Function of crzA in Fungal Development and Aflatoxin Production in Aspergillus flavus
Abstract
1. Introduction
2. Results and Discussion
2.1. Summary of CrzA in A. flavus
2.2. Roles of CrzA in Asexual Development
2.3. Roles of CrzA in Sclerocia Formation
2.4. Roles of CrzA in Stress Response
2.5. Roles of CrzA in Aflatoxin B1 Production
2.6. Roles of CrzA in Host Colonization
3. Conclusions
4. Materials and Methods
4.1. Fungal Strains and Culture Conditions
4.2. Generation of the CrzA Mutant Strains
4.3. Physiological Studies
4.4. Quantitative Reverse Transcript PCR (qRT-PCR)
4.5. Stress Tests
4.6. Aflatoxin Extraction and Thin-Layer Chromatography Analysis
4.7. Kernel Bioassays
4.8. Microscopy
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Amaike, S.; Keller, N.P. Aspergillus flavus . Annu. Rev. Phytopathol. 2011, 49, 107–133. [Google Scholar] [CrossRef] [PubMed]
- Fountain, J.C.; Scully, B.T.; Ni, X.; Kemerait, R.C.; Lee, R.D.; Chen, Z.Y.; Guo, B. Environmental influences on maize-Aspergillus flavus interactions and aflatoxin production. Front. Microbiol. 2014, 5, 40. [Google Scholar] [CrossRef] [PubMed]
- Hedayati, M.T.; Pasqualotto, A.C.; Warn, P.A.; Bowyer, P.; Denning, D.W. Aspergillus flavus: Human pathogen, allergen and mycotoxin producer. Microbiology 2007, 153, 1677–1692. [Google Scholar] [CrossRef] [PubMed]
- Klich, M.A. Aspergillus flavus: The major producer of aflatoxin. Mol. Plant Pathol. 2007, 8, 713–722. [Google Scholar] [CrossRef] [PubMed]
- Bennett, J.W.; Klich, M. Mycotoxins. Clin. Microbiol. Rev. 2003, 16, 497–516. [Google Scholar] [CrossRef] [PubMed]
- Kensler, T.W.; Roebuck, B.D.; Wogan, G.N.; Groopman, J.D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicol. Sci. 2011, 120, S28–S48. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Mahato, D.K.; Kamle, M.; Mohanta, T.K.; Kang, S.G. Aflatoxins: A Global Concern for Food Safety, Human Health and Their Management. Front. Microbiol. 2016, 7, 2170. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, S.; Manavathu, E.K.; Chandrasekar, P.H. Aspergillus flavus: An emerging non-fumigatus Aspergillus species of significance. Mycoses 2009, 52, 206–222. [Google Scholar] [CrossRef] [PubMed]
- Pasqualotto, A.C. Differences in pathogenicity and clinical syndromes due to Aspergillus fumigatus and Aspergillus flavus. Med. Mycol. 2009, 47, S261–S270. [Google Scholar] [CrossRef] [PubMed]
- Rudramurthy, S.M.; Paul, R.A.; Chakrabarti, A.; Mouton, J.W.; Meis, J.F. Invasive Aspergillosis by Aspergillus flavus: Epidemiology, Diagnosis, Antifungal Resistance, and Management. J. Fungi 2019, 5, 55. [Google Scholar] [CrossRef] [PubMed]
- Horn, B.W.; Moore, G.G.; Carbone, I. Sexual reproduction in Aspergillus flavus. Mycologia 2009, 101, 423–429. [Google Scholar] [CrossRef] [PubMed]
- Krijgsheld, P.; Bleichrodt, R.; van Veluw, G.J.; Wang, F.; Muller, W.H.; Dijksterhuis, J.; Wosten, H.A. Development in Aspergillus. Stud. Mycol. 2013, 74, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Ojeda-Lopez, M.; Chen, W.; Eagle, C.E.; Gutierrez, G.; Jia, W.L.; Swilaiman, S.S.; Huang, Z.; Park, H.S.; Yu, J.H.; Canovas, D.; et al. Evolution of asexual and sexual reproduction in the aspergilli. Stud. Mycol. 2018, 91, 37–59. [Google Scholar] [CrossRef] [PubMed]
