Sterculic Acid Alters Adhesion Molecules Expression and Extracellular Matrix Compounds to Regulate Migration of Lung Cancer Cells
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Culture
2.2. Cell Treatments
2.3. Cell Viability Assay
2.4. Wound Healing Assay
2.5. Transwell Migration Assay
2.6. RNA Purification
2.7. Quantitative Real-Time PCR
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. SA Induces Dose-Dependent Cytotoxicity in Cancer Cell Lines in Serum and Serum-Free Conditions
3.2. SA Reduces Cell Motility
3.3. SA Modifies Expression of Cell Adhesion, Matrix Composition and Remodeling Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Quail, D.F.; Joyce, J.A. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef] [PubMed]
- Najafi, M.; Farhood, B.; Mortezaee, K. Extracellular matrix (ECM) stiffness and degradation as cancer drivers. J. Cell. Biochem. 2018, 120, 2782–2790. [Google Scholar] [CrossRef]
- Hanahan, D.; Coussens, L.M. Accessories to the Crime: Functions of Cells Recruited to the Tumor Microenvironment. Cancer Cell 2012, 21, 309–322. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Hou, J.; Yu, S.; Li, W.; Wang, X.; Sun, H.; Qin, T.; Claret, F.X.; Guo, H.; Liu, Z. Role of cancer-associated fibroblasts in the resistance to antitumor therapy, and their potential therapeutic mecha-nisms in non-small cell lung cancer. Oncol. Lett. 2021, 21, 413. [Google Scholar] [CrossRef] [PubMed]
- Hui, L.; Chen, Y. Tumor microenvironment: Sanctuary of the devil. Cancer Lett. 2015, 368, 7–13. [Google Scholar] [CrossRef]
- Mouw, J.K.; Ou, G.; Weaver, V.M. Extracellular matrix assembly: A multiscale deconstruction. Nat. Rev. Mol. Cell Biol. 2014, 15, 771–785. [Google Scholar] [CrossRef]
- Theocharis, A.D.; Skandalis, S.S.; Gialeli, C.; Karamanos, N.K. Extracellular matrix structure. Adv. Drug Deliv. Rev. 2015, 97, 4–27. [Google Scholar] [CrossRef]
- McKee, T.J.; Perlman, G.; Morris, M.; Komarova, S.V. Extracellular matrix composition of connective tissues: A systematic review and meta-analysis. Sci. Rep. 2019, 9, 10542. [Google Scholar] [CrossRef] [PubMed]
- Duval, K.; Grover, H.; Han, L.-H.; Mou, Y.; Pegoraro, A.F.; Fredberg, J.; Chen, Z. Modeling Physiological Events in 2D vs. 3D Cell Culture. Physiology 2017, 32, 266–277. [Google Scholar] [CrossRef]
- Afik, R.; Zigmond, E.; Vugman, M.; Klepfish, M.; Shimshoni, E.; Pasmanik-Chor, M.; Shenoy, A.; Bassat, E.; Halpern, Z.; Geiger, T.; et al. Tumor macrophages are pivotal constructors of tumor collagenous matrix. J. Exp. Med. 2016, 213, 2315–2331. [Google Scholar] [CrossRef] [PubMed]
- Sekiya, S.; Miura, S.; Matsuda-Ito, K.; Suzuki, A. Myofibroblasts Derived from Hepatic Progenitor Cells Create the Tumor Microenvironment. Stem Cell Rep. 2016, 7, 1130–1139. [Google Scholar] [CrossRef]
- Nallanthighal, S.; Heiserman, J.P.; Cheon, D.-J. The Role of the Extracellular Matrix in Cancer Stemness. Front. Cell Dev. Biol. 2019, 7, 86. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-H.; Turnbull, J.; Guimond, S. Extracellular matrix and cell signalling: The dynamic cooperation of integrin, proteoglycan and growth factor receptor. J. Endocrinol. 2011, 209, 139–151. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y. Endothelial glycocalyx as a critical signalling platform integrating the extracellular haemodynamic forces and chemical signalling. J. Cell. Mol. Med. 2017, 21, 1457–1462. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Hu, M.; Huang, K.; Lin, S.; Du, H. Roles of Proteoglycans and Glycosaminoglycans in Cancer Development and Progression. Int. J. Mol. Sci. 2020, 21, 5983. [Google Scholar] [CrossRef] [PubMed]
