Development of Retrotransposon-Based Molecular Markers for Characterization of Persea americana (Avocado) Cultivars and Horticultural Races
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Samples and DNA Purification
2.2. The iPBS Analysis
2.3. Cloning and Sequencing of iPBS Fragments
2.4. Identification of Potential LTRs and IRAP Analysis
2.5. Phylogenetic Inferences
3. Results
3.1. Generation of P. americana gDNA Collection
3.2. iPBS Implementation in P. americana
3.3. Potential LTR Identification
3.4. IRAP Implementation in P. americana
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- The Angiosperm Phylogeny Group; Chase, M.W.; Christenhusz, M.J.M.; Fay, M.F.; Byng, J.W.; Judd, W.S.; Soltis, D.E.; Mabberley, D.J.; Sennikov, A.N.; Soltis, P.S.; et al. An Update of the Angiosperm Phylogeny Group Classification for the Orders and Families of Flowering Plants: APG IV. Bot. J. Linn. Soc. 2016, 181, 1–20. [Google Scholar] [CrossRef]
- Lahav, E.; Lavi, U. Avocado Genetics and Breeding. In Breeding Plantation Tree Crops: Tropical Species; Jain, S.M., Priyadarshan, P.M., Eds.; Springer: New York, NY, USA, 2009; pp. 247–285. ISBN 978-0-387-71199-7. [Google Scholar]
- Schaffer, B.A.; Wolstenholme, B.N.; Whiley, A.W. The Avocado: Botany, Production and Uses; CAB International: London, UK, 2013. [Google Scholar]
- Bergh, B.; Ellstrand, N. Taxonomy of the Avocado. Calif. Avocado Soc. 1986, 70, 135–146. [Google Scholar]
- Sommaruga, R.; Eldridge, H.M. Avocado Production: Water Footprint and Socio-Economic Implications. EuroChoices 2021, 20, 48–53. [Google Scholar] [CrossRef]
- Fulgoni, V.L.; Dreher, M.; Davenport, A.J. Avocado Consumption Is Associated with Better Diet Quality and Nutrient Intake, and Lower Metabolic Syndrome Risk in US Adults: Results from the National Health and Nutrition Examination Survey (NHANES) 2001–2008. Nutr. J. 2013, 12, 1. [Google Scholar] [CrossRef]
- Araújo, R.G.; Rodriguez-Jasso, R.M.; Ruiz, H.A.; Pintado, M.M.E.; Aguilar, C.N. Avocado By-Products: Nutritional and Functional Properties. Trends Food Sci. Technol. 2018, 80, 51–60. [Google Scholar] [CrossRef]
- Akan, S. Phytochemicals in Avocado Peel and Their Potential Uses. Food Health 2021, 7, 138–149. [Google Scholar] [CrossRef]
- Adeyemi, O.O.; Okpo, S.O.; Ogunti, O.O. Analgesic and Anti-Inflammatory Effects of the Aqueous Extract of Leaves of Persea americana Mill (Lauraceae). Fitoterapia 2002, 73, 375–380. [Google Scholar] [CrossRef]
- Moreno-Ortega, G.; Pliego, C.; Sarmiento, D.; Barceló, A.; Martínez-Ferri, E. Yield and Fruit Quality of Avocado Trees under Different Regimes of Water Supply in the Subtropical Coast of Spain. Agric. Water Manag. 2019, 221, 192–201. [Google Scholar] [CrossRef]
- Sauco, G. Avocado Culture in the Canary Islands. Calif. Avocado Soc. 1985, 69, 73–80. [Google Scholar]
- Alonso Gonzalez, J. Los Cultivos Agrícolas en Canarias: Los Cambios y sus Causas; Repositorio Institutional Universidad de La Laguna (RIULL): Canary Islands, Spain, 2020. [Google Scholar]
- Instituto Canario de Estadística (ISTAC). Gobierno de Canarias Estadísticas de La Comunidad Autónoma de Canarias. Series Anuales de Agricultura. Municipios, Islas y Provincias de Canarias. 1999–2020. Available online: http://www.gobiernodecanarias.org/istac/jaxi-istac/tabla.do (accessed on 18 November 2021).