- Horn, B.W.; Gell, R.M.; Singh, R.; Sorensen, R.B.; Carbone, I. Sexual Reproduction in Aspergillus flavus Sclerotia: Acquisition of Novel Alleles from Soil Populations and Uniparental Mitochondrial Inheritance. PLoS ONE 2016, 11, e0146169. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, M.; Keller, N.P.; Adams, T.H. Sequence-specific binding by Aspergillus nidulans AflR, a C6 zinc cluster protein regulating mycotoxin biosynthesis. Mol. Microbiol. 1998, 28, 1355–1365. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Yu, J.H. Genetic control of asexual sporulation in filamentous fungi. Curr. Opin. Microbiol. 2012, 15, 669–677. [Google Scholar] [CrossRef]
- Park, H.S.; Lee, M.K.; Han, K.H.; Kim, M.J.; Yu, J.H. Developmental Decisions in Aspergillus nidulans. In Biology of the Fungal Cell, 3rd ed.; Hoffmeister, D., Gressler, M., Eds.; Springer Science & Business Media: Berlin, Germany, 2019; pp. 63–80. [Google Scholar]
- Park, H.S.; Yu, J.H. Molecular Biology of Asexual Sporulation in Filamentous Fungi. In Biochemistry and Molecular Biology. The Mycota (A Comprehensive Treatise on Fungi as Experimental Systems for Basic and Applied Research); Hoffmeister, D., Ed.; Springer: Cham, Germany, 2016. [Google Scholar]
- Juvvadi, P.R.; Lee, S.C.; Heitman, J.; Steinbach, W.J. Calcineurin in fungal virulence and drug resistance: Prospects for harnessing targeted inhibition of calcineurin for an antifungal therapeutic approach. Virulence 2017, 8, 186–197. [Google Scholar] [CrossRef]
- Cyert, M.S. Calcineurin signaling in Saccharomyces cerevisiae: How yeast go crazy in response to stress. Biochem. Biophys. Res. Commun. 2003, 311, 1143–1150. [Google Scholar] [CrossRef]
- Clapham, D.E. Calcium signaling. Cell 2007, 131, 1047–1058. [Google Scholar] [CrossRef]
- Liu, S.; Hou, Y.; Liu, W.; Lu, C.; Wang, W.; Sun, S. Components of the calcium-calcineurin signaling pathway in fungal cells and their potential as antifungal targets. Eukaryot. Cell 2015, 14, 324–334. [Google Scholar] [CrossRef]
- Rusnak, F.; Mertz, P. Calcineurin: Form and function. Physiol. Rev. 2000, 80, 1483–1521. [Google Scholar] [CrossRef] [PubMed]
- Stie, J.; Fox, D. Calcineurin regulation in fungi and beyond. Eukaryot. Cell 2008, 7, 177–186. [Google Scholar] [CrossRef] [PubMed]
- Juvvadi, P.R.; Lamoth, F.; Steinbach, W.J. Calcineurin as a Multifunctional Regulator: Unraveling Novel Functions in Fungal Stress Responses, Hyphal Growth, Drug Resistance, and Pathogenesis. Fungal Biol. Rev. 2014, 28, 56–69. [Google Scholar] [CrossRef] [PubMed]
- Thewes, S. Calcineurin-Crz1 signaling in lower eukaryotes. Eukaryot. Cell 2014, 13, 694–705. [Google Scholar] [CrossRef] [PubMed]
- Stathopoulos, A.M.; Cyert, M.S. Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 1997, 11, 3432–3444. [Google Scholar] [CrossRef] [PubMed]
- Matheos, D.P.; Kingsbury, T.J.; Ahsan, U.S.; Cunningham, K.W. Tcn1p/Crz1p, a calcineurin-dependent transcription factor that differentially regulates gene expression in Saccharomyces cerevisiae. Genes Dev. 1997, 11, 3445–3458. [Google Scholar] [CrossRef] [PubMed]
