Omega-3 Fatty Acids Weaken Lymphocyte Inflammatory Features and Improve Glycemic Control in Nonobese Diabetic Goto-Kakizaki Rats
Abstract
Highlights
- Fish oil supplementation reduces insulin resistance in nonobese type 2 diabetes model.
- Fish oil supplementation increased the lymphocyte polarization towards T regulatory profile instead Th1 and Th17 profiles.
- Fish oil immunomodulatory effects indicate a potential effect of omega-3 to reduce inflammatory response in lean type 2 diabetic patients.
- Anti-inflammatory effects of fish oil can contribute for the increased insulin response in nonobese type 2 diabetic individuals.
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatment
2.2. Body Weight, Calculation of the Lee Index, and Caloric Intake
2.3. Glucose Tolerance Test (GTT)
2.4. Insulin Tolerance Test (ITT)
2.5. Determination of Blood Serum Parameters
2.6. Isolation of Lymphocytes
2.7. Lymphocytes Culture
2.8. Cell Proliferation Assay
2.9. RT-PCR
2.10. Lymphocyte Profile Evaluation by Flow Cytometry
2.11. Expression of CD28 on Lymphocyte Membrane
2.12. Glucose Uptake
2.13. Measurement of Cytokine Concentrations in the Lymphocyte Culture Supernatant
2.14. Statistical Analysis
3. Results
3.1. Body Weight, Lee Index, Caloric Intake, GTT, and ITT
3.2. Lymphocyte Inflammatory Features
- Th1 lymphocytes: The percentage of CD4+TNF-α+ cells in the GK CT group was higher compared to the WT CT and GK ω-3 groups. However, the GK ω-3 group exhibited a lower proportion of Th1 cells than the WT ω-3 group (Figure 5A). Additionally, the mean fluorescence intensity vital for the intracellular detection of TNF-α was higher in the GK CT group compared to the WT CT and GK ω-3 groups (Figure 5B).
- Th2 lymphocytes: There were no remarkable variations in the percentage of CD4+ IL-4+ cells or the mean fluorescence intensity related to IL-4 (Figure 5C,D).
- Th17 lymphocytes: The proportion of CD4+ ROR-γ+ cells was enhanced in the GK CT group compared to the WT CT and GK ω-3 groups. However, the WT ω-3 group had a lower percentage compared to the WT CT, while the GK ω-3 group had a higher percentage compared to the WT ω-3 group (Figure 5E). The mean fluorescence intensity for ROR-γ was also elevated in the GK CT group compared to the WT CT and GK ω-3 groups (Figure 5F).
- Treg lymphocytes: A lower percentage of CD4+ FOXP-3+ cells was observed in the GK CT group compared to the WT CT and GK ω-3 groups (Figure 5G). However, their proportion was enhanced in the WT ω-3 group compared to the WT CT group. In terms of mean fluorescence intensity for FOXP-3, the GK ω-3 group demonstrated a higher value compared to the GK CT group (Figure 5H).
