects: A new synthesis. Ecology 2004, 85, 1383–1398. [Google Scholar] [CrossRef]
- Kühsel, S.; Brückner, A.; Schmelzle, S.; Heethoff, M.; Blüthgen, N. Surface area-volume ratios in insects. Insect Sci. 2017, 24, 829–841. [Google Scholar] [CrossRef]
- O’Donnell, M.J. A perspective on insect water balance. J. Exp. Biol. 2022, 225, jeb242358. [Google Scholar] [CrossRef]
- Shukla, E.; Thorat, L.J.; Nath, B.B.; Gaikwad, S.M. Insect trehalase: Physiological significance andpotential applications. Glycobiology 2015, 25, 357–367. [Google Scholar] [CrossRef]
- Herren, P.; Hesketh, H.; Meyling, N.V.; Dunn, A.M. Environment-host-parasite interactions in mass-reared insects. Trends Parasitol. 2023, 39, 588–602. [Google Scholar] [CrossRef]
- Simmons, L.W.; Lovegrove, M.; Du, X.B.; Ren, Y.; Thomas, M.L. Humidity stress and its consequences for male pre- and post-copulatory fitness traits in an insect. Ecol. Evol. 2023, 13, e10244. [Google Scholar] [CrossRef]
- Diyes, C.P.; Dergousoff, S.J.; Yunik, M.E.; Chilton, N.B. Reproductive output and larval survival of American dog ticks from a population at the northern distributional limit. Exp. Appl. Acarol. 2021, 83, 257–270. [Google Scholar] [CrossRef]
- Giri, G.; Nagloo, N.; Enjin, A. A dynamic humidity arena to explore humidity-related behaviours in insects. J. Exp. Biol. 2024, 227, jeb247195. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.H.; Hu, J.R.; Zhang, Y.J. The effects of temperature and humidity on a field population of Bradysia odoriphaga (Diptera: Sciaridae). J. Econ. Entomol. 2020, 113, 1927–1932. [Google Scholar] [CrossRef] [PubMed]
- Abou-Shaara, H.F.; Owayss, A.A.; Ibrahim, Y.Y.; Basuny, N.K. A review of impacts of temperature and relative humidity on various activities of honey bees. Insectes Sociaux 2017, 64, 455–463. [Google Scholar] [CrossRef]
- Laursen, W.J.; Budelli, G.; Tang, R.; Chang, E.C.; Busby, R.; Shankar, S.; Garrity, P.A. Humidity sensors that alert mosquitoes to nearby hosts and egg-laying sites. Neuron 2023, 111, 874–887.e8. [Google Scholar] [CrossRef] [PubMed]
- Salzman, S.; Dahake, A.; Kandalaft, W.; Valencia-Montoya, W.A.; Calonje, M.; Specht, C.D.; Raguso, R.A. Cone humidity is a strong attractant in an obligate cycad pollination system. Curr. Biol. 2023, 33, 1654–1664.e4. [Google Scholar] [CrossRef]
- Okal, M.N.; Francis, B.; Herrera-Varela, M.; Fillinger, U.; Lindsay, S.W. Water vapour is a pre-oviposition attractant for the malaria vector Anopheles gambiae sensu stricto. Malar. J. 2013, 12, 365. [Google Scholar] [CrossRef]
- Arx, M.V.; Goyret, J.; Davidowitz, G.; Raguso, R.A. Floral humidity as a reliable sensory cue for profitability assessment by nectar-foraging hawkmoths. Proc. Natl. Acad. Sci. USA 2012, 109, 947. [Google Scholar]
- Vackova, T.; Pekar, S.; Klimov, P.B.; Hubert, J. Population growth and respiration in the dust mite Dermatophagoides farinae under different temperature and humidity regimes. Exp. Appl. Acarol. 2023, 89, 157–169. [Google Scholar] [CrossRef]
- Tang, B.; Xu, Q.Y.; Zhao, L.N.; Wang, S.G.; Zhang, F. Progress in research on the characteristics and functions of trehalose and the TPS gene in insects. Chin. J. Appl. Entomol. 2014, 51, 1397–1405. [Google Scholar]