- Chow, E.W.; Clancey, S.A.; Billmyre, R.B.; Averette, A.F.; Granek, J.A.; Mieczkowski, P.; Cardenas, M.E.; Heitman, J. Elucidation of the calcineurin-Crz1 stress response transcriptional network in the human fungal pathogen Cryptococcus neoformans. PLoS Genet. 2017, 13, e1006667. [Google Scholar] [CrossRef] [PubMed]
- Karababa, M.; Valentino, E.; Pardini, G.; Coste, A.T.; Bille, J.; Sanglard, D. CRZ1, a target of the calcineurin pathway in Candida albicans. Mol. Microbiol. 2006, 59, 1429–1451. [Google Scholar] [CrossRef]
- Santos, M.; de Larrinoa, I.F. Functional characterization of the Candida albicans CRZ1 gene encoding a calcineurin-regulated transcription factor. Curr. Genet. 2005, 48, 88–100. [Google Scholar] [CrossRef]
- Choi, J.; Kim, Y.; Kim, S.; Park, J.; Lee, Y.H. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genet. Biol. 2009, 46, 243–254. [Google Scholar] [CrossRef]
- Schumacher, J.; de Larrinoa, I.F.; Tudzynski, B. Calcineurin-responsive zinc finger transcription factor CRZ1 of Botrytis cinerea is required for growth, development, and full virulence on bean plants. Eukaryot. Cell 2008, 7, 584–601. [Google Scholar] [CrossRef] [PubMed]
- Soriani, F.M.; Malavazi, I.; da Silva Ferreira, M.E.; Savoldi, M.; Von Zeska Kress, M.R.; de Souza Goldman, M.H.; Loss, O.; Bignell, E.; Goldman, G.H. Functional characterization of the Aspergillus fumigatus CRZ1 homologue, CrzA. Mol. Microbiol. 2008, 67, 1274–1291. [Google Scholar] [CrossRef] [PubMed]
- Cramer, R.A., Jr.; Perfect, B.Z.; Pinchai, N.; Park, S.; Perlin, D.S.; Asfaw, Y.G.; Heitman, J.; Perfect, J.R.; Steinbach, W.J. Calcineurin target CrzA regulates conidial germination, hyphal growth, and pathogenesis of Aspergillus fumigatus. Eukaryot. Cell 2008, 7, 1085–1097. [Google Scholar] [CrossRef] [PubMed]
- Hagiwara, D.; Kondo, A.; Fujioka, T.; Abe, K. Functional analysis of C2H2 zinc finger transcription factor CrzA involved in calcium signaling in Aspergillus nidulans. Curr. Genet. 2008, 54, 325–338. [Google Scholar] [CrossRef] [PubMed]
- Spielvogel, A.; Findon, H.; Arst, H.N.; Araujo-Bazan, L.; Hernandez-Ortiz, P.; Stahl, U.; Meyer, V.; Espeso, E.A. Two zinc finger transcription factors, CrzA and SltA, are involved in cation homoeostasis and detoxification in Aspergillus nidulans. Biochem. J. 2008, 414, 419–429. [Google Scholar] [CrossRef] [PubMed]
- Almeida, R.S.; Loss, O.; Colabardini, A.C.; Brown, N.A.; Bignell, E.; Savoldi, M.; Pantano, S.; Goldman, M.H.; Arst, H.N., Jr.; Goldman, G.H. Genetic bypass of Aspergillus nidulans crzA function in calcium homeostasis. G3 Genes Genomes Genet. 2013, 3, 1129–1141. [Google Scholar] [CrossRef]
- Chang, P.K. Aspergillus parasiticus crzA, which encodes calcineurin response zinc-finger protein, is required for aflatoxin production under calcium stress. Int. J. Mol. Sci. 2008, 9, 2027–2043. [Google Scholar] [CrossRef]
- Soriani, F.M.; Malavazi, I.; Savoldi, M.; Espeso, E.; Dinamarco, T.M.; Bernardes, L.A.; Ferreira, M.E.; Goldman, M.H.; Goldman, G.H. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA. BMC Microbiol. 2010, 10, 12. [Google Scholar] [CrossRef]