- Hernandez-Moreno, J.; Tejedor, M.; Jiménez, C. Effects of Land Use on Soil Degradation and Restoration in the Canary Islands. In Soils of Volcanic Regions in Europe; Springer Nature: Berlin/Heidelberg, Germany, 2007; pp. 565–579. [Google Scholar] [CrossRef]
- Celis, N.; Suarez, D.L.; Wu, L.; Li, R.; Arpaia, M.L.; Mauk, P. Salt Tolerance and Growth of 13 Avocado Rootstocks Related Best to Chloride Uptake. HortScience 2018, 53, 1737–1745. [Google Scholar] [CrossRef]
- Acosta-Rangel, A.M.; Li, R.; Celis, N.; Suarez, D.L.; Santiago, L.S.; Arpaia, M.L.; Mauk, P.A. The Physiological Response of ‘Hass’ Avocado to Salinity as Influenced by Rootstock. Sci. Hortic. 2019, 256, 108629. [Google Scholar] [CrossRef]
- Llobet, G.; Zárate, P. Evaluación en campo de patrones clonales de aguacate de raza mexicana y antillana tolerante-resistentes a Phytophthora cinnamomi Rands. In Proceedings of the V World Avocado Congress, Málaga, Spain, 19–24 October 2003; pp. 573–578. [Google Scholar]
- Boletín Oficial de Canarias Num. 125; Orden de 18 de Junio de 2012, Por la que se aprueban las normas técnicas específicas de producción integrada del Aguacate, Mango, Papaya y Piña Tropical en Canarias; Gobierno de Canarias: Canarias, Spain, 2012; pp. 12044–12088.
- Davis, J.; Henderson, D.; Kobayashi, M.; Clegg, M.T.; Clegg, M.T. Genealogical Relationships among Cultivated Avocado as Revealed through RFLP Analyses. J. Hered. 1998, 89, 319–323. [Google Scholar] [CrossRef]
- Furnier, G.R.; Cummings, M.P.; Clegg, M.T. Evolution of the Avocados as Revealed by DNA Restriction Fragment Variation. J. Hered. 1990, 81, 183–188. [Google Scholar] [CrossRef]
- Cañas-Gutiérrez, G.P.; Galindo-López, L.F.; Arango-Isaza, R.; Saldamando-Benjumea, C.I. Diversidad Genética de Cultivares de Aguacate (Persea americana) En Antioquia, Colombia. Agron. Mesoam. 2015, 26, 129–143. [Google Scholar] [CrossRef][Green Version]
- Farrow, B.J.; Fourie, G.; Van den Berg, N. DNA Profiling of Persea americana Using AFLP Markers. S. Afr. J. Bot. 2010, 76, 410. [Google Scholar] [CrossRef]
- Taah, K.J.; Alderson, P.G.; Power, J.B. Molecular Approaches for the Characterization of Ghanaian Avocado Pear (Persea americana Mill.) Germplasm. In Proceedings of the V World Avocado Congress (Actas V Congreso Mundial del Aguacate), Málaga, Spain, 19–24 October 2003; pp. 19–24. [Google Scholar]
- Douhan, G.W.; Fuller, E.; McKee, B.; Pond, E. Genetic Diversity Analysis of Avocado (Persea americana Miller) Rootstocks Selected under Greenhouse Conditions for Tolerance to Phytophthora Root Rot Caused by Phytophthora cinnamomi. Euphytica 2011, 182, 209. [Google Scholar] [CrossRef]
- Fiedler, J.; Bufler, G.; Bangerth, F. Genetic Relationships of Avocado (Persea americana Mill.) Using RAPD Markers. Euphytica 1998, 101, 249–255. [Google Scholar] [CrossRef]