- Lu, P.; Weaver, V.M.; Werb, Z. The extracellular matrix: A dynamic niche in cancer progression. J. Cell Biol. 2012, 196, 395–406. [Google Scholar] [CrossRef]
- Wu, Y.H.; Huang, Y.F.; Chang, T.H.; Chen, C.C.; Wu, P.Y.; Huang, S.C.; Chou, C.Y. COL11A1 activates cancer-associated fibroblasts by modulating TGF-beta3 through the NF-kappaB/IGFBP2 axis in ovarian cancer cells. Oncogene 2021, 40, 4503–4519. [Google Scholar] [CrossRef]
- Frantz, C.; Stewart, K.M.; Weaver, V.M. The extracellular matrix at a glance. J. Cell Sci. 2010, 123, 4195–4200. [Google Scholar] [CrossRef]
- Netti, P.A.; Berk, D.A.; Swartz, M.A.; Grodzinsky, A.J.; Jain, R.K. Role of extracellular matrix assembly in interstitial transport in solid tumors. Cancer Res. 2000, 60, 2497–2503. [Google Scholar]
- Bourboulia, D.; Stetler-Stevenson, W.G. Matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs): Positive and negative regulators in tumor cell adhesion. Semin. Cancer Biol. 2010, 20, 161–168. [Google Scholar] [CrossRef]
- Aued-Pimentel, S.; Lago, J.H.G.; Chaves, M.H.; Kumagai, E.E. Evaluation of a methylation procedure to determine cyclopropenoids fatty acids from Sterculia striata St. Hil. Et Nauds seed oil. J. Chromatogr. A 2004, 1054, 235–239. [Google Scholar] [CrossRef]
- Bichi, E.; Toral, P.G.; Hervás, G.; Frutos, P.; Gómez-Cortés, P.; Juárez, M.; De la Fuente, M.A. Inhibition of 9-desaturase activity with sterculic acid: Effect on the endogenous synthesis of cis-9 18:1 and cis-9, trans-11 18:2 in dairy sheep. J. Dairy Sci. 2012, 95, 5242–5252. [Google Scholar] [CrossRef]
- Ortinau, L.C.; Nickelson, K.J.; Stromsdorfer, K.L.; Naik, C.Y.; Pickering, R.T.; Haynes, R.A.; Fritsche, K.L.; Perfield, J.W. Sterculic Oil, a natural inhibitor of SCD1, improves the metabolic state of obese OLETF rats. Obesity 2013, 21, 344–352. [Google Scholar] [CrossRef] [PubMed]
- Kadegowda, A.K.G.; Burns, T.A.; Pratt, S.L.; Duckett, S.K. Inhibition of stearoyl-CoA desaturase 1 reduces lipogenesis in primary bovine adipocytes. Lipids 2013, 48, 967–976. [Google Scholar] [CrossRef]
- Gomez, F.E.; Bauman, D.E.; Ntambi, J.M.; Fox, B.G. Effects of sterculic acid on stearoyl-CoA desaturase in differentiating 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun. 2003, 300, 316–326. [Google Scholar] [CrossRef]
- Herrera-Meza, M.S.; Mendoza-Lopez, M.R.; Garcia-Barradas, O.; Sanchez-Otero, M.G.; Silva-Hernández, E.R.; Angulo, J.O.; Oliart-Ros, R.M. Dietary anhydrous milk fat naturally enriched with conjugated linoleic acid and vaccenic acid modify cardiovascular risk biomarkers in spontaneously hypertensive rats. Int. J. Food Sci. Nutr. 2013, 64, 575–586. [Google Scholar] [CrossRef]
- Ortinau, L.C.; Pickering, R.T.; Nickelson, K.J.; Stromsdorfer, K.L.; Naik, C.Y.; Haynes, R.A.; Bauman, D.E.; Rector, R.S.; Fritsche, K.L.; Perfield, J.W. Sterculic Oil, a Natural SCD1 Inhibitor, Improves Glucose Tolerance in Obese ob/ob Mice. ISRN Endocrinol. 2012, 2012, 947323. [Google Scholar] [CrossRef] [PubMed]
- Peláez, R.; Pariente, A.; Pérez-Sala, Á.; Larráyoz, I.M. Sterculic Acid: The Mechanisms of Action beyond Stearoyl-CoA Desaturase Inhibition and Therapeutic Oppor-tunities in Human Diseases. Cells 2020, 9, 140. [Google Scholar] [CrossRef] [PubMed]