- de Castro, P.A.; Chen, C.; de Almeida, R.S.; Freitas, F.Z.; Bertolini, M.C.; Morais, E.R.; Brown, N.A.; Ramalho, L.N.; Hagiwara, D.; Mitchell, T.K.; et al. ChIP-seq reveals a role for CrzA in the Aspergillus fumigatus high-osmolarity glycerol response (HOG) signalling pathway. Mol. Microbiol. 2014, 94, 655–674. [Google Scholar] [CrossRef]
- Shwab, E.K.; Juvvadi, P.R.; Waitt, G.; Soderblom, E.J.; Barrington, B.C.; Asfaw, Y.G.; Moseley, M.A.; Steinbach, W.J. Calcineurin-dependent dephosphorylation of the transcription factor CrzA at specific sites controls conidiation, stress tolerance, and virulence of Aspergillus fumigatus. Mol. Microbiol. 2019, 112, 62–80. [Google Scholar] [CrossRef]
- Manoli, M.T.; Espeso, E.A. Modulation of calcineurin activity in Aspergillus nidulans: The roles of high magnesium concentrations and of transcriptional factor CrzA. Mol. Microbiol. 2019, 111, 1283–1301. [Google Scholar] [CrossRef] [PubMed]
- Nierman, W.C.; Yu, J.; Fedorova-Abrams, N.D.; Losada, L.; Cleveland, T.E.; Bhatnagar, D.; Bennett, J.W.; Dean, R.; Payne, G.A. Genome Sequence of Aspergillus flavus NRRL 3357, a Strain That Causes Aflatoxin Contamination of Food and Feed. Genome Announc. 2015, 3. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Rao, A.; Hogan, P.G. Interaction of calcineurin with substrates and targeting proteins. Trends Cell Biol. 2011, 21, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Ortiz, P.; Espeso, E.A. Phospho-regulation and nucleocytoplasmic trafficking of CrzA in response to calcium and alkaline-pH stress in Aspergillus nidulans. Mol. Microbiol. 2013, 89, 532–551. [Google Scholar] [CrossRef] [PubMed]
- Elbein, A.D.; Pan, Y.T.; Pastuszak, I.; Carroll, D. New insights on trehalose: A multifunctional molecule. Glycobiology 2003, 13, 17R–27R. [Google Scholar] [CrossRef] [PubMed]
- Ries, L.N.A.; Rocha, M.C.; de Castro, P.A.; Silva-Rocha, R.; Silva, R.N.; Freitas, F.Z.; de Assis, L.J.; Bertolini, M.C.; Malavazi, I.; Goldman, G.H. The Aspergillus fumigatus CrzA Transcription Factor Activates Chitin Synthase Gene Expression during the Caspofungin Paradoxical Effect. MBio 2017, 8. [Google Scholar] [CrossRef] [PubMed]
- Fiedler, M.R.; Lorenz, A.; Nitsche, B.M.; van den Hondel, C.A.; Ram, A.F.; Meyer, V. The capacity of Aspergillus niger to sense and respond to cell wall stress requires at least three transcription factors: RlmA, MsnA and CrzA. Fungal Biol. Biotechnol. 2014, 1, 5. [Google Scholar] [CrossRef]
- Barratt, R.W.; Johnson, G.B.; Ogata, W.N. Wild-type and mutant stocks of Aspergillus nidulans. Genetics 1965, 52, 233–246. [Google Scholar]
- He, Z.M.; Price, M.S.; Obrian, G.R.; Georgianna, D.R.; Payne, G.A. Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus. BMC Microbiol. 2007, 7, 104. [Google Scholar] [CrossRef]
- Yu, J.H.; Hamari, Z.; Han, K.H.; Seo, J.A.; Reyes-Dominguez, Y.; Scazzocchio, C. Double-joint PCR: A PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet. Biol. 2004, 41, 973–981. [Google Scholar] [CrossRef]
- Lee, M.K.; Kwon, N.J.; Lee, I.S.; Jung, S.; Kim, S.C.; Yu, J.H. Negative regulation and developmental competence in Aspergillus. Sci. Rep. 2016, 6, 28874. [Google Scholar] [CrossRef] [PubMed]