- Cuiris-Pérez, H.; Guillén-Andrade, H.; Pedraza-Santos, M.E.; López-Medina, J.; Vidales-Fernández, I. Genetic Variability within Mexican Race Avocado (Persea americana Mill.) Germplasm Collections Determined by ISSRs. Rev. Chapingo Ser. Hortic. 2009, 15, 169–175. [Google Scholar] [CrossRef]
- Borrone, J.W.; Olano, C.T.; Kuhn, D.N.; Brown, J.S.; Schnell, R.J.; Violi, H.A. Outcrossing in Florida Avocados as Measured Using Microsatellite Markers. J. Am. Soc. Hortic. Sci. 2008, 133, 255–261. [Google Scholar] [CrossRef]
- Acheampong, A.K.; Akromah, R.; Ofori, F.A.; Takrama, J.F.; Saada, D.; Bitton, I.; Lavi, U. Genetic Characterization of Ghanaian Avocados Using Microsatellite Markers. J. Am. Soc. Hortic. Sci. 2008, 133, 801–809. [Google Scholar]
- Canas-Gutierrez, G.P.; Arango-Isaza, R.E.; Saldamando-Benjumea, C.I. Microsatellites Revealed Genetic Diversity and Population Structure in Colombian Avocado (Persea americana Mill.) Germplasm Collection and Its Natural Populations. JPBCS 2019, 11, 106–119. [Google Scholar] [CrossRef]
- Schnell, R.J.; Brown, J.S.; Olano, C.T.; Power, E.J.; Krol, C.A.; Kuhn, D.N.; Motamayor, J.C. Evaluation of Avocado Germplasm Using Microsatellite Markers. J. Am. Soc. Hortic. Sci. 2003, 128, 881–889. [Google Scholar] [CrossRef]
- Borrone, J.W.; Schnell, R.J.; Violi, H.A.; Ploetz, R.C. Primer note: Seventy Microsatellite Markers from Persea americana Miller (Avocado) Expressed Sequence Tags: PRIMER NOTE. Mol. Ecol. Notes 2006, 7, 439–444. [Google Scholar] [CrossRef]
- Ashworth, V.E.T.M.; Kobayashi, M.C.; De La Cruz, M.; Clegg, M.T. Microsatellite Markers in Avocado (Persea americana Mill.): Development of Dinucleotide and Trinucleotide Markers. Sci. Hortic. 2004, 101, 255–267. [Google Scholar] [CrossRef]
- Gross-German, E.; Viruel, M.A. Molecular Characterization of Avocado Germplasm with a New Set of SSR and EST-SSR Markers: Genetic Diversity, Population Structure, and Identification of Race-Specific Markers in a Group of Cultivated Genotypes. Tree Genet. Genomes 2013, 9, 539–555. [Google Scholar] [CrossRef]
- Boza, E.J.; Tondo, C.L.; Ledesma, N.; Campbell, R.J.; Bost, J.; Schnell, R.J.; Gutiérrez, O.A. Genetic Differentiation, Races and Interracial Admixture in Avocado (Persea americana Mill.), and Persea spp. Evaluated Using SSR Markers. Genet. Resour. Crop Evol. 2018, 65, 1195–1215. [Google Scholar] [CrossRef]
- Chen, H.; Morrell, P.L.; Ashworth, V.E.T.M.; de la Cruz, M.; Clegg, M.T. Tracing the Geographic Origins of Major Avocado Cultivars. J. Hered. 2008, 100, 56–65. [Google Scholar] [CrossRef]
- Ge, Y.; Zhang, T.; Wu, B.; Tan, L.; Ma, F.; Zou, M.; Chen, H.; Pei, J.; Liu, Y.; Chen, Z.; et al. Genome-Wide Assessment of Avocado Germplasm Determined from Specific Length Amplified Fragment Sequencing and Transcriptomes: Population Structure, Genetic Diversity, Identification, and Application of Race-Specific Markers. Genes 2019, 10, 215. [Google Scholar] [CrossRef]