- Galbraith, L.; Leung, H.Y.; Ahmad, I. Lipid pathway deregulation in advanced prostate cancer. Pharmacol. Res. 2018, 131, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Fritz, V.; Benfodda, Z.; Rodier, G.; Henriquet, C.; Iborra, F.; Avancès, C.; Allory, Y.; de la Taille, A.; Culine, S.; Blancou, H.; et al. Abrogation of de novo lipogenesis by stearoyl-CoA desaturase 1 inhibition interferes with oncogenic signaling and blocks prostate cancer progression in mice. Mol. Cancer Ther. 2010, 9, 1740–1754. [Google Scholar] [CrossRef]
- Tracz-Gaszewska, Z.; Dobrzyn, P. Stearoyl-CoA Desaturase 1 as a Therapeutic Target for the Treatment of Cancer. Cancers 2019, 11, 948. [Google Scholar] [CrossRef]
- Huang, J.-D.; Amaral, J.; Lee, J.W.; Larrayoz, I.; Rodriguez, I.R. Sterculic acid antagonizes 7-ketocholesterol-mediated inflammation and inhibits choroidal neovascularization. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 2012, 1821, 637–646. [Google Scholar] [CrossRef][Green Version]
- Major, C.A.; Ryan, K.; Bennett, A.; Lock, A.L.; Bauman, D.E.; Salter, A. Inhibition of stearoyl CoA desaturase activity induces hypercholesterolemia in the cholesterol-fed hamster. J. Lipid Res. 2008, 49, 1456–1465. [Google Scholar] [CrossRef]
- Huang, J.-D.; Amaral, J.; Lee, J.W.; Rodriguez, I.R. 7-Ketocholesterol-Induced Inflammation Signals Mostly through the TLR4 Receptor Both In Vitro and In Vivo. PLoS ONE 2014, 9, e100985. [Google Scholar] [CrossRef] [PubMed]
- Pariente, A.; Pérez-Sala, Á.; Ochoa, R.; Peláez, R.; Larráyoz, I.M. Genome-Wide Transcriptomic Analysis Identifies Pathways Regulated by Sterculic Acid in Retinal Pigmented Epithelium Cells. Cells 2020, 9, 1187. [Google Scholar] [CrossRef] [PubMed]
- Coderch, C.; de Cerio, M.D.; Zapico, J.M.; Peláez, R.; Larrayoz, I.; Ramos, A.; Martínez, A.; de Pascual-Teresa, B. In silico identification and in vivo characterization of small molecule therapeutic hypothermia mimetics. Bioorg. Med. Chem. 2017, 25, 6597–6604. [Google Scholar] [CrossRef] [PubMed]
- Scaglia, N.; Igal, R.A. Inhibition of Stearoyl-CoA Desaturase 1 expression in human lung adenocarcinoma cells impairs tu-morigenesis. Int. J. Oncol. 2008, 33, 839–850. [Google Scholar]
- Hess, D.; Chisholm, J.W.; Igal, R.A. Inhibition of StearoylCoA Desaturase Activity Blocks Cell Cycle Progression and Induces Programmed Cell Death in Lung Cancer Cells. PLoS ONE 2010, 5, e11394. [Google Scholar] [CrossRef] [PubMed]
- Roongta, U.V.; Pabalan, J.G.; Wang, X.; Ryseck, R.P.; Fargnoli, J.; Henley, B.J.; Yang, W.-P.; Zhu, J.; Madireddi, M.T.; Lawrence, R.M.; et al. Cancer cell dependence on unsaturated fatty acids implicates stearoyl-CoA desaturase as a target for cancer therapy. Mol. Cancer Res. 2011, 9, 1551–1561. [Google Scholar] [CrossRef]
- Tang, D.; Kang, R.; Berghe, T.V.; Vandenabeele, P.; Kroemer, G. The molecular machinery of regulated cell death. Cell Res. 2019, 29, 347–364. [Google Scholar] [CrossRef]
- Xu, T.; Ding, W.; Ji, X.; Ao, X.; Liu, Y.; Yu, W.; Wang, J. Molecular mechanisms of ferroptosis and its role in cancer therapy. J. Cell. Mol. Med. 2019, 23, 4900–4912. [Google Scholar] [CrossRef] [PubMed]
- Nury, T.; Zarrouk, A.; Mackrill, J.J.; Samadi, M.; Durand, P.; Riedinger, J.M.; Doria, M.; Vejux, A.; Limage, E.; Delmas, D.; et al. Induction of oxiapoptophagy on 158N murine oligodendrocytes treated by 7-ketocholesterol-, 7beta-hydroxycholesterol-, or 24(S)-hydroxycholesterol: Protective effects of alpha-tocopherol and docosahexaenoic acid (DHA.; C22:6 n-3). Steroids 2015, 99, 194–203. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Deng, R.; Zhang, C. Erastin induces apoptotic and ferroptotic cell death by inducing ROS accumulation by causing mitochondrial dysfunction in gastric cancer cell HGC-27. Mol. Med. Rep. 2020, 22, 2826–2832. [Google Scholar] [CrossRef]
