The Cyanotoxin BMAA Induces Heterocyst Specific Gene Expression in Anabaena sp. PCC 7120 under Repressive Conditions
Abstract
:1. Introduction
2. Results and Discussion
2.1. β-N-Methylamino-l-Alanine (BMAA) Induces Formation of Non-Functional Heterocyst-Like Cells in Anabaena 7120 in Nitrogen-Replete Conditions
2.2. Comparison of BMMA and Other Non-Proteinogenic Amino Acids Effects on Heterocyst Derepression
2.3. BMAA Induces Heterocyst-Specific Gene Expression in Anabaena 7120 under Repressive Conditions
2.4. BMAA Induces glnA and gltS Gene Expression in Anabaena 7120 under Repressive Conditions
3. Conclusions
4. Materials and Methods
4.1. Cyanobacterial Strain and Cultivation Conditions
4.2. Chlorophyll A Measurements
4.3. Nitrogenase Activity Measurements
4.4. Fluorescence Microscopy
4.5. RNA Extraction and Reverse Transcription Quantitative PCR (RT-qPCR)
4.6. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Cox, P.A.; Banack, S.A.; Murch, S.J.; Rasmussen, U.; Tien, G.; Bidigare, R.R.; Metcalf, J.S.; Morrison, L.F.; Codd, G.A.; Bergman, B. Diverse taxa of cyanobacteria produce beta-N-methylamino-l-alanine, a neurotoxic amino acid. Proc. Natl. Acad. Sci. USA 2005, 102, 5074–5078. [Google Scholar] [CrossRef] [PubMed]
- Banack, S.A.; Johnson, H.E.; Cheng, R.; Cox, P.A. Production of the neurotoxin BMAA by a marine cyanobacterium. Mar. Drugs 2007, 5, 180–196. [Google Scholar] [CrossRef] [PubMed]
- Esterhuizen, M.; Downing, T.G. β-N-methylamino-l-alanine (BMAA) in novel South African cyanobacterial isolates. Ecotoxicol. Environ. Saf. 2008, 71, 309–313. [Google Scholar] [CrossRef] [PubMed]
- Metcalf, J.S.; Banack, S.A.; Lindsay, J.; Morrison, L.F.; Cox, P.A.; Codd, G.A. Co-occurrence of β-N-methylamino-l-alanine, a neurotoxic amino acid with other cyanobacterial toxins in British waterbodies, 1990–2004. Environ. Microbiol. 2008, 10, 702–708. [Google Scholar] [CrossRef] [PubMed]
- Spácil, Z.; Eriksson, J.; Jonasson, S.; Rasmussen, U.; Ilag, L.L.; Bergman, B. Analytical protocol for identification of BMAA and DAB in biological samples. Analyst 2009, 135, 127–132. [Google Scholar] [CrossRef] [PubMed]
- Cox, P.A.; Banack, S.A.; Murch, S.J. Biomagnification of cyanobacterial neurotoxins and neurodegenerative disease among the Chamorro people of Guam. Proc. Natl. Acad. Sci. USA 2003, 100, 13380–13383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murch, S.J.; Cox, P.A.; Banack, S.A.; Steele, J.C.; Sacks, O.W. Occurrence of β-methylamino-l-alanine (BMAA) in ALS/PDC patients from Guam. Acta Neurol. Scand. 2004, 110, 267–269. [Google Scholar] [CrossRef] [PubMed]
- Berntzon, L.; Ronnevi, L.-O.; Bergman, B.; Eriksson, J. Detection of BMAA in the human central nervous system. Neuroscience 2015, 292, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Jonasson, S.; Eriksson, J.; Berntzon, L.; Spácil, Z.; Ilag, L.L.; Ronnevi, L.O.; Rasmussen, U.; Bergman, B. Transfer of a cyanobacterial neurotoxin within a temperate aquatic ecosystem suggests pathways for human exposure. Proc. Natl. Acad. Sci. USA 2010, 107, 9252–9257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, L.; Eriksson, J.; Lage, S.; Jonasson, S.; Shams, S.; Mehine, M.; Ilag, L.L.; Rasmussen, U. Diatoms: A novel source for the neurotoxin BMAA in aquatic environments. PLoS ONE 2014, 9, e84578. [Google Scholar] [CrossRef] [PubMed]