- Rubinstein, M.; Eshed, R.; Rozen, A.; Zviran, T.; Kuhn, D.N.; Irihimovitch, V.; Sherman, A.; Ophir, R. Genetic Diversity of Avocado (Persea americana Mill.) Germplasm Using Pooled Sequencing. BMC Genom. 2019, 20, 379. [Google Scholar] [CrossRef]
- Kämper, W.; Trueman, S.J.; Cooke, J.; Kasinadhuni, N.; Brunton, A.J.; Ogbourne, S.M. Single-Nucleotide Polymorphisms That Uniquely Identify Cultivars of Avocado (Persea americana). Appl. Plant Sci. 2021, 9, e11440. [Google Scholar] [CrossRef]
- Kuhn, D.N.; Livingstone, D.S.; Richards, J.H.; Manosalva, P.; Van den Berg, N.; Chambers, A.H. Application of Genomic Tools to Avocado (Persea americana) Breeding: SNP Discovery for Genotyping and Germplasm Characterization. Sci. Hortic. 2019, 246, 1–11. [Google Scholar] [CrossRef]
- Talavera, A.; Soorni, A.; Bombarely, A.; Matas, A.J.; Hormaza, J.I. Genome-Wide SNP Discovery and Genomic Characterization in Avocado (Persea americana Mill.). Sci. Rep. 2019, 9, 20137. [Google Scholar] [CrossRef] [PubMed]
- Schulman, A.H.; Flavell, A.J.; Ellis, T.H.N. The Application of LTR Retrotransposons as Molecular Markers in Plants. In Mobile Genetic Elements: Protocols and Genomic Applications; Methods in Molecular Biology; Miller, W.J., Capy, P., Eds.; Humana Press: Totowa, NJ, USA, 2004; pp. 145–173. ISBN 978-1-59259-755-0. [Google Scholar]
- Kalendar, R.; Flavell, A.J.; Ellis, T.H.N.; Sjakste, T.; Moisy, C.; Schulman, A.H. Analysis of Plant Diversity with Retrotransposon-Based Molecular Markers. Heredity 2011, 106, 520–530. [Google Scholar] [CrossRef] [PubMed]
- Waugh, R.; McLean, K.; Flavell, A.J.; Pearce, S.R.; Kumar, A.; Thomas, B.B.T.; Powell, W. Genetic Distribution of Bare–1-like Retrotransposable Elements in the Barley Genome Revealed by Sequence-Specific Amplification Polymorphisms (S-SAP). Mol. Gen. Genet. 1997, 253, 687–694. [Google Scholar] [CrossRef]
- Kalendar, R.; Grob, T.; Regina, M.; Suoniemi, A.; Schulman, A. IRAP and REMAP: Two New Retrotransposon-Based DNA Fingerprinting Techniques. Theor. Appl. Genet. 1999, 98, 704–711. [Google Scholar] [CrossRef]
- Kalendar, R.; Muterko, A.; Boronnikova, S. Retrotransposable Elements: DNA Fingerprinting and the Assessment of Genetic Diversity. In Molecular Plant Taxonomy: Methods and Protocols; Methods in Molecular Biology; Besse, P., Ed.; Springer: New York, NY, USA, 2021; pp. 263–286. ISBN 978-1-07-160997-2. [Google Scholar]
- Kalendar, R.; Schulman, A.H. Transposon-Based Tagging: IRAP, REMAP, and IPBS. In Molecular Plant Taxonomy; Springer: Berlin/Heidelberg, Germany, 2014; pp. 233–255. [Google Scholar]
- Kalendar, R.; Schulman, A.H. IRAP and REMAP for Retrotransposon-Based Genotyping and Fingerprinting. Nat. Protoc. 2006, 1, 2478–2484. [Google Scholar] [CrossRef]