- Bhattacharya, D.; Basta, B.; Mato, J.M.; Craig, A.; Fernández-Ramos, D.; Lopitz-Otsoa, F.; Tsvirkun, D.; Hayardeny, L.; Chandar, V.; Schwartz, R.E.; et al. Aramchol downregulates stearoyl CoA-desaturase 1 in hepatic stellate cells to attenuate cellular fibro-genesis. JHEP Rep. 2021, 3, 100237. [Google Scholar] [CrossRef]
- He, Y.; Liu, R.; Yang, M.; Bi, W.; Zhou, L.; Zhang, S.; Jin, J.; Liang, X.; Zhang, P. Identification of VWF as a Novel Biomarker in Lung Adenocarcinoma by Comprehensive Analysis. Front. Oncol. 2021, 11, 1–11. [Google Scholar] [CrossRef]
- Wang, J.; Song, J.; Gao, Z.; Huo, X.; Zhang, Y.; Wang, W.; Qi, J.; Zheng, S. Analysis of gene expression profiles of non-small cell lung cancer at different stages reveals significantly altered biological functions and candidate genes. Oncol. Rep. 2017, 37, 1736–1746. [Google Scholar] [CrossRef]
- Beaulieu, M.-E.; Jauset, T.; Massó-Vallés, D.; Martínez-Martín, S.; Rahl, P.; Maltais, L.; Zacarias-Fluck, M.F.; Casacuberta-Serra, S.; Del Pozo, E.S.; Fiore, C.; et al. Intrinsic cell-penetrating activity propels Omomyc from proof of concept to viable anti-MYC therapy. Sci. Transl. Med. 2019, 11, eaar5012. [Google Scholar] [CrossRef]
- Godar, S.; Ince, T.A.; Bell, G.W.; Feldser, D.; Donaher, J.L.; Bergh, J.; Liu, A.; Miu, K.; Watnick, R.S.; Reinhardt, F.; et al. Growth-Inhibitory and Tumor- Suppressive Functions of p53 Depend on Its Repression of CD44 Expression. Cell 2008, 134, 62–73. [Google Scholar] [CrossRef]
- Sottile, J.; Hocking, D.C. Fibronectin Polymerization Regulates the Composition and Stability of Extracellular Matrix Fibrils and Cell-Matrix Adhesions. Mol. Biol. Cell 2002, 13, 3546–3559. [Google Scholar] [CrossRef] [PubMed]
- Musiime, M.; Chang, J.; Hansen, U.; Kadler, K.; Zeltz, C.; Gullberg, D. Collagen Assembly at the Cell Surface: Dogmas Revisited. Cells 2021, 10, 662. [Google Scholar] [CrossRef]
- Zeisberg, M.; Neilson, E.G. Biomarkers for epithelial-mesenchymal transitions. J. Clin. Investig. 2009, 119, 1429–1437. [Google Scholar] [CrossRef]
- Rybak, J.-N.; Roesli, C.; Kaspar, M.; Villa, A.; Neri, D. The Extra-domain A of Fibronectin Is a Vascular Marker of Solid Tumors and Metastases. Cancer Res. 2007, 67, 10948–10957. [Google Scholar] [CrossRef]
- Bae, Y.K.; Kim, A.; Kim, M.K.; Choi, J.E.; Kang, S.H.; Lee, S.J. Fibronectin expression in carcinoma cells correlates with tumor aggressiveness and poor clinical outcome in patients with invasive breast cancer. Hum. Pathol. 2013, 44, 2028–2037. [Google Scholar] [CrossRef]
- Jun, B.H.; Guo, T.; Libring, S.; Chanda, M.K.; Paez, J.S.; Shinde, A.; Wendt, M.K.; Vlachos, P.P.; Solorio, L. Fibronectin-Expressing Mesenchymal Tumor Cells Promote Breast Cancer Metastasis. Cancers 2020, 12, 2553. [Google Scholar] [CrossRef]
- Roovers, K.; Assoian, R.K. Integrating the MAP kinase signal into the G1 phase cell cycle machinery. Bioessays 2000, 22, 818–826. [Google Scholar] [CrossRef]
- Balanis, N.; Wendt, M.; Schiemann, B.J.; Wang, Z.; Schiemann, W.P.; Carlin, C.R. Epithelial to Mesenchymal Transition Promotes Breast Cancer Progression via a Fibronectin-dependent STAT3 Signaling Pathway. J. Biol. Chem. 2013, 288, 17954–17967. [Google Scholar] [CrossRef]