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bennouar, S.; Bachir Cherif, A.; Aoudia, Y.; Abdi, S. Additive Interaction Between Insulin Resistance, Chronic Low-Grade Inflammation and Vitamin D Deficiency on the Risk of Type 2 Diabetes Mellitus: A Cohort Study. J. Am. Nutr. Assoc. 2024, 43, 571–581. [Google Scholar] [CrossRef] [PubMed]
- Antoniades, C.; Antonopoulos, A.S.; Tousoulis, D.; Stefanadis, C. Adiponectin: From Obesity to Cardiovascular Disease. Obes. Rev. Off. J. Int. Assoc. Study Obes. 2009, 10, 269–279. [Google Scholar] [CrossRef] [PubMed]
- Calder, P.C.; Albers, R.; Antoine, J.-M.; Blum, S.; Bourdet-Sicard, R.; Ferns, G.A.; Folkerts, G.; Friedmann, P.S.; Frost, G.S.; Guarner, F.; et al. Inflammatory Disease Processes and Interactions with Nutrition. Br. J. Nutr. 2009, 101 (Suppl. 1), S1–S45. [Google Scholar] [CrossRef] [PubMed]
- Ding, Q.; Gao, Z.; Chen, K.; Zhang, Q.; Hu, S.; Zhao, L. Inflammation-Related Epigenetic Modification: The Bridge Between Immune and Metabolism in Type 2 Diabetes. Front. Immunol. 2022, 13, 883410. [Google Scholar] [CrossRef]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef]
- Ruze, R.; Liu, T.; Zou, X.; Song, J.; Chen, Y.; Xu, R.; Yin, X.; Xu, Q. Obesity and Type 2 Diabetes Mellitus: Connections in Epidemiology, Pathogenesis, and Treatments. Front. Endocrinol. 2023, 14, 1161521. [Google Scholar] [CrossRef]
- Shoelson, S.E.; Herrero, L.; Naaz, A. Obesity, Inflammation, and Insulin Resistance. Gastroenterology 2007, 132, 2169–2180. [Google Scholar] [CrossRef]
- Zhang, J.-M.; An, J. Cytokines, Inflammation and Pain. Int. Anesthesiol. Clin. 2007, 45, 27–37. [Google Scholar] [CrossRef]
- de Almeida Silveira, A.S.; dos Anjos Alves, A.C.; Gimenes, G.M.; da Silva Quessada, P.; Lobato, T.B.; Dias, B.B.; Pereira, A.C.G.; Iser-Bem, P.N.; Pereira, J.N.B.; Hatanaka, E.; et al. Evidence for a Pro-Inflammatory State of Macrophages from Non-Obese Type-2 Diabetic Goto-Kakizaki Rats. Int. J. Mol. Sci. 2024, 25, 10240. [Google Scholar] [CrossRef]
- McLaughlin, T.; Liu, L.-F.; Lamendola, C.; Shen, L.; Morton, J.; Rivas, H.; Winer, D.; Tolentino, L.; Choi, O.; Zhang, H.; et al. T-Cell Profile in Adipose Tissue Is Associated with Insulin Resistance and Systemic Inflammation in Humans. Arterioscler. Thromb. Vasc. Biol. 2014, 34, 2637–2643. [Google Scholar] [CrossRef]
- Nishimura, S.; Manabe, I.; Nagasaki, M.; Eto, K.; Yamashita, H.; Ohsugi, M.; Otsu, M.; Hara, K.; Ueki, K.; Sugiura, S.; et al. CD8+ Effector T Cells Contribute to Macrophage Recruitment and Adipose Tissue Inflammation in Obesity. Nat. Med. 2009, 15, 914–920. [Google Scholar] [CrossRef] [PubMed]
- Feuerer, M.; Herrero, L.; Cipolletta, D.; Naaz, A.; Wong, J.; Nayer, A.; Lee, J.; Goldfine, A.; Benoist, C.; Shoelson, S.; et al. Fat Treg Cells: A Liaison between the Immune and Metabolic Systems. Nat. Med. 2009, 15, 930–939. [Google Scholar] [CrossRef] [PubMed]
- Zeyda, M.; Farmer, D.; Todoric, J.; Aszmann, O.; Speiser, M.; Györi, G.; Zlabinger, G.J.; Stulnig, T.M. Human Adipose Tissue Macrophages Are of an Anti-Inflammatory Phenotype but Capable of Excessive pro-Inflammatory Mediator Production. Int. J. Obes. 2005 2007, 31, 1420–1428. [Google Scholar] [CrossRef] [PubMed]