- Kalendar, R.; Amenov, A.; Daniyarov, A. Use of Retrotransposon-Derived Genetic Markers to Analyse Genomic Variability in Plants. Funct. Plant Biol. 2019, 46, 15–29. [Google Scholar] [CrossRef]
- Kalendar, R.; Antonius, K.; Smýkal, P.; Schulman, A.H. IPBS: A Universal Method for DNA Fingerprinting and Retrotransposon Isolation. Theor. Appl. Genet. 2010, 121, 1419–1430. [Google Scholar] [CrossRef]
- Galindo-González, L.; Mhiri, C.; Deyholos, M.K.; Grandbastien, M.-A. LTR-Retrotransposons in Plants: Engines of Evolution. Gene 2017, 626, 14–25. [Google Scholar] [CrossRef]
- Seberg, O.; Petersen, G. A Unified Classification System for Eukaryotic Transposable Elements Should Reflect Their Phylogeny. Nat. Rev. Genet. 2009, 10, 276. [Google Scholar] [CrossRef]
- Wicker, T.; Sabot, F.; Hua-Van, A.; Bennetzen, J.L.; Capy, P.; Chalhoub, B.; Flavell, A.; Leroy, P.; Morgante, M.; Panaud, O. A Unified Classification System for Eukaryotic Transposable Elements. Nat. Rev. Genet. 2007, 8, 973–982. [Google Scholar] [CrossRef]
- Griffiths, J.; Catoni, M.; Iwasaki, M.; Paszkowski, J. Sequence-Independent Identification of Active LTR Retrotransposons in Arabidopsis. Mol. Plant 2018, 11, 508–511. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Sneath, P.H.; Sokal, R.R. Unweighted Pair Group Method with Arithmetic Mean. In Numerical Taxonomy; CAB International: Wallingford, UK, 1973; pp. 230–234. [Google Scholar]
- Buquicchio, F.; Spruyt, M. Gene Runner. Available online: www.generunner.net (accessed on 17 May 2019).
- Jacquemoud-Collet, J.-P.; Perrier, X. DARWin: Dissimilarity Analysis and Representation for Windows. Available online: https://darwin.cirad.f (accessed on 17 May 2006).
- Castro-López, C.; Bautista-Hernández, I.; González-Hernández, M.D.; Martínez-Ávila, G.C.G.; Rojas, R.; Gutiérrez-Díez, A.; Medina-Herrera, N.; Aguirre-Arzola, V.E. Polyphenolic Profile and Antioxidant Activity of Leaf Purified Hydroalcoholic Extracts from Seven Mexican Persea americana Cultivars. Molecules 2019, 24, 173. [Google Scholar] [CrossRef]
- Pandey, R.N.; Adams, R.P.; Flournoy, L.E. Inhibition of Random Amplified Polymorphic DNAs (RAPDs) by Plant Polysaccharides. Plant Mol. Biol. Rep. 1996, 14, 17–22. [Google Scholar] [CrossRef]
- Ramírez, I.M.; Rodríguez, N.N.; Valdés-Infante, J.; Capote, M.; Becker, D.; Rohde, W. Isolation of Genomic DNAs from the Tropical Fruit Trees Avocado, Coconut, Guava and Mango for PCR-Based DNA Marker Application. Cultiv. Trop. 2004, 25, 33–38. [Google Scholar]
- Bennetzen, J.L. Transposable Element Contributions to Plant Gene and Genome Evolution. Plant Mol. Biol. 2000, 42, 251–269. [Google Scholar] [CrossRef]
- Lisch, D. How Important Are Transposons for Plant Evolution? Nat. Rev. Genet. 2012, 14, 49–61. [Google Scholar] [CrossRef]
- Schulman, A.H. Retrotransposon Replication in Plants. Curr. Opin. Virol. 2013, 3, 604–614. [Google Scholar] [CrossRef]