- Liu, J.; Tan, Y.; Zhang, H.; Zhang, Y.; Xu, P.; Chen, J.; Poh, Y.-C.; Tang, K.; Wang, N.; Huang, B. Soft fibrin gels promote selection and growth of tumorigenic cells. Nat. Mater. 2012, 11, 734–741. [Google Scholar] [CrossRef] [PubMed]
- Peláez, R.; Morales, X.; Salvo, E.; Garasa, S.; Ortiz de Solórzano, C.; Martínez, A.; Larrayoz, I.M.; Rouzat, A. beta3 integrin expression is required for invadopodia-mediated ECM degradation in lung carcinoma cells. PLoS ONE 2017, 12, e0181579. [Google Scholar] [CrossRef] [PubMed]
- Salvo, E.; Garasa, S.; Dotor, J.; Morales, X.; Peláez, R.; Altevogt, P.; Rouzaut, A. Combined targeting of TGF-beta1 and integrin beta3 impairs lymph node metastasis in a mouse model of non-small-cell lung cancer. Mol. Cancer 2014, 13, 112. [Google Scholar] [CrossRef] [PubMed]
- Park, K.Y.; Kim, J. Cyclic pentapeptide cRGDfK enhances the inhibitory effect of sunitinib on TGF-beta1-induced epitheli-al-to-mesenchymal transition in human non-small cell lung cancer cells. PLoS ONE 2020, 15, e0232917. [Google Scholar]
- Zhu, C.; Kong, Z.; Wang, B.; Cheng, W.; Wu, A.; Meng, X. ITGB3/CD61: A hub modulator and target in the tumor microenvironment. Am. J. Transl. Res. 2019, 11, 7195–7208. [Google Scholar]
- Kariya, Y.; Oyama, M.; Suzuki, T.; Kariya, Y. alphavbeta3 Integrin induces partial EMT independent of TGF-beta signaling. Commun. Biol. 2021, 4, 490. [Google Scholar] [CrossRef] [PubMed]
- Baciu, P.C.; Suleiman, E.A.; Deryugina, E.I.; Strongin, A.Y. Membrane type-1 matrix metalloproteinase (MT1-MMP) processing of pro-alphav integrin regulates cross-talk between alphavbeta3 and alpha2beta1 integrins in breast carcinoma cells. Exp. Cell Res. 2003, 291, 167–175. [Google Scholar] [CrossRef]
- Yosef, G.; Arkadash, V.; Papo, N. Targeting the MMP-14/MMP-2/integrin alphavbeta3 axis with multispecific N-TIMP2-based antagonists for cancer therapy. J. Biol. Chem. 2018, 293, 13310–13326. [Google Scholar] [CrossRef] [PubMed]
- Eto, K.; Huet, C.; Tarui, T.; Kupriyanov, S.; Liu, H.Z.; Puzon-McLaughlin, W.; Zhang, X.-P.; Sheppard, D.; Engvall, E.; Takada, Y. Functional classification of ADAMs based on a conserved motif for binding to integrin alpha 9beta 1: Implications for sperm-egg binding and other cell interactions. J. Biol. Chem. 2002, 277, 17804–17810. [Google Scholar] [CrossRef]
- Xiang, B.; Liu, Y.; Zhao, W.; Zhao, H.; Yu, H. Extracellular calcium regulates the adhesion and migration of osteoclasts via integrin alphav beta 3/Rho A/Cytoskeleton signaling. Cell Biol. Int. 2019, 43, 1125–1136. [Google Scholar] [CrossRef] [PubMed]
- Qi, J.H.; Anand-Apte, B. Tissue inhibitor of metalloproteinase-3 (TIMP3) promotes endothelial apoptosis via a caspa-se-independent mechanism. Apoptosis 2015, 20, 523–534. [Google Scholar] [CrossRef]
- Ioannidis, D.; Tsagkovits, A.; Rokade, A. Minimising aerosol spread during endoscopic sinus and skull base surgery. Ex-perimental model evaluation of the efficacy of the microscope drape method. J. Laryngol. Otol. 2020, 134, 1–7. [Google Scholar] [CrossRef]
- Xu, C.; Hou, Z.; Zhan, P.; Zhao, W.; Chang, C.; Zou, J.; Hu, H.; Zhang, Y.; Yao, X.; Yu, L.; et al. EZH2 regulates cancer cell migration through repressing TIMP-3 in non-small cell lung cancer. Med. Oncol. 2013, 30, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Ricono, J.M.; Huang, M.; Barnes, L.A.; Lau, S.K.; Weis, S.M.; Schlaepfer, D.D.; Hanks, S.K.; Cheresh, D.A. Specific cross-talk between epidermal growth factor receptor and integrin alphavbeta5 promotes carcinoma cell invasion and metastasis. Cancer Res. 2009, 69, 1383–1391. [Google Scholar] [CrossRef]