- Ou, Q.; Power, R.; Griffin, M.D. Revisiting Regulatory T Cells as Modulators of Innate Immune Response and Inflammatory Diseases. Front. Immunol. 2023, 14, 1287465. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Zhang, Z.; Jiang, K.; Wang, X.; Li, Y. Preliminary Study of the Role F-Box Protein 32 (FBXO32) in Colorectal Neoplasms Through the Transforming Growth Factor Beta (TGF-β)/Smad4 Signalling Pathway. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2018, 24, 1080–1088. [Google Scholar] [CrossRef]
- Zhang, S.; Gang, X.; Yang, S.; Cui, M.; Sun, L.; Li, Z.; Wang, G. The Alterations in and the Role of the Th17/Treg Balance in Metabolic Diseases. Front. Immunol. 2021, 12, 678355. [Google Scholar] [CrossRef]
- Fung, T.T.; McCullough, M.L.; Newby, P.K.; Manson, J.E.; Meigs, J.B.; Rifai, N.; Willett, W.C.; Hu, F.B. Diet-Quality Scores and Plasma Concentrations of Markers of Inflammation and Endothelial Dysfunction. Am. J. Clin. Nutr. 2005, 82, 163–173. [Google Scholar] [CrossRef]
- Jha, B.K.; Sherpa, M.L.; Imran, M.; Mohammed, Y.; Jha, L.A.; Paudel, K.R.; Jha, S.K. Progress in Understanding Metabolic Syndrome and Knowledge of Its Complex Pathophysiology. Diabetology 2023, 4, 134–159. [Google Scholar] [CrossRef]
- Kashima, S.; Inoue, K.; Matsumoto, M.; Akimoto, K. Prevalence and Characteristics of Non-Obese Diabetes in Japanese Men and Women: The Yuport Medical Checkup Center Study: Characteristics of Non-Obese Diabetes. J. Diabetes 2015, 7, 523–530. [Google Scholar] [CrossRef]
- Goto, Y.; Kakizaki, M.; Masaki, N. Production of Spontaneous Diabetic Rats by Repetition of Selective Breeding. Tohoku J. Exp. Med. 1976, 119, 85–90. [Google Scholar] [CrossRef]
- Pereira, J.N.B.; Murata, G.M.; Sato, F.T.; Marosti, A.R.; Carvalho, C.R.D.O.; Curi, R. Small Intestine Remodeling in Male Goto–Kakizaki Rats. Physiol. Rep. 2021, 9, e14755. [Google Scholar] [CrossRef] [PubMed]
- Portha, B.; Giroix, M.-H.; Tourrel-Cuzin, C.; Le-Stunff, H.; Movassat, J. The GK Rat: A Prototype for the Study of Non-Overweight Type 2 Diabetes. In Animal Models in Diabetes Research; Joost, H.-G., Al-Hasani, H., Schürmann, A., Eds.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2012; pp. 125–159. ISBN 978-1-62703-068-7. [Google Scholar]
- Serdan, T.D.A.; Masi, L.N.; Pereira, J.N.B.; Rodrigues, L.E.; Alecrim, A.L.; Scervino, M.V.M.; Diniz, V.L.S.; Dos Santos, A.A.C.; Filho, C.P.B.S.; Alba- Loureiro, T.C.; et al. Impaired Brown Adipose Tissue Is Differentially Modulated in Insulin-Resistant Obese Wistar and Type 2 Diabetic Goto-Kakizaki Rats. Biomed. Pharmacother. 2021, 142, 112019. [Google Scholar] [CrossRef]
- Blumer, I.; Clement, M. Type 2 Diabetes, Hypoglycemia, and Basal Insulins: Ongoing Challenges. Clin. Ther. 2017, 39, S1–S11. [Google Scholar] [CrossRef]
- Sanches, J.M.; Zhao, L.N.; Salehi, A.; Wollheim, C.B.; Kaldis, P. Pathophysiology of Type 2 Diabetes and the Impact of Altered Metabolic Interorgan Crosstalk. FEBS J. 2023, 290, 620–648. [Google Scholar] [CrossRef]