- Lage, S.; Costa, P.R.; Moita, T.; Eriksson, J.; Rasmussen, U.; Rydberg, S.J. BMAA in shellfish from two Portuguese transitional water bodies suggests the marine dinoflagellate Gymnodinium catenatum as a potential BMAA source. Aquat. Toxicol. 2014, 152, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Scott, L.L.; Downing, S.; Phelan, R.R.; Downing, T.G. Environmental modulation of microcystin and β-N-methylamino-l-alanine as a function of nitrogen availability. Toxicon 2014, 87, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Pablo, J.; Banack, S.A.; Cox, P.A.; Johnson, T.E.; Papapetropoulos, S.; Bradley, W.G.; Buck, A.; Mash, D.C. Cyanobacterial neurotoxin BMAA in ALS and Alzheimer’s disease. Acta Neurol. Scand. 2009, 120, 216–225. [Google Scholar] [CrossRef] [PubMed]
- Popova, A.A.; Koksharova, O.A. Neurotoxic non-proteinogenic amino acid β-N-methylamino-l-alanine and its role in biological systems. Biochemistry 2016, 81, 794–805. [Google Scholar] [CrossRef] [PubMed]
- Nunn, P.B.; Codd, G.A. Metabolic solutions to the biosynthesis of some diaminomonocarboxylic acids in nature: Formation in cyanobacteria of the neurotoxins 3-N-methyl-2,3-diaminopropanoic acid (BMAA) and 2,4-diaminobutanoic acid (2,4-DAB). Phytochemistry 2017, 144, 253–270. [Google Scholar] [CrossRef] [PubMed]
- Downing, S.; Banack, S.A.; Metcalf, J.S.; Cox, P.A.; Downing, T.G. Nitrogen starvation of cyanobacteria results in the production of β-N-methylamino-l-alanine. Toxicon 2011, 58, 187–194. [Google Scholar] [CrossRef] [PubMed]
- Downing, T.G.; Phelan, R.R.; Downing, S. A potential physiological role for cyanotoxins in cyanobacteria of arid environments. J. Arid Environ. 2015, 112, 147–151. [Google Scholar] [CrossRef]
- Berntzon, L.; Erasmie, S.; Celepli, N.; Eriksson, J.; Rasmussen, U.; Bergman, B. BMAA inhibits nitrogen fixation in the cyanobacterium Nostoc sp. PCC 7120. Mar. Drugs 2013, 11, 3091–3108. [Google Scholar] [CrossRef] [PubMed]
- Popova, A.A.; Rasmussen, U.; Semashko, T.A.; Govorun, V.M.; Koksharova, O.A. Stress effects of cyanotoxin β-methylamino-L-alanine (BMAA) on cyanobacterial heterocyst formation and functionality. Environ. Microbiol. Rep. 2018, 10, 369–377. [Google Scholar] [CrossRef] [PubMed]
- Flores, E.; Picossi, S.; Valladares, A.; Herrero, A. Transcriptional regulation of development in heterocyst-forming cyanobacteria. Biochim. Biophys. Acta 2018. [Google Scholar] [CrossRef] [PubMed]
- Thomas, J. Absence of the pigments of photosystem II of photosynthesis in heterocysts of a blue-green alga. Nature 1970, 228, 181–183. [Google Scholar] [CrossRef] [PubMed]
- Ferimazova, N.; Felcmanová, K.; Šetlíková, E.; Küpper, H.; Maldener, I.; Hauska, G.; Šedivá, B.; Práš, O. Regulation of photosynthesis during heterocyst differentiation in Anabaena sp. strain PCC 7120 investigated in vivo at single-cell level by chlorophyll fluorescence kinetic microscopy. Photosynth. Res. 2013, 116, 79–91. [Google Scholar] [PubMed]
- Nozue, S.; Mukuno, A.; Tsuda, Y.; Shiina, T.; Terazima, M.; Kumazaki, S. Characterization of thylakoid membrane in a heterocystous cyanobacterium and green alga with dual-detector fluorescence lifetime imaging microscopy with a systematic change of incident laser power. Biochim. Biophys. Acta 2016, 1857, 46–59. [Google Scholar] [CrossRef] [PubMed]