- Lanciano, S.; Mirouze, M. Transposable Elements: All Mobile, All Different, Some Stress Responsive, Some Adaptive? Curr. Opin. Genet. Dev. 2018, 49, 106–114. [Google Scholar] [CrossRef]
- Medina, N.N.R.; Lorenzo, J.L.F.; Arbelo, O.C.; Fiallo, V.R.F.; Pérez, I.M.R.; Becker, D.; García, I.R.; Arencibia, C.G.; Martín, X.X.; Gutiérrez, M.I.R. Agro-Morphologic Traits, Isoenzyme and DNA Markers for Estimating the Polymorphism Levels, Discriminating Capacity and Informativeness in Avocado. Rev. CENIC Cienc. Biol. 2009, 40, 63–74. [Google Scholar]
- Baránek, M.; Meszáros, M.; Sochorová, J.; Čechová, J.; Raddová, J. Utility of Retrotransposon-Derived Marker Systems for Differentiation of Presumed Clones of the Apricot Cultivar Velkopavlovická. Sci. Hortic. 2012, 143, 1–6. [Google Scholar] [CrossRef]
- Guo, D.-L.; Guo, M.-X.; Hou, X.-G.; Zhang, G.-H. Molecular Diversity Analysis of Grape Varieties Based on IPBS Markers. Biochem. Syst. Ecol. 2014, 52, 27–32. [Google Scholar] [CrossRef]
- Milovanov, A.; Zvyagin, A.; Daniyarov, A.; Kalendar, R.; Troshin, L. Genetic Analysis of the Grapevine Genotypes of the Russian Vitis Ampelographic Collection Using IPBS Markers. Genetica 2019, 147, 91–101. [Google Scholar] [CrossRef]
- Mehmood, A.; Luo, S.; Ahmad, N.M.; Dong, C.; Mahmood, T.; Sajjad, Y.; Jaskani, M.J.; Sharp, P. Molecular Variability and Phylogenetic Relationships of Guava (Psidium guajava L.) Cultivars Using Inter-Primer Binding Site (IPBS) and Microsatellite (SSR) Markers. Genet. Resour. Crop Evol. 2016, 63, 1345–1361. [Google Scholar] [CrossRef]
- Al-Najm, A.; Luo, S.; Ahmad, N.M.; Trethowan, R. Molecular Variability and Genetic Relationships of Date Palm (Phoenix dactylifera L.) Cultivars Based on Inter-Primer Binding Site (IPBS) Markers. Aust. J. Crop Sci. 2016, 10, 732. [Google Scholar] [CrossRef]
- Yaldiz, G.; Camlica, M.; Nadeem, M.A.; Nawaz, M.A.; Baloch, F.S. Genetic Diversity Assessment in Nicotiana tabacum L. with IPBS-Retrotransposons. Turk. J. Agric. For. 2018, 42, 154–164. [Google Scholar] [CrossRef]
- Demirel, U.; Tındaş, İ.; Yavuz, C.; Baloch, F.S.; Çalışkan, M.E. Assessing Genetic Diversity of Potato Genotypes Using Inter-PBS Retrotransposon Marker System. Plant Genet. Resour. 2018, 16, 137–145. [Google Scholar] [CrossRef]
- Khapilina, O.; Raiser, O.; Danilova, A.; Shevtsov, V.; Turzhanova, A.; Kalendar, R. DNA Profiling and Assessment of Genetic Diversity of Relict Species Allium Altaicum Pall. on the Territory of Altai. PeerJ 2021, 9, e10674. [Google Scholar] [CrossRef]
- Khapilina, O.; Turzhanova, A.; Danilova, A.; Tumenbayeva, A.; Shevtsov, V.; Kotukhov, Y.; Kalendar, R. Primer Binding Site (PBS) Profiling of Genetic Diversity of Natural Populations of Endemic Species Allium ledebourianum Schult. BioTech 2021, 10, 23. [Google Scholar] [CrossRef]