- Weng, W.; Tian, Y.; Kimball, E.S.; Kong, S.X.; Bouchard, J.; Hobbs, T.M.; Sakurada, B. Treatment Patterns and Clinical Characteristics of Patients with Type 2 Diabetes Mellitus According to Body Mass Index: Findings from an Electronic Medical Records Database. BMJ Open Diabetes Res. Care 2017, 5, e000382. [Google Scholar] [CrossRef]
- Lobato, T.B.; Manoel, R.; Pereira, A.C.G.; Correa, I.S.; Iser-Bem, P.N.; de Sousa Santos, E.S.; Pereira, J.N.B.; de Araújo, M.J.L.; de Oliveira Borges, J.C.; Pauferro, J.R.B.; et al. Insulin Resistance in Nonobese Type 2 Diabetic Goto Kakizaki Rats Is Associated with a Proinflammatory T Lymphocyte Profile. FEBS Lett. 2024, 598, 2566–2580. [Google Scholar] [CrossRef] [PubMed]
- Massaro, M.; Scoditti, E.; Carluccio, M.A.; Montinari, M.R.; De Caterina, R. Omega–3 Fatty Acids, Inflammation and Angiogenesis: Nutrigenomic Effects as an Explanation for Anti-Atherogenic and Anti-Inflammatory Effects of Fish and Fish Oils. J. Nutr. Nutr. 2007, 1, 4–23. [Google Scholar] [CrossRef] [PubMed]
- Mukhametov, A.; Yerbulekova, M.; Aitkhozhayeva, G.; Tuyakova, G.; Dautkanova, D. Effects of ω-3 Fatty Acids and Ratio of ω-3/ω-6 for Health Promotion and Disease Prevention. Food Sci. Technol. 2022, 42, e58321. [Google Scholar] [CrossRef]
- Chen, G.-C.; Arthur, R.; Qin, L.-Q.; Chen, L.-H.; Mei, Z.; Zheng, Y.; Li, Y.; Wang, T.; Rohan, T.E.; Qi, Q. Association of Oily and Nonoily Fish Consumption and Fish Oil Supplements With Incident Type 2 Diabetes: A Large Population-Based Prospective Study. Diabetes Care 2021, 44, 672–680. [Google Scholar] [CrossRef]
- Drenjančević, I.; Pitha, J. Omega-3 Polyunsaturated Fatty Acids—Vascular and Cardiac Effects on the Cellular and Molecular Level (Narrative Review). Int. J. Mol. Sci. 2022, 23, 2104. [Google Scholar] [CrossRef]
- Lehner, A.; Staub, K.; Aldakak, L.; Eppenberger, P.; Rühli, F.; Martin, R.D.; Bender, N. Impact of Omega-3 Fatty Acid DHA and EPA Supplementation in Pregnant or Breast-Feeding Women on Cognitive Performance of Children: Systematic Review and Meta-Analysis. Nutr. Rev. 2021, 79, 585–598. [Google Scholar] [CrossRef] [PubMed]
- Lorente-Cebrián, S.; Costa, A.G.V.; Navas-Carretero, S.; Zabala, M.; Martínez, J.A.; Moreno-Aliaga, M.J. Role of Omega-3 Fatty Acids in Obesity, Metabolic Syndrome, and Cardiovascular Diseases: A Review of the Evidence. J. Physiol. Biochem. 2013, 69, 633–651. [Google Scholar] [CrossRef] [PubMed]
- Novak, T.E.; Babcock, T.A.; Jho, D.H.; Helton, W.S.; Espat, N.J. NF-Kappa B Inhibition by Omega -3 Fatty Acids Modulates LPS-Stimulated Macrophage TNF-Alpha Transcription. Am. J. Physiol. Lung Cell. Mol. Physiol. 2003, 284, L84–L89. [Google Scholar] [CrossRef] [PubMed]
- Colussi, N.A.; Todaro, J.S.; Rodríguez, J.P.; Olea, G.B.; Ferrini, L.A.; Stoyanoff, T.R.; Aguirre, M.V. Dietary Supplementation with Integral Chia and Flax Flours Ameliorates Systemic Inflammation. Medicina 2024, 84, 206–220. [Google Scholar]
- Perez-Hernandez, J.; Chiurchiù, V.; Perruche, S.; You, S. Regulation of T-Cell Immune Responses by Pro-Resolving Lipid Mediators. Front. Immunol. 2021, 12, 768133. [Google Scholar] [CrossRef]
- Serhan, C.N.; Chiang, N.; Van Dyke, T.E. Resolving Inflammation: Dual Anti-Inflammatory and pro-Resolution Lipid Mediators. Nat. Rev. Immunol. 2008, 8, 349–361. [Google Scholar] [CrossRef]