- Kumar, K.; Mella-Herrera, R.A.; Golden, J.W. Cyanobacterial heterocysts. Cold Spring Harb. Perspect. Biol. 2010, 2, A000315. [Google Scholar] [CrossRef] [PubMed]
- Weiss, J.H.; Choi, D.W. β-N-methylamino-l-alanine neurotoxicity: Requirement for bicarbonate as a cofactor. Science 1988, 241, 973–975. [Google Scholar] [CrossRef] [PubMed]
- Capone, D.G.; Montoya, J.P. Nitrogen Fixation and Denitrification. In Marine Microbiology; Paul, J.H., Ed.; Academic Press: London, UK, 2001; pp. 501–515. [Google Scholar]
- Stacey, G.; Van Baalen, C.; Tabita, F.R. Isolation and characterization of a marine Anabaena sp. capable of rapid growth on molecular nitrogen. Arch. Microbiol. 1977, 114, 197–201. [Google Scholar] [CrossRef]
- Rogerson, A.C. Modifiers of heterocyst repression and spacing and formation of heterocysts without nitrogenase in the cyanobacterium Anabaena variabilis. J. Bacteriol. 1979, 140, 213–219. [Google Scholar] [PubMed]
- Chen, C.H.; Van Baalen, C.; Tabita, F.R. Nitrogen starvation mediated by DL-7-azatryptophan in the cyanobacterium Anabaena sp. strain CA. J. Bacteriol. 1987, 169, 1107–1113. [Google Scholar] [CrossRef] [PubMed]
- Mishra, A.K. MSX-resistant mutants of Anabaena 7120 with derepressed heterocyst development and nitrogen fixation. World J. Microbial. Biotechnol. 2003, 19, 675–680. [Google Scholar] [CrossRef]
- Zhang, C.C.; Laurent, S.; Sakr, S.; Peng, L.; Bédu, S. Heterocyst differentiation and pattern formation in cyanobacteria: A chorus of signals. Mol. Microbiol. 2006, 59, 367–375. [Google Scholar] [CrossRef] [PubMed]
- Muro-Pastor, A.M.; Hess, W.R. Heterocyst differentiation: From single mutants to global approaches. Trends Microbiol. 2012, 20, 548–557. [Google Scholar] [CrossRef] [PubMed]
- Sarma, T.A. Handbook of Cyanobacteria; CRC Press: Boca Raton, FL, USA, 2012. [Google Scholar]
- Videau, P.; Ni, S.; Rivers, O.S.; Ushijima, B.; Feldmann, E.A.; Cozy, L.M.; Kennedy, M.A.; Callahan, S.M. Expanding the direct HetR regulon in Anabaena sp. strain PCC 7120. J. Bacteriol. 2014, 196, 1113–1121. [Google Scholar] [CrossRef] [PubMed]
- Buikema, W.J.; Haselkorn, R. Characterization of a gene controlling heterocyst differentiation in the cyanobacterium Anabaena 7120. Genes Dev. 1991, 5, 321–330. [Google Scholar] [CrossRef] [PubMed]
- Black, T.A.; Cai, Y.; Wolk, C.P. Spatial expression and autoregulation of hetR, a gene involved in the control of heterocyst development in Anabaena. Mol. Microbiol. 1993, 9, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Golden, J.W.; Whorff, L.L.; Wiest, D.R. Independent regulation of nifHDK operon transcription and DNA rearrangement during heterocyst differentiation in the cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 1991, 173, 7098–7105. [Google Scholar] [CrossRef] [PubMed]
- Herrero, A.; Muro-Pastor, A.M.; Valladares, A.; Flores, E. Cellular differentiation and the NtcA transcription factor in filamentous cyanobacteria. FEMS Microbiol. Rev. 2004, 28, 469–487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tumer, N.E.; Robinson, S.J.; Haselkorn, R. Different promoters for the Anabaena glutamine synthetase gene during growth using molecular or fixed nitrogen. Nature 1983, 306, 337–342. [Google Scholar] [CrossRef]