- Park, H.S.; Ni, M.; Jeong, K.C.; Kim, Y.H.; Yu, J.H. The role, interaction and regulation of the velvet regulator VelB in Aspergillus nidulans. PLoS ONE 2012, 7, e45935. [Google Scholar] [CrossRef]
- Park, H.S.; Yu, J.H. Multi-copy genetic screen in Aspergillus nidulans. Methods Mol. Biol. 2012, 944, 183–190. [Google Scholar] [CrossRef] [PubMed]
- Eom, T.J.; Moon, H.; Yu, J.H.; Park, H.S. Characterization of the velvet regulators in Aspergillus flavus. J. Microbiol. 2018, 56, 893–901. [Google Scholar] [CrossRef] [PubMed]
- Christensen, S.; Borrego, E.; Shim, W.B.; Isakeit, T.; Kolomiets, M. Quantification of fungal colonization, sporogenesis, and production of mycotoxins using kernel bioassays. J. Vis. Exp. 2012. [Google Scholar] [CrossRef] [PubMed]







| Strain Name | Relevant Genotype | References |
|---|---|---|
| NRRL3357 | A. flavus wild type | FGSC 1 |
| NRRL3357.5 | pyrG- | (He et al. 2007) |
| TTJ6.1 | pyrG-; ΔpyrG::AfupyrG+ | This study |
| TDH1.1-3 | pyrG-; ΔcrzA::AfupyrG | This study |
| TTJ9.1-2 | pyrG-; ΔcrzA::AfupyrG; crzA(p)::crzA::FLAG4x::ptrA | This study |
| Name | Sequence (5′ → 3′) a | Purpose |
|---|---|---|
| OHS089 | GCTGAAGTCATGATACAGGCCAAA | AfupyrG Maker_F |
| OHS090 | ATCGTCGGGAGGTATTGTCGTCAC | AfupyrG Maker_R |
| OHS357 | GTTGTCGTCAGGCACCGTCA | 5′ flanking region of crzA |
| OHS358 | GGCTTTGGCCTGTATCATGACTTCA GATACCACGCGAAGCAAGGC | crzA with AfupyrG tail R |
| OHS359 | TTTGGTGACGACAATACCTCCCGAC AGGGTGGAAACCAGATGGCG | crzA with AfupyrG tail F |
| OHS360 | CACCCATTGGTGTTGCGCTC | 3′ flanking region of crzA |
| OHS361 | GGGACGCGGTAGATTGTGCT | crzA nested 5′ NF |
| OHS362 | TCGCACGCTTCCTTCAGGAG | crzA nested 5′ NR |
| OHS367 | AATT GCGGCCGC GGGTTGGGATCCACCGCTTA | 5′ crzA with pro and NotI |
| OHS368 | AATT GCGGCCGC GGCATACCCCGAGTCCCCA | 3′ crzA with NotI |
| OHS407 | GATATGTCGCCACACTGGAC | AflbrlA F_RT |
| OHS408 | CTGTATTCGCGGCTATTCGG | AflbrlA R_RT |
| OHS409 | CTTCCGCACCTTAACAGCAG | AflabaA F_RT |
| OHS410 | GTTTGCCGGAATTGCCAAAG | AflabaA R_RT |
| OHS411 | CCGTCAGATATCCTGCCACA | AflwetA F_RT |
| OHS412 | ATGGATATCGCGGGAGATGG | AflwetA R_RT |
| OHS405 | TATGTCGGTGATGAGGCACA | Aflactin F_RT |
| OHS406 | AACACGGAGCTCGTTGTAGA | Aflactin R_RT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, S.-Y.; Son, Y.-E.; Lee, D.-H.; Eom, T.-J.; Kim, M.-J.; Park, H.-S. Function of crzA in Fungal Development and Aflatoxin Production in Aspergillus flavus. Toxins 2019, 11, 567. https://doi.org/10.3390/toxins11100567
Lim S-Y, Son Y-E, Lee D-H, Eom T-J, Kim M-J, Park H-S. Function of crzA in Fungal Development and Aflatoxin Production in Aspergillus flavus. Toxins. 2019; 11(10):567. https://doi.org/10.3390/toxins11100567
Chicago/Turabian StyleLim, Su-Yeon, Ye-Eun Son, Dong-Hyun Lee, Tae-Jin Eom, Min-Ju Kim, and Hee-Soo Park. 2019. "Function of crzA in Fungal Development and Aflatoxin Production in Aspergillus flavus" Toxins 11, no. 10: 567. https://doi.org/10.3390/toxins11100567
APA StyleLim, S.-Y., Son, Y.-E., Lee, D.-H., Eom, T.-J., Kim, M.-J., & Park, H.-S. (2019). Function of crzA in Fungal Development and Aflatoxin Production in Aspergillus flavus. Toxins, 11(10), 567. https://doi.org/10.3390/toxins11100567