- Gorjão, R.; Azevedo-Martins, A.K.; Rodrigues, H.G.; Abdulkader, F.; Arcisio-Miranda, M.; Procopio, J.; Curi, R. Comparative Effects of DHA and EPA on Cell Function. Pharmacol. Ther. 2009, 122, 56–64. [Google Scholar] [CrossRef]
- Figueras, M.; Olivan, M.; Busquets, S.; López-Soriano, F.J.; Argilés, J.M. Effects of Eicosapentaenoic Acid (EPA) Treatment on Insulin Sensitivity in an Animal Model of Diabetes: Improvement of the Inflammatory Status. Obesity 2011, 19, 362–369. [Google Scholar] [CrossRef]
- Radosinska, J.; Kurahara, L.H.; Hiraishi, K.; Viczenczova, C.; Egan Benova, T.; Szeiffova Bacova, B.; Dosenko, V.; Navarova, J.; Obsitnik, B.; Imanaga, I.; et al. Modulation of Cardiac Connexin-43 by Omega-3 Fatty Acid Ethyl-Ester Supplementation Demonstrated in Spontaneously Diabetic Rats. Physiol. Res. 2015, 64, 795–806. [Google Scholar] [CrossRef]
- Natto, Z.S.; Yaghmoor, W.; Alshaeri, H.K.; Van Dyke, T.E. Omega-3 Fatty Acids Effects on Inflammatory Biomarkers and Lipid Profiles among Diabetic and Cardiovascular Disease Patients: A Systematic Review and Meta-Analysis. Sci. Rep. 2019, 9, 18867. [Google Scholar] [CrossRef]
- Yamazaki, R.K.; Brito, G.A.; Coelho, I.; Pequitto, D.C.; Yamaguchi, A.A.; Borghetti, G.; Schiessel, D.L.; Kryczyk, M.; Machado, J.; Rocha, R.E.; et al. Low Fish Oil Intake Improves Insulin Sensitivity, Lipid Profile and Muscle Metabolism on Insulin Resistant MSG-Obese Rats. Lipids Health Dis. 2011, 10, 66. [Google Scholar] [CrossRef] [PubMed]
- Martins, A.R.; Crisma, A.R.; Masi, L.N.; Amaral, C.L.; Marzuca-Nassr, G.N.; Bomfim, L.H.M.; Teodoro, B.G.; Queiroz, A.L.; Serdan, T.D.A.; Torres, R.P.; et al. Attenuation of Obesity and Insulin Resistance by Fish Oil Supplementation Is Associated with Improved Skeletal Muscle Mitochondrial Function in Mice Fed a High-Fat Diet. J. Nutr. Biochem. 2018, 55, 76–88. [Google Scholar] [CrossRef]
- Bernardis, L.L.; Patterson, B.D. Correlation Between “Lee Index” and Carcass Fat Content in Weanling and Adult Female Rats with Hypothalamic Lesions. J. Endocrinol. 1968, 40, 527–528. [Google Scholar] [CrossRef]
- Kuwabara, W.M.T.; Panveloski-Costa, A.C.; Yokota, C.N.F.; Pereira, J.N.B.; Filho, J.M.; Torres, R.P.; Hirabara, S.M.; Curi, R.; Alba-Loureiro, T.C. Comparison of Goto-Kakizaki rats and high fat diet-induced obese rats: Are they reliable models to study Type 2 Diabetes mellitus? PLoS ONE 2017, 12, e0189622. [Google Scholar] [CrossRef]
- Harris, K.K.; Welch, B.A.; Smith, A.M.; Pride, Y.; Grayson, B.E. Altered Chronic Glycemic Control in a Clinically Relevant Model of Rat Thoracic Spinal Contusion. Biosci. Rep. 2022, 43, BSR20221699. [Google Scholar] [CrossRef]
- Bonora, E.; Moghetti, P.; Zancanaro, C.; Cigolini, M.; Querena, M.; Cacciatori, V.; Corgnati, A.; Muggeo, M. Estimates of In Vivo Insulin Action in Man: Comparison of Insulin Tolerance Tests with Euglycemic and Hyperglycemic Glucose Clamp Studies. J. Clin. Endocrinol. Metab. 1989, 68, 374–378. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.-W.; Muniyappa, R.; Yan, X.; Yue, L.Q.; Linden, E.H.; Chen, H.; Hansen, B.C.; Quon, M.J. Comparison between Surrogate Indexes of Insulin Sensitivity/Resistance and Hyperinsulinemic Euglycemic Glucose Clamps in Rhesus Monkeys. Endocrinology 2011, 152, 414–423. [Google Scholar] [CrossRef] [PubMed]