- Cornette, R.; Kanamori, Y.; Watanabe, M.; Nakahara, Y.; Gusev, O.; Mitsumasu, K.; Kadono-Okuda, K.; Shimomura, M.; Mita, K.; Kikawada, T.; et al. Identification of anhydrobiosis-related genes from an expressed sequence tag database in the cryptobiotic midge Polypedilum vanderplanki (Diptera: Chironomidae). J. Biol. Chem. 2010, 358, 89–99. [Google Scholar] [CrossRef] [PubMed]
- Tellis, M.B.; Kotkar, H.M.; Joshi, R.S. Regulation of trehalose metabolism in insects: From genes to the metabolite window. Glycobiology 2023, 33, 262–273. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Tian, Y.; Zhang, H.; Liu, S. Molecular-level insight into the effects of low moisture and trehalose on the thermostability of β-glucosidase. Food Chem. 2024, 460 Pt 2, 140607. [Google Scholar] [CrossRef] [PubMed]
- Toxopeus, J.; Sinclair, B.J. Mechanisms underlying insect freeze tolerance. Biol. Rev. Camb. Philos. Soc. 2018, 93, 1891–1914. [Google Scholar] [CrossRef]
- Becker, A.; Schlöder, P.; Steele, J.E.; Wegener, G. The regulation of trehalose metabolism in insects. Experientia 1996, 52, 433–439. [Google Scholar] [CrossRef]
- Leyria, J.E.; Mawed, H.; Orchard, I.; Lange, A.B. Regulation of a trehalose–Specific facilitated transporter (Tret) by insulin and adipokinetic hormone in Rhodnius prolixus, a vector of chagas disease. Front. Physiol. 2021, 12, 624165. [Google Scholar] [CrossRef]
- Ohta, N.; Mori, N.; Kuwahara, Y.; Nishida, R. A hemiterpene glucoside as a probing deterrent of the bean aphid, Megoura crassicauda, from a non-host vetch, Vicia hirsuta. Phytochemistry 2006, 67, 584–588. [Google Scholar] [CrossRef]
- Rusin, M.; Gospodarek, J.; Nadgórska-Socha, A.; Barczyk, G. Effect of petroleum-derived substances on life history traits of black bean aphid (Aphis fabae Scop.) and on the growth and chemical composition of broad bean. Ecotoxicology 2017, 26, 308–319. [Google Scholar] [CrossRef]
- Ragsdale, D.W.; Mccornack, B.P.; Venette, R.C.; Potter, B.D.; MacRae, I.V.; Hodgson, E.W.; Cullen, E.M. Economic threshold for soybean aphid (Hemiptera:Aphididae). J. Econ. Entomol. 2007, 100, 1258–1267. [Google Scholar] [CrossRef]
- Wang, X.Z.; Wan, S.J.; He, B.E.; Wang, S.L.; Wang, T.W.; Yu, L.H.; Wang, S.G.; Wang, H.Z.; Tang, B.; Lu, J.J. Physalis floridana suppresses the expression of trehalase gene HvTREs in Henosepilachna vigintioctopunctata (Coleoptera: Coccinellidae) for defense against herbivorous insects. J. Pest Sci. 2024. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Li, B.; Gao, L.; Wang, J.; Yan, Z. Humidity response in Drosophila olfactory sensory neurons requires the mechanosensitive channel TMEM63. Nat. Commun. 2022, 13, 3814. [Google Scholar] [CrossRef] [PubMed]
- Fisher, J.J.; Rijal, J.P.; Zalom, F.G. Temperature and Humidity Interact to Influence Brown Marmorated Stink Bug (Hemiptera: Pentatomidae), Survival. Environ. Entomol. 2021, 50, 390–398. [Google Scholar] [CrossRef] [PubMed]
- Mermer, S.; Maslen, E.A.; Dalton, D.T.; Nielsen, A.L.; Rucker, A.; Lowenstein, D.; Wiman, N.; Bhattarai, M.; Soohoo-Hui, A.; Harris, E.T.; et al. Temperature-Dependent Life Table Parameters of Brown Marmorated Stink Bug, Halyomorpha halys (Stål) (Hemiptera: Pentatomidae) in the United States. Insects 2023, 14, 248. [Google Scholar] [CrossRef] [PubMed]