- Cheuk, I.W.-Y.; Siu, M.T.; Ho, J.C.-W.; Chen, J.; Shin, V.Y.; Kwong, A. ITGAV targeting as a therapeutic approach for treatment of metastatic breast cancer. Am. J. Cancer Res. 2020, 10, 211–223. [Google Scholar]
- Knyazev, E.N.; Nyushko, K.M.; Alekseev, B.Y.; Samatov, T.R.; Shkurnikov, M.Y. Suppression of ITGB4 Gene Expression in PC-3 Cells with Short Interfering RNA Induces Changes in the Expression of beta-Integrins Associated with RGD-Receptors. Bull. Exp. Biol. Med. 2015, 159, 541–545. [Google Scholar] [CrossRef]
- Drake, J.M.; Barnes, J.M.; Madsen, J.M.; Domann, F.E.; Stipp, C.S.; Henry, M.D. ZEB1 coordinately regulates laminin-332 and {beta}4 integrin expression altering the invasive phenotype of prostate cancer cells. J. Biol. Chem. 2010, 285, 33940–33948. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, A.R.; Reynolds, L.E.; Nagel, T.E.; Lively, J.C.; Robinson, S.D.; Hicklin, D.J.; Bodary, S.C.; Hodivala-Dilke, K.M. Elevated Flk1 (vascular endothelial growth factor receptor 2) signaling mediates enhanced angiogenesis in beta3-integrin-deficient mice. Cancer Res. 2004, 64, 8643–8650. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, L.E.; Wyder, L.; Lively, J.C.; Taverna, D.; Robinson, S.D.; Huang, X.; Sheppard, D.; Hynes, R.O.; Hodivala-Dike, K.M. Enhanced pathological angiogenesis in mice lacking beta3 integrin or beta3 and beta5 integrins. Nat. Med. 2002, 8, 27–34. [Google Scholar] [CrossRef]
- Aleckovic, M.; Wei, Y.; Leroy, G.; Sidoli, S.; Liu, D.D.; Garcia, B.A.; Kang, Y. Identification of Nidogen 1 as a lung metastasis protein through secretome analysis. Genes Dev. 2017, 31, 1439–1455. [Google Scholar] [CrossRef]
- Xu, X.; Zhou, X.; Gao, C.; Cui, Y. Hsa_circ_0018818 knockdown suppresses tumorigenesis in non-small cell lung cancer by sponging miR-767-3p. Aging 2020, 12, 7774–7785. [Google Scholar] [CrossRef] [PubMed]
- Mohan, A.; Rajan, R.R.; Mohan, G.; Puthenveettil, P.K.; Maliekal, T.T. Markers and Reporters to Reveal the Hierarchy in Heterogeneous Cancer Stem Cells. Front. Cell Dev. Biol. 2021, 9, 1–19. [Google Scholar] [CrossRef]
- Li, L.; Qi, L.; Liang, Z.; Song, W.; Liu, Y.; Wang, Y.; Sun, B.; Zhang, B.; Cao, W. Transforming growth factor-beta1 induces EMT by the transactivation of epidermal growth factor signaling through HA/CD44 in lung and breast cancer cells. Int. J. Mol. Med. 2015, 36, 113–122. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.; Kumar, B.; Datta, J.; Teknos, T.N.; Kumar, P. IL-6 Promotes Head and Neck Tumor Metastasis by Inducing Epithelial–Mesenchymal Transition via the JAK-STAT3-SNAIL Signaling Pathway. Mol. Cancer Res. 2011, 9, 1658–1667. [Google Scholar] [CrossRef] [PubMed]
- Bihl, M.; Tamm, M.; Nauck, M.; Wieland, H.; Perruchoud, A.P.; Roth, M. Proliferation of Human Non–Small-Cell Lung Cancer Cell Lines: Role of Interleukin-6. Am. J. Respir. Cell Mol. Biol. 1998, 19, 606–612. [Google Scholar] [CrossRef]
- Zhang, L.; Chen, W.X.; Li, L.L.; Cao, Y.Z.; Geng, Y.D.; Feng, X.J. Paeonol Suppresses Proliferation and Motility of Non-Small-Cell Lung Cancer Cells by Disrupting STAT3/NF-kappaB Signaling. Front. Pharmacol. 2020, 11, 572616. [Google Scholar] [CrossRef]