- Matthews, D.R.; Hosker, J.P.; Rudenski, A.S.; Naylor, B.A.; Treacher, D.F.; Turner, R.C. Homeostasis Model Assessment: Insulin Resistance and β-Cell Function from Fasting Plasma Glucose and Insulin Concentrations in Man. Diabetologia 1985, 28, 412–419. [Google Scholar] [CrossRef] [PubMed]
- Katz, A.; Nambi, S.S.; Mather, K.; Baron, A.D.; Follmann, D.A.; Sullivan, G.; Quon, M.J. Quantitative Insulin Sensitivity Check Index: A Simple, Accurate Method for Assessing Insulin Sensitivity In Humans. J. Clin. Endocrinol. Metab. 2000, 85, 2402–2410. [Google Scholar] [CrossRef]
- Ardawi, M.S.; Newsholme, E.A. Maximum Activities of Some Enzymes of Glycolysis, the Tricarboxylic Acid Cycle and Ketone-Body and Glutamine Utilization Pathways in Lymphocytes of the Rat. Biochem. J. 1982, 208, 743–748. [Google Scholar] [CrossRef]
- Grases-Pintó, B.; Abril-Gil, M.; Rodríguez-Lagunas, M.J.; Castell, M.; Pérez-Cano, F.J.; Franch, À. Leptin and Adiponectin Supplementation Modifies Mesenteric Lymph Node Lymphocyte Composition and Functionality in Suckling Rats. Br. J. Nutr. 2018, 119, 486–495. [Google Scholar] [CrossRef] [PubMed]
- Folador, A.; De Lima-Salgado, T.M.; Hirabara, S.M.; Aikawa, J.; Yamazaki, R.K.; Martins, E.F.; De Oliveira, H.H.P.; Pizatto, N.; Kanunfre, C.C.; Peres, C.M.; et al. Effect of Fish Oil Supplementation for Two Generations on Changes of Lymphocyte Function Induced by Walker 256 Cancer Cachexia in Rats. Nutr. Cancer 2009, 61, 670–679. [Google Scholar] [CrossRef] [PubMed]
- Curi, R.; Peres, C. Como Cultivar Células; Guanabara Koogan: Rio de Janeiro, Brazil, 2005; ISBN 978-85-277-0975-0. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Andersen, G.; Harnack, K.; Erbersdobler, H.F.; Somoza, V. Dietary Eicosapentaenoic Acid and Docosahexaenoic Acid Are More Effective than Alpha-Linolenic Acid in Improving Insulin Sensitivity in Rats. Ann. Nutr. Metab. 2008, 52, 250–256. [Google Scholar] [CrossRef]
- Albracht-Schulte, K.; Kalupahana, N.S.; Ramalingam, L.; Wang, S.; Rahman, S.M.; Robert-McComb, J.; Moustaid-Moussa, N. Omega-3 Fatty Acids in Obesity and Metabolic Syndrome: A Mechanistic Update. J. Nutr. Biochem. 2018, 58, 1–16. [Google Scholar] [CrossRef]
- Habte, M.L.; Melka, D.S.; Degef, M.; Menon, M.K.C.; Yifter, H.; Feyisa, T.O. Comparison of Lipid Profile, Liver Enzymes, Creatine Kinase and Lactate Dehydrogenase Among Type II Diabetes Mellitus Patients on Statin Therapy. Diabetes Metab. Syndr. Obes. Targets Ther. 2020, 13, 763–773. [Google Scholar] [CrossRef]
- Liu, Y.-X.; Yu, J.-H.; Sun, J.-H.; Ma, W.-Q.; Wang, J.-J.; Sun, G.-J. Effects of Omega-3 Fatty Acids Supplementation on Serum Lipid Profile and Blood Pressure in Patients with Metabolic Syndrome: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Foods 2023, 12, 725. [Google Scholar] [CrossRef]