- Doungous, O.; Kalendar, R.; Filippova, N.; Ngane, B.K. Utility of IPBS Retrotransposons Markers for Molecular Characterization of African Gnetum Species. Plant Biosyst.-Int. J. Deal. All Asp. Plant Biol. 2020, 154, 587–592. [Google Scholar] [CrossRef]
- González Carracedo, M.; Tejera-Pérez, H.; Hernández Ferrer, M.; Jiménez Arias, D.; Pérez Pérez, J.A. Comparative Assessment of Microsatellite and Retrotransposon-Based Markers for Genetic Characterization of Commercial Banana Cultivars (Musa spp.). Plant Breed. 2021, 140, 968–980. [Google Scholar] [CrossRef]
- Rendón-Anaya, M.; Ibarra-Laclette, E.; Méndez-Bravo, A.; Lan, T.; Zheng, C.; Carretero-Paulet, L.; Perez-Torres, C.A.; Chacón-López, A.; Hernandez-Guzmán, G.; Chang, T.-H.; et al. The Avocado Genome Informs Deep Angiosperm Phylogeny, Highlights Introgressive Hybridization, and Reveals Pathogen-Influenced Gene Space Adaptation. Proc. Natl. Acad. Sci. USA 2019, 116, 17081–17089. [Google Scholar] [CrossRef] [PubMed]
- Ashworth, V.E.T.M. Microsatellite Markers in Avocado (Persea americana Mill.): Genealogical Relationships Among Cultivated Avocado Genotypes. J. Hered. 2003, 94, 407–415. [Google Scholar] [CrossRef]





| Race 1 | Source | Cultivar |
|---|---|---|
| G | PE | Reed |
| M | ICIA | Thomas |
| W | PE | SS3 |
| GxM | PE | Orotava |
| Fuerte | ||
| Hass | ||
| Pinkerton | ||
| Bacon | ||
| Zutano | ||
| ICIA | Lamb-Hass | |
| GxW | ICIA | Choquette |
| Julián |
| Primer ID 1 | Sequence (5′-3′) | Ta (°C) 2 |
|---|---|---|
| PBS2228 | CATTGGCTCTTGATACCA | 54.0 |
| PBS2232 | AGAGAGGCTCGGATACCA | 55.4 |
| PBS2237 | CCCCTACCTGGCGTGCCA | 55.0 |
| PBS2239 | ACCTAGGCTCGGATGCCA | 55.0 |
| PBS2242 | GCCCCATGGTGGGCGCCA | 57.0 |
| PBS2251 | GAACAGGCGATGATACCA | 53.2 |
| PBS2373 | GAACTTGCTCCGATGCCA | 51.0 |
| PBS2395 | TCCCCAGCGGAGTCGCCA | 52.8 |
| PBS2415 | CATCGTAGGTGGGCGCCA | 61.0 |
| Race | Cultivar | PBS2232 | PBS2239 | PBS2251 |
|---|---|---|---|---|
| M | Thomas | 21 | 14 | 16 |
| G | Reed | 21 | 13 | 17 |
| W | SS3 | 22 | 10 | 10 |
| GxM | Fuerte | 22 | 12 | 18 |
| Bacon | 19 | 14 | 16 | |
| Lamb-Hass | 20 | 13 | 13 | |
| Zutano | 18 | 12 | 14 | |
| Hass | 18 | 11 | 15 | |
| Pinkerton | 20 | 11 | 16 | |
| Orotava | 20 | 12 | 15 | |
| GxW | Choquette | 19 | 12 | 13 |
| Julián | 24 | 10 | 13 | |
| Alleles | 47 | 23 | 31 | |
| Monomorphic alleles | 7 (14.9) | 5 (21.7) | 5 (16.1) | |
| Polymorphic alleles | 30 (63.8) | 18 (78.3) | 20 (64.5) | |
| Cultivar-specific alleles 1 | 10 (21.3) | 0 (0.0) | 6 (19.4) | |
| LTR Cluster | iPBS Sequences | Potential LTRs | ||
|---|---|---|---|---|
| Length (bp) | Identity (%) | Gap (%) | ||
| 1 | PBS2232.01 | 278 | 97.1 | 0.7 |
| PBS2251.08 | 280 | |||
| 2 | PBS2232.13 | 297 | 79.4 | 10.1 |
| PBS2251.01 | 303 | |||
| 3 | PBS2232.12(-) | 313 | 82.7 | 5.0 |
| PBS2251.11(-) | 307 | |||
| 4 | PBS2251.06 | 234 | 66.0 | 17.9 |
| PBS2251.15 | ||||
| 6 | PBS2232.08 | 225 | 77.5 | 5.6 |