- Shen, Y.; Chen, Q.; Li, L. Endostar regulates EMT, migration and invasion of lung cancer cells through the HGF-Met pathway. Mol. Cell. Probes 2019, 45, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.C.; Chan, S.T.; Chang, C.N.; Yu, P.S.; Chuang, C.H.; Yeh, S.L. Quercetin and chrysin inhibit nickel-induced invasion and migration by downregulation of TLR4/NF-kappaB signaling in A549cells. Chem. Biol. Interact. 2018, 292, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Jin, Y.; Sun, Y.; Lei, J.; Liu, C. Knockdown of toll-like receptor 4 inhibits human NSCLC cancer cell growth and inflammatory cytokine secretion in vitro and in vivo. Int. J. Oncol. 2014, 45, 813–821. [Google Scholar] [CrossRef][Green Version]
- Hirano, T. IL-6 in inflammation, autoimmunity and cancer. Int. Immunol. 2021, 33, 127–148. [Google Scholar] [CrossRef]
- Rose-John, S. The Soluble Interleukin 6 Receptor: Advanced Therapeutic Options in Inflammation. Clin. Pharmacol. Ther. 2017, 102, 591–598. [Google Scholar] [CrossRef] [PubMed]
- Amour, A.; Slocombe, P.M.; Webster, A.; Butler, M.; Knight, C.; Smith, B.J.; Stephens, P.E.; Shelley, C.; Hutton, M.; Knauper, V.; et al. TNF-α converting enzyme (TACE) is inhibited by TIMP-3. FEBS Lett. 1998, 435, 39–44. [Google Scholar] [CrossRef]
- Xu, T.; Shen, X.; Seyfert, H.-M. Stearoyl-CoA desaturase 1 expression is downregulated in liver and udder during E. coli mastitis through enhanced expression of repressive C/EBP factors and reduced expression of the inducer SREBP1A. BMC Mol. Biol. 2016, 17, 1–16. [Google Scholar] [CrossRef]
- Angelucci, C.; D’Alessio, A.; Iacopino, F.; Proietti, G.; Di Leone, A.; Masetti, R.; Sica, G. Pivotal role of human stearoyl-CoA desaturases (SCD1 and 5) in breast cancer progression: Oleic acid-based effect of SCD1 on cell migration and a novel pro-cell survival role for SCD5. Oncotarget 2018, 9, 24364–24380. [Google Scholar] [CrossRef]
- Ran, H.; Zhu, Y.; Deng, R.; Zhang, Q.; Liu, X.; Feng, M.; Zhong, J.; Lin, S.; Tong, X.; Su, Q. Stearoyl-CoA desaturase-1 promotes colorectal cancer metastasis in response to glucose by suppressing PTEN. J. Exp. Clin. Cancer Res. 2018, 37, 54. [Google Scholar] [CrossRef]
- Brabletz, T.; Kalluri, R.; Nieto, M.A.; Weinberg, R.A. EMT in cancer. Nat. Rev. Cancer 2018, 18, 128–134. [Google Scholar] [CrossRef] [PubMed]
- Pan, T.; Zhang, F.; Li, F.; Gao, X.; Li, Z.; Li, X.; Ren, X. Shikonin blocks human lung adenocarcinoma cell migration and invasion in the inflammatory microenvironment via the IL-6/STAT3 signaling pathway. Oncol. Rep. 2020, 44, 1049–1063. [Google Scholar] [CrossRef] [PubMed]
- Shen, K.-H.; Hung, J.-H.; Liao, Y.-C.; Tsai, S.-T.; Wu, M.-J.; Chen, P.-S. Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs. Int. J. Mol. Sci. 2020, 21, 3080. [Google Scholar] [CrossRef]
- Mauvoisin, D.; Charfi, C.; Lounis, A.M.; Rassart, E.; Mounier, C. Decreasing stearoyl-CoA desaturase-1 expression inhibits beta-catenin signaling in breast cancer cells. Cancer Sci. 2013, 104, 36–42. [Google Scholar] [CrossRef]
- Park, S.-M.; Gaur, A.B.; Lengyel, E.; Peter, M.E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008, 22, 894–907. [Google Scholar] [CrossRef] [PubMed]
- Yankaskas, C.; Thompson, K.N.; Paul, C.D.; Vitolo, M.I.; Mistriotis, P.; Mahendra, A.; Bajpai, V.K.; Shea, D.J.; Manto, K.M.; Chai, A.C.; et al. A microfluidic assay for the quantification of the metastatic propensity of breast cancer specimens. Nat. Biomed. Eng. 2019, 3, 452–465. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.C.; Humphries, B.; Brien, R.; Gibbons, A.E.; Chen, Y.T.; Qyli, T.; Haley, H.R.; Pirone, M.E.; Chiang, B.; Xiao, A. Functional Isolation of Tumor-Initiating Cells using Microfluidic-Based Migration Identifies Phosphatidylserine Decarboxylase as a Key Regulator. Sci. Rep. 2018, 8, 244. [Google Scholar] [CrossRef]