- Frías, J.E.; Flores, E.; Herrero, A. Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 1994, 14, 823–832. [Google Scholar] [CrossRef] [PubMed]
- Thiel, T. Nitrogen fixation in heterocyst-forming cyanobacteria. In Genetics and Regulation of Nitrogen Fixation in Free-Living Bacteria; Klipp, W., Masepohl, B., Gallon, J.R., Newton, W.E., Eds.; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2005; pp. 73–111. [Google Scholar]
- Luque, I.; Flores, E.; Herrero, A. Nitrite reductase gene from Synechococcus sp. PCC 7942: Homology between cyanobacterial and higher-plant nitrite reductases. Plant Mol. Biol. 1993, 21, 1201–1205. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Wolk, C.P. Nitrogen deprivation of Anabaena sp. strain PCC 7120 elicits rapid activation of a gene cluster that is essential for uptake and utilization of nitrate. J. Bacteriol. 1997, 179, 258–266. [Google Scholar] [CrossRef] [PubMed]
- Rubio, L.M.; Herrero, A.; Flores, E. A cyanobacterial narB gene encodes a ferredoxin-dependent nitrate reductase. Plant Mol. Biol. 1996, 4, 845–850. [Google Scholar] [CrossRef]
- Li, J.-H.; Laurent, S.; Konde, V.; Bedu, S.; Zhang, C.C. An increase in the level of 2-oxoglutarate promotes heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120. Microbiology 2003, 149, 3257–3263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muro-Pastor, M.I.; Reyes, J.C.; Florencio, F.J. Ammonium assimilation in cyanobacteria. Photosynth. Res. 2005, 83, 135–150. [Google Scholar] [CrossRef] [PubMed]
- Brownson, D.M.; Mabry, T.J.; Leslie, S.W. The cycad neurotoxic amino acid, β-N-methylamino-l-alanine (BMAA), elevates intracellular calcium levels in dissociated rat brain cells. J. Ethnopharmacol. 2002, 82, 159–167. [Google Scholar] [CrossRef]
- Lage, S.; Ström, L.; Godhe, A.; Rydberg, S. The effect of exogenous β-N-methylamino-l-alanine (BMAA) on the diatoms Phaeodactylum tricornutum and Thalassiosira weissflogii. Harmful Algae 2016, 58, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Wei, T.F.; Ramasubramanian, T.S.; Golden, J.W. Anabaena sp. strain PCC 7120 ntcA gene required for growth on nitrate and heterocyst development. J. Bacteriol. 1994, 176, 4473–4482. [Google Scholar] [CrossRef] [PubMed]
- Nunn, P.B.; Ponnusamy, M. β-N-methylaminoalanine (BMAA): Metabolism and metabolic effects in model systems and in neural and other tissues of the rat in vitro. Toxicon 2009, 54, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Engskog, M.K.R.; Ersson, L.; Haglöf, J.; Arvidsson, T.; Pettersson, C.; Brittebo, E. β-N-Methylaminol-l-alanine (BMAA) perturbs alanine, aspartate and glutamate metabolism pathways in human neuroblastoma cells as determined by metabolic profiling. Amino Acids 2017, 49, 905–919. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, C.S. Structural, dynamic and energetic differences among biotic communities dominated by macrophytes, planktonic algae and cyanobacteria. Water Sci. Technol. 1995, 32, 1–23. [Google Scholar] [CrossRef]