| PBS2232.08(-) | 224 | |||
| 7 | PBS2232.12 | 146 | 87.2 | 0.0 |
| PBS2232.10(-) | ||||
| PBS2251.06(-) | ||||
| 11 | PBS2251.14 | 181 | 96.4 | 0.0 |
| PBS2232.11(-) | ||||
| PBS2232.14(-) | ||||
| PBS2251.08(-) | ||||
| 12 | PBS2232.05(-) | 179 | 83.8 | 1.7 |
| PBS2251.17(-) | 176 | |||
| Primer Code | Potential LTR 1 | Primer Sequence (5′-3′) | Tm (°C) |
|---|---|---|---|
| PaIRAP-1 | PBS2251.01 | AGAAAGGAAAACCATCTAATTGTATC | 65.3 |
| PaIRAP-3 | PBS2232.12(-) | CTAGCTGGACTGGATTGATGG | 63.8 |
| PaIRAP-4 | PBS2251.06 | ATTAAATTGGATTGGGGTGTAAC | 64.7 |
| PaIRAP-5 | PBS2251.15 | TTTGGGGCTGGGGTGTAAC | 66.9 |
| PaIRAP-6 | PBS2251.14, PBS2232.11(-) PBS2232.14(-) PBS2251.08(-) | GTAAGGGTGTAAGCTCTACATATAAAC | 63.7 |
| PaIRAP-8 | PBS2232.10(-) | GGGCTCGACCACAATTATGAC | 66.1 |
| PaIRAP-9 | PBS2232.13 | GGGCTTTGGGCCTATTTAAC | 65.6 |
| PaIRAP-10 | PBS2232.01 PBS2251.08 | GGGCTTTTGGCCTGTTTAAC | 66.2 |
| Race | Cultivar | PaIRAP-5 | PaIRAP-6 | PaIRAP-8 |
|---|---|---|---|---|
| M | Thomas | 8 | 12 | 15 |
| G | Reed | 15 | 13 | 13 |
| W | SS3 | 11 | 10 | 14 |
| GxM | Fuerte | 14 | 15 | 15 |
| Bacon | 14 | 11 | 16 | |
| Lamb-Hass | 13 | 11 | 14 | |
| Zutano | 10 | 12 | 13 | |
| Hass | 14 | 11 | 16 | |
| Pinkerton | 13 | 11 | 13 | |
| Orotava | 11 | 11 | 14 | |
| GxW | Choquette | 13 | 10 | 12 |
| Julián | 13 | 13 | 16 | |
| Alleles | 26 | 29 | 34 | |
| Monomorphic alleles | 1 (3.8) | 4 (13.8) | 9 (26.5) | |
| Polymorphic alleles | 20 (76.9) | 15 (51.7) | 22 (64.7) | |
| Cultivar-specific alleles 1 | 5 (19.2) | 10 (34.5) | 3 (8.8) | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carracedo, M.G.; Alonso, S.B.; Cabrera, R.S.B.; Jiménez-Arias, D.; Pérez Pérez, J.A. Development of Retrotransposon-Based Molecular Markers for Characterization of Persea americana (Avocado) Cultivars and Horticultural Races. Agronomy 2022, 12, 1510. https://doi.org/10.3390/agronomy12071510
Carracedo MG, Alonso SB, Cabrera RSB, Jiménez-Arias D, Pérez Pérez JA. Development of Retrotransposon-Based Molecular Markers for Characterization of Persea americana (Avocado) Cultivars and Horticultural Races. Agronomy. 2022; 12(7):1510. https://doi.org/10.3390/agronomy12071510
Chicago/Turabian StyleCarracedo, Mario González, Samuel Bello Alonso, Rahil Salomé Brito Cabrera, David Jiménez-Arias, and José Antonio Pérez Pérez. 2022. "Development of Retrotransposon-Based Molecular Markers for Characterization of Persea americana (Avocado) Cultivars and Horticultural Races" Agronomy 12, no. 7: 1510. https://doi.org/10.3390/agronomy12071510
APA StyleCarracedo, M. G., Alonso, S. B., Cabrera, R. S. B., Jiménez-Arias, D., & Pérez Pérez, J. A. (2022). Development of Retrotransposon-Based Molecular Markers for Characterization of Persea americana (Avocado) Cultivars and Horticultural Races. Agronomy, 12(7), 1510. https://doi.org/10.3390/agronomy12071510