- Baur, J.; Jagusch, D.; Michalak, P.; Koppik, M.; Berger, D. The mating system affects the temperature sensitivity of male and female fertility. Funct. Ecol. 2022, 36, 92–106. [Google Scholar] [CrossRef]
- Wang, S.S.; Li, Q.M.; Li, Y.; Wan, S.; Yin, Z.; Zhao, S.; Dai, X.; Wang, R.; Wang, S.; Zhai, Y.; et al. Stress Response of Aphid Population Under Combined Stress of Cadmium and Lead and Its Effects on Development of Harmonia axyridis. Int. J. Mol. Sci. 2024, 25, 11145. [Google Scholar] [CrossRef]
- Baumgart, L.; Wittke, M.; Morsbach, S.; Abou, B.; Menzel, F. Why do ants differ in acclimatory ability biophysical mechanisms behind cuticular hydrocarbon acclimation across species. J. Exp. Biol. 2022, 225, 196–199. [Google Scholar] [CrossRef]
- Thorat, L.J.; Gaikwad, S.M.; Nath, B.B. Trehalose as an indicator of desiccation stress in Drosophila melanogaster larvae: A potential marker of anhydrobiosis. Biochem. Biophys. Res. Commun. 2012, 419, 638–642. [Google Scholar] [CrossRef]
- Steele, J.E. Evidence that ecdysis in the larval cockroach, Periplaneta americana L. is triggered by an increase in the concentration of hemolymph sugar. Arch. Insect Biochem. Physiol. 2016, 92, 159–172. [Google Scholar] [CrossRef]
- Wang, X.P.; Huang, Z.; Li, Y.L.; Jin, K.Y.; Dong, D.J.; Wang, J.X.; Zhao, X.F. Krüppel-like factor 15 integrated autophagy and gluconeogenesis to maintain glucose homeostasis under 20-hydroxyecdysone regulation. PLoS Genet. 2022, 18, e1010229. [Google Scholar] [CrossRef]
- Chen, Z.T.; Chen, Q.L.; Zhang, R.Z.; Li, D.F.; Wang, F. Bx-daf-2 and Bx-tre-1 synergistically regulate trehalose to promote low-temperature stress resistance in Bursaphelenchus xylophilus. J. Hunan Agric. Univ. (Nat. Sci. Ed.) 2020, 46, 21–27. [Google Scholar]
- Yao, Q.; Liang, Z.T.; Duan, S.G.; Dong, Y.Z.; Xu, S.; Li, W.J. Cloning and Bioinformatics Analysis of Trehalase Genes in Conopomorpha sinensis Bradley. Guangdong Agric. Sci. 2024, 51, 13–21. [Google Scholar]
- Perez, R.; Aron, S. Protective role of trehalose in the Namib desert ant, Ocymyrmex robustior. J. Exp. Biol. 2023, 226, jeb245149. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.Y.; Wei, Y.; Chen, X.M.; Ding, Y.J.; Hu, Y.W.; Tang, B.; Wang, S.G. Effects of heavy metal cadmium on the trehalose metabolism in Aedes albopictus (Diptera: Culicidae) larvae. J. Entomol. 2019, 62, 11. [Google Scholar]
- Tang, B.; Wei, P.; Chen, J.; Wang, S.; Zhang, W. Progress in gene features and functions of insect trehalases. Acta Entomol. Sin. 2012, 55, 1315–1321. [Google Scholar]
- Li, Y.; Chen, X.; Wang, S.S.; Pan, B.Y.; Wang, S.G.; Wang, S.; Tang, B. Evaluation of the Expression and Function of the TRE2-like and TRE2 Genes in Ecdysis of Harmonia axyridis. Front. Physiol. 2019, 10, 1371. [Google Scholar] [CrossRef]
- Zhang, J.; Qi, L.; Chen, B.; Li, H.; Hu, L.; Wang, Q.; Wang, S.; Xi, J. Trehalose-6-Phosphate Synthase Contributes to Rapid Cold Hardening in the Invasive Insect Lissorhoptrus oryzophilus (Coleoptera: Curculionidae) by Regulating Trehalose Metabolism. Insects 2023, 14, 903. [Google Scholar] [CrossRef]
- Chen, Q.; Ma, E.; Behar, K.L.; Xu, T.; Haddad, G.G. Role of trehalose phosphate synthase in anoxia tolerance and development in Drosophila melanogaster. J. Biol. Chem. 2002, 277, 3274–3279. [Google Scholar] [CrossRef]