- Marin-Bejar, O.; Rogiers, A.; Dewaele, M.; Femel, J.; Karras, P.; Pozniak, J.; Bervoets, G.; Van Raemdonck, N.; Pedri, D.; Swings, T.; et al. Evolutionary predictability of genetic versus nongenetic resistance to anticancer drugs in melanoma. Cancer Cell 2021, 39, 1135–1149.e8. [Google Scholar] [CrossRef]







| Gene Name | Oligonucleotide Sequence |
|---|---|
| ITGβ1-Fow | AACGGGGTGAATGGAACAGG |
| ITGβ1-Rev | ACTTCCTCCGTAAAGCCCAG |
| ITGβ3-Fow | TTGATGCTTATGGGAAAATCCG |
| ITGβ3-Rev | ACCTTGGCCTCAATGCTGAA |
| ITGβ5-Fow | CAAACTCGCGGAGGAGATGA |
| ITGβ5-Rev | AATGCACGGATTGGTCTGGT |
| ITGα5-Fow | TGGCCTTCGGTTTACAGTCC |
| ITGα5-Rev | GGAGAGCCGAAAGGAAACCA |
| IL-6-Fow | TACCCCCAGGAGAAGATTCC |
| Il-6-Rev | TTTTCTGCCAGTGCCTCTTT |
| ITGαV-Fow | CCAAAGCAAACACCACCCAG |
| ITGαV-Rev | GCTCCAAACCACTGATGGGA |
| TIMP3-Fow | CAAGGGGCTGAACTATCGGT |
| TIMP3-Rev | TCGGTCCAGAGACACTCGTT |
| VIM-Fow | CAGGACTCGGTGGACTTCTC |
| VIM-Rev | TAGTTGGCGAAGCGGTCATT |
| SNAIL-Fow | CTATGCCGCGCTCTTTCCTC |
| SNAIL-Rev | GTAGGGCTGCTGGAAGGTAAA |
| TGFβ1-Fow | TTGAGCCGTGGAGGGGAAAT |
| TGFβ1-Rev | GCGTTGATGTCCACTTGCAG |
| TWIST1-Fow | ATTCAGACCCTCAAGCTGGC |
| TWIST1-Rev | CATCCTCCAGACCGAGAAGG |
| TWIST2-Fow | AGCAAGAAGTCGAGCGAAGA |
| TWIST2-Rev | CTTGTCAGAGGGCAGCGT |
| ZEB1-Fow | ACGCTTTTCCCATTCTGGCT |
| ZEB1-Rev | TTTGCCGTATCTGTGGTCGT |
| ZEB2-Fow | CCAAGGAGCAGGTAATCGCA |
| ZEB2-Rev | GTGCGAACTGTAGGAACCAGA |
| ACTA2-Fow | CCAACTGGGACGACATGGAA |
| ACTA2-Rev | CAGGGTGGGATGCTCTTCAG |
| CDH1-Fow | GACGCGGACGATGATGTGAA |
| CDH1-Rev | GAAACTCTCTCGGTCCAGCC |
| CDH2-Fow | GCCCAAGACAAAGAGACCCA |
| CDH2-Rev | ACCCAGTCTCTCTTCTGCCT |
| FN1-Fow | TTCCAAGCACAGCCACTTC |
| FN1-Rev | AACTCTGCTCCCCATCCTCA |
| NID1-Fow | ACGGGGATGACTTCGTCTCT |
| NID1-Rev | GGGGGTTCACTCGTAGCAAT |
| CD44-Fow | GACATCTACCCCAGCAACCC |
| CD44-Rev | CTGTCTGTGCTGTCGGTGAT |
| 18S-Fow | ATGCTCTTAGCTGAGTGTCCCG |
| 18S-Rev | ATTCCTAGCTGCGGTATCCAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peláez, R.; Ochoa, R.; Pariente, A.; Villanueva-Martínez, Á.; Pérez-Sala, Á.; Larráyoz, I.M. Sterculic Acid Alters Adhesion Molecules Expression and Extracellular Matrix Compounds to Regulate Migration of Lung Cancer Cells. Cancers 2021, 13, 4370. https://doi.org/10.3390/cancers13174370
Peláez R, Ochoa R, Pariente A, Villanueva-Martínez Á, Pérez-Sala Á, Larráyoz IM. Sterculic Acid Alters Adhesion Molecules Expression and Extracellular Matrix Compounds to Regulate Migration of Lung Cancer Cells. Cancers. 2021; 13(17):4370. https://doi.org/10.3390/cancers13174370
Chicago/Turabian StylePeláez, Rafael, Rodrigo Ochoa, Ana Pariente, Ángela Villanueva-Martínez, Álvaro Pérez-Sala, and Ignacio M. Larráyoz. 2021. "Sterculic Acid Alters Adhesion Molecules Expression and Extracellular Matrix Compounds to Regulate Migration of Lung Cancer Cells" Cancers 13, no. 17: 4370. https://doi.org/10.3390/cancers13174370
APA StylePeláez, R., Ochoa, R., Pariente, A., Villanueva-Martínez, Á., Pérez-Sala, Á., & Larráyoz, I. M. (2021). Sterculic Acid Alters Adhesion Molecules Expression and Extracellular Matrix Compounds to Regulate Migration of Lung Cancer Cells. Cancers, 13(17), 4370. https://doi.org/10.3390/cancers13174370