- Horn, H.; Uhlmann, D. Competitive growth of blue-greens and diatoms (Fragilaria) in the Saidenbach Reservoir, Saxony. Water Sci. Technol. 1995, 32, 77–88. [Google Scholar] [CrossRef]
- Watermann, F.; Hillebrand, H.; Gerdes, G.; Krumbein, W.E.; Sommer, U. Competition between benthic cyanobacteria and diatoms as influenced by different grain sizes and temperatures. Mar. Ecol. Prog. Ser. 1999, 187, 77–87. [Google Scholar] [CrossRef] [Green Version]
- Van der Grinten, E.; Simis, S.G.H.; Barranguet, C.; Admiraal, W. Dominance of diatoms over cyanobacterial species in nitrogen-limited biofilms. Arch. Hydrobiol. 2004, 161, 99–112. [Google Scholar] [CrossRef]
- Bruckner, C.G.; Rehm, C.; Grossart, H.P.; Kroth, P.G. Growth and release of extracellular organic compounds by benthic diatoms depend on interactions with bacteria. Environ. Microbiol. 2011, 13, 1052–1063. [Google Scholar] [CrossRef] [PubMed]
- Amin, S.A.; Parker, M.S.; Armbrust, E.V. Interactions between Diatoms and Bacteria. Microbiol. Mol. Biol. Rev. 2012, 76, 667–684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pflugmacher, S. Possible allelopathic effects of cyanotoxins, with reference to microcystin-LR, in aquatic ecosystems. Environ. Toxicol. 2002, 17, 407–413. [Google Scholar] [CrossRef] [PubMed]
- Jang, M.H.; Ha, K.; Joo, G.-J.; Takamura, N. Toxin production ofcyanobacteria is increased by exposure to zooplankton. Freshw. Biol. 2003, 48, 1540–1550. [Google Scholar] [CrossRef]
- Jang, M.H.; Ha, K.; Takamura, N. Reciprocal allelopathic responses between toxic cyanobacteria (Microcystis aeruginosa) and duckweed (Lemna japonica). Toxicon 2007, 49, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Jang, M.H.; Jung, J.M.; Takamura, N. Changes in microcystin production in cyanobacteria exposed to zooplankton at different population densities and infochemical concentrations. Limnol. Oceanogr. 2007, 52, 1454–1466. [Google Scholar] [CrossRef] [Green Version]
- Jang, M.H.; Ha, K.; Takamura, N. Microcystin production by Microcystis aeruginosa exposed to different stages of herbivorous zooplankton. Toxicon 2008, 51, 882–889. [Google Scholar] [CrossRef] [PubMed]
- Ha, K.; Takamura, N.; Jang, M.H. Microcystin Production by Microcystis aeruginosa Exposed to Phytoplanktivorous and Omnivorous Fish at Different Kairomone Concentrations. Bull. Environ. Contam. Toxicol. 2009, 83, 761–765. [Google Scholar] [CrossRef] [PubMed]
- Rippka, R.; Deruelles, J.; Waterbury, J.B.; Herdman, M.; Stanier, R.Y. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 1979, 111, 1–61. [Google Scholar] [CrossRef]
- Talling, J.F.; Driver, D. Some problems in the estimation of chlorophyll-a in phytoplankton, in primary productivity measurement, marine and freshwater. In U.S. Atomic Energy Commision Report No. TID-7633; Doty, M.S., Ed.; U.S. Atomic Energy Commision: Honolulu, HI, USA, 1961; pp. 142–146. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Pinto, F.; Pacheco, C.C.; Ferreira, D.; Moradas-Ferreira, P.; Tamagnini, P. Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria. PLoS ONE 2012, e34983. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. 1995, 57, 289–300. [Google Scholar]
Growth Condition | 1 Frequency of Heterocyst or Heterocyst-Like Cells, 1 % | 2 Nitrogenase Activity, 2 nmol (Eth)/μg(Chl) h | |
---|---|---|---|