- Kaplan, F.; Kopka, J.; Haskell, D.W.; Zhao, W.; Schiller, K.C.; Gatzke, N.; Sung, D.Y.; Guy, C.L. Exploring the temperature-stress metabolome of Arabidopsis. Plant Physiol. 2004, 136, 4159–4168. [Google Scholar] [CrossRef]
- Rodrigues, Y.K.; Beldade, P. Thermal plasticity in insects’ response to climate change and to multifactorial environments. Front. Ecol. Evol. 2020, 8, 271. [Google Scholar] [CrossRef]
Gene ID | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Notes |
---|---|---|---|
AB627775.1 | GATCATTGCCCCACCAGAAC | TTTACGGTGGACAATGCCTG | Actin |
PB.1523.1 | GTGACATGAAGGACACGGCT | TCAGGTAGTACACCCGTCCA | TRE1-1 |
PB.5448.1 | GGTCCTTACCATTCACCGCA | TCACGTTTGAAGTTTGGACTGC | TRE1-2 |
PB.11546.1 | TGGCGTATCAACTCTGGTGG | CGTCTTTGTTGCCTGTGCTG | TRE1-3 |
PB.13951.1 | AGGTGGTCGATTCCGTGAAG | TGCTGATTACCCCTTTTGCTGT | TRE1-4 |
PB.14734.1 | TGAAGACATACCAACTACTTTGAGC | ATATGTACTGAAGTGGGGGCCA | TRE1-5 |
PB.25140.1 | GGGACAAACCAAATGCGTGG | TGTGAGCAATGTTTGACGCC | TRE1-6 |
PB.530.1 | TGCCGCCTGATTTTGTTGAG | CCTTGCGGGCCAATCTTTTC | TRE2-1 |
PB.885.1 | GTGAACAGTGGGACTACCCG | GCCCAGTTATCGCCTGAGTT | TRE2-2 |
PB.133.1 | ACAGGCTTCCGTTCGTTCTC | AGTGACTAACCCACCAGCAC | TPS-1 |
PB.367.1 | GCGCCCCTCATCGTAGTATC | GACCACCCGCACTTTGTTTC | TPS-2 |
PB.29534.1 | TATCCACAGCACAGCGTCTC | ACAGGAGGTTTGGCCTCAAT | TPP |
Gene | RH60/RH75 | RH60/RH90 | RH75/RH90 | |||
---|---|---|---|---|---|---|
log2Fold | p-Value | log2Fold | p-Value | log2Fold | p-Value | |
TRE1-1 | 0.38783 | 0.03301 | 0.1186 | 0.451190 | −0.25798 | 0.114360 |
TRE1-2 | −0.54957 | 0.01578 | −1.5048 | 0.000158 | −0.94960 | 0.030701 |
TRE1-3 | −0.10250 | 0.39999 | −0.3395 | 0.004930 | −0.22491 | 0.089015 |
TRE1-4 | 0.07676 | 0.69414 | 0.6637 | 0.000272 | 0.59825 | 0.001318 |
TRE1-5 | 1.15610 | 0.06738 | 1.4833 | 0.024938 | 0.33881 | 0.549570 |
TRE1-6 | −0.13610 | 0.64496 | 0.6256 | 0.083270 | 0.76989 | 0.042673 |
TRE2-2 | 0.12484 | 0.33977 | −0.2444 | 0.066887 | −0.35637 | 0.000320 |
TRE2-2 | −0.23049 | 0.24753 | −1.4992 | 1.06 × 10−10 | −1.25620 | 2.48 × 10−11 |
TPS1 | 0.19987 | 0.02205 | −0.3434 | 5.97 × 10−5 | −0.53139 | 1.80 × 10−17 |
TPS2 | 0.16273 | 0.19375 | −0.8350 | 1.36 × 10−9 | −0.98539 | 7.99 × 10−11 |
TPP | −1.54080 | 0.20991 | 1.3938 | 0.112010 | 2.95240 | 0.007052 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, W.; Si, H.; Wan, S.; Zhan, Q.; He, Y.; Zhou, W.; Wen, W.; Xie, Y.; Tan, X.; Sun, S.; et al. The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae). Agronomy 2024, 14, 2958. https://doi.org/10.3390/agronomy14122958
Ma W, Si H, Wan S, Zhan Q, He Y, Zhou W, Wen W, Xie Y, Tan X, Sun S, et al. The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae). Agronomy. 2024; 14(12):2958. https://doi.org/10.3390/agronomy14122958
Chicago/Turabian StyleMa, Wu, Huiru Si, Sijing Wan, Qinwen Zhan, Yanlan He, Wenjing Zhou, Weiwei Wen, Yuhang Xie, Xiaoling Tan, Sisi Sun, and et al. 2024. "The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae)" Agronomy 14, no. 12: 2958. https://doi.org/10.3390/agronomy14122958
APA StyleMa, W., Si, H., Wan, S., Zhan, Q., He, Y., Zhou, W., Wen, W., Xie, Y., Tan, X., Sun, S., & Tang, B. (2024). The Participation of Trehalose Metabolism in Response to High-Humidity Stress in Megoura crassicauda (Hemiptera: Aphididae). Agronomy, 14(12), 2958. https://doi.org/10.3390/agronomy14122958