1 | BG11N | 0.0 | 0.0 |
2 | BG11N, 20 μM BMAA | 3.73 ± 1.73 | 0.0 |
3 | BG110 | 5.14 ± 1.28 | 22.4 ± 3.84 |
Gene | Product | Relative Ratio in log2 | |||||
---|---|---|---|---|---|---|---|
4 h | 8 h | 24 h | 48 h | 96 h | |||
hetR | HetR, Heterocyst differentiation protein | Control | −2.33 ± 0.02 | 0.64 ± 0.23 | −1.03 ± 0.19 | 0.09 ± 0.07 | 0.15 ± 0.06 |
BMAA | −2.26 ± 0.32 | 0.45 ± 0.41 | −1.29 ± 0.22 | 3.35 ± 0.38 | 0.36 ± 0.22 | ||
hepA | HepA, Heterocyst differentiation protein | Control | −0.53 ± 0.06 | 0.66 ± 0.21 | −0.06 ± 0.13 | 0.09 ± 0.07 | 0.15 ± 0.06 |
BMAA | 1.35 ± 0.05 | 3.87 ± 0.36 | 1.83 ± 0.23 | 3.35 ± 0.38 | 0.36 ± 0.22 | ||
ntcA | NtcA, Nitrogen-responsive regulatory protein | Control | −2.01 ± 0.01 | 2.50 ± 0.60 | −1.35 ± 0.11 | −0.12 ± 0.09 | −0.65 ± 0.27 |
BMAA | −1.36 ± 0.67 | 2.30 ± 0.35 | −0.53 ± 0.10 | 1.31 ± 0.27 | 0.88 ± 0.22 | ||
nifH | Nitrogenase subunit | Control | −0.39 ± 0.07 | 1.37 ± 0.63 | 1.47 ± 0.68 | 0.30 ± 0.50 | 3.18 ± 2.82 |
BMAA | 0.50 ± 0.08 | 3.44 ± 0.11 | 2.62 ± 0.07 | 6.57 ± 1.43 | 4.82 ± 0.58 | ||
glnA | Glutamine synthetase | Control | 1.51 ± 0.56 | −0.56 ± 0.05 | 2.22 ± 0.95 | 0.19 ± 0.16 | −2.60 ± 0.17 |
BMAA | 1.80 ± 0.04 | −0.67 ± 0.99 | 2.17 ± 0.67 | 2.70 ± 0.15 | 1.02 ± 0.11 | ||
gltS | Glutamine-oxoglutarate-aminotransferase | Control | −1.66 ± 0.58 | 1.23 ± 0.15 | −1.14 ± 0.40 | −0.24 ± 0.03 | 0.65 ± 0.17 |
BMAA | −1.95 ± 0.39 | 0.67 ± 0.28 | −0.13 ± 0.01 | 2.17 ± 0.16 | 2.17 ± 0.12 | ||
nirA | Nitrite reductase | Control | −0.65 ± 0.16 | 1.40 ± 0.16 | −0.67 ± 0.26 | −1.51 ± 0.16 | −4.54 ± 0.07 |
BMAA | −1.10 ± 0.28 | 1.63 ± 0.19 | −0.90 ± 0.26 | −1.18 ± 0.18 | −2.87 ± 0.15 |
Primer | Sequence (5′→3′) | Reference |
---|---|---|
nifH-F | CTATGCCTATCCGTGAAGG | [19] |
nifH-R | CCAAGTTCATGATTAACTCGTC | [19] |
hetR-F | AGTTACCCAGCAATCTTCCC | [19] |
hetR-R | ATAGAAGGGCATTCCCCAAG | [19] |
ntcA-F | GAGCTTTTCCTCCTGTTGTC | [19] |
ntcA-R | ACCTATCCGACTTGTTTCCT | [19] |
glnA-F | GGTGATACAGCCTTCTTTGG | [19] |
glnA-R | CTTGGAAAGAATCTGTGGGG | [19] |
nirA-F | CCAACAAAGGAGAAGGCAAT | [19] |
nirA-R | AGAAACCACCAACTAACACG | [19] |
hepA-F | TTCGGGTGAACTCATTAATACG | [19] |
hepA-R | TTCTCTGACTCGCTTATTCAG | [19] |
gltS-F | TAGAACATCGGGGTGGTTGT | [19] |
gltS-R | CTACTCGCCAGCCCAATAC | [19] |
rnpB-F | ACTGATTTGAGGAAAGTCCG | [67] |
rnpB-R | CTTTGCACCCTTACCAAGAG | [67] |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Popova, A.A.; Semashko, T.A.; Kostina, N.V.; Rasmussen, U.; Govorun, V.M.; Koksharova, O.A. The Cyanotoxin BMAA Induces Heterocyst Specific Gene Expression in Anabaena sp. PCC 7120 under Repressive Conditions. Toxins 2018, 10, 478. https://doi.org/10.3390/toxins10110478
Popova AA, Semashko TA, Kostina NV, Rasmussen U, Govorun VM, Koksharova OA. The Cyanotoxin BMAA Induces Heterocyst Specific Gene Expression in Anabaena sp. PCC 7120 under Repressive Conditions. Toxins. 2018; 10(11):478. https://doi.org/10.3390/toxins10110478
Chicago/Turabian StylePopova, Alexandra A., Tatiana A. Semashko, Natalia V. Kostina, Ulla Rasmussen, Vadim M. Govorun, and Olga A. Koksharova. 2018. "The Cyanotoxin BMAA Induces Heterocyst Specific Gene Expression in Anabaena sp. PCC 7120 under Repressive Conditions" Toxins 10, no. 11: 478. https://doi.org/10.3390/toxins10110478