- Molinar-Toribio, E.; Pérez-Jiménez, J.; Ramos-Romero, S.; Romeu, M.; Giralt, M.; Taltavull, N.; Muñoz-Cortes, M.; Jáuregui, O.; Méndez, L.; Medina, I.; et al. Effect of N-3 PUFA Supplementation at Different EPA:DHA Ratios on the Spontaneously Hypertensive Obese Rat Model of the Metabolic Syndrome. Br. J. Nutr. 2015, 113, 878–887. [Google Scholar] [CrossRef]
- Harford, K.A.; Reynolds, C.M.; McGillicuddy, F.C.; Roche, H.M. Fats, Inflammation and Insulin Resistance: Insights to the Role of Macrophage and T-Cell Accumulation in Adipose Tissue. Proc. Nutr. Soc. 2011, 70, 408–417. [Google Scholar] [CrossRef]
- Jagannathan-Bogdan, M.; McDonnell, M.E.; Shin, H.; Rehman, Q.; Hasturk, H.; Apovian, C.M.; Nikolajczyk, B.S. Elevated Proinflammatory Cytokine Production by a Skewed T Cell Compartment Requires Monocytes and Promotes Inflammation in Type 2 Diabetes. J. Immunol. 2011, 186, 1162–1172. [Google Scholar] [CrossRef] [PubMed]
- Zeng, C.; Shi, X.; Zhang, B.; Liu, H.; Zhang, L.; Ding, W.; Zhao, Y. The Imbalance of Th17/Th1/Tregs in Patients with Type 2 Diabetes: Relationship with Metabolic Factors and Complications. J. Mol. Med. 2012, 90, 175–186. [Google Scholar] [CrossRef] [PubMed]
- Seal, S.V.; Henry, M.; Pajot, C.; Holuka, C.; Bailbé, D.; Movassat, J.; Darnaudéry, M.; Turner, J.D. A Holistic View of the Goto-Kakizaki Rat Immune System: Decreased Circulating Immune Markers in Non- Obese Type 2 Diabetes. Front. Immunol. 2022, 13, 896179. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A. IL-18: A TH1 -Inducing, Proinflammatory Cytokine and New Member of the IL-1 Family. J. Allergy Clin. Immunol. 1999, 103, 11–24. [Google Scholar] [CrossRef]
- Okamura, H.; Tsutsui, H.; Komatsu, T.; Yutsudo, M.; Hakura, A.; Tanimoto, T.; Torigoe, K.; Okura, T.; Nukada, Y.; Hattori, K.; et al. Cloning of a New Cytokine That Induces IFN-γ Production by T Cells. Nature 1995, 378, 88–91. [Google Scholar] [CrossRef]
- Sanders, N.L.; Mishra, A. Role of Interleukin-18 in the Pathophysiology of Allergic Diseases. Cytokine Growth Factor Rev. 2016, 32, 31–39. [Google Scholar] [CrossRef]
- Lit, L.C.-W.; Wong, C.-K.; Li, E.K.-M.; Tam, L.-S.; Lam, C.W.-K.; Lo, Y.-M.D. Elevated Gene Expression of Th1/Th2 Associated Transcription Factors Is Correlated with Disease Activity in Patients with Systemic Lupus Erythematosus. J. Rheumatol. 2007, 34, 89–96. [Google Scholar]
- Aarts, J.; van Caam, A.; Chen, X.; Marijnissen, R.J.; Helsen, M.M.; Walgreen, B.; Vitters, E.L.; van de Loo, F.A.; van Lent, P.L.; van der Kraan, P.M.; et al. Local Inhibition of TGF-Β1 Signaling Improves Th17/Treg Balance but Not Joint Pathology during Experimental Arthritis. Sci. Rep. 2022, 12, 3182. [Google Scholar] [CrossRef]
- Liu, C.; Fan, D.; Lei, Q.; Lu, A.; He, X. Roles of Resolvins in Chronic Inflammatory Response. Int. J. Mol. Sci. 2022, 23, 14883. [Google Scholar] [CrossRef]
- Lee, Y.K.; Mukasa, R.; Hatton, R.D.; Weaver, C.T. Developmental Plasticity of Th17 and Treg Cells. Curr. Opin. Immunol. 2009, 21, 274–280. [Google Scholar] [CrossRef]
- Jolly, C.A.; Muthukumar, A.; Reddy Avula, C.P.; Fernandes, G. Maintenance of NF-kappaB Activation in T-Lymphocytes and a Naive T-Cell Population in Autoimmune-Prone (NZB/NZW)F(1) Mice by Feeding a Food-Restricted Diet Enriched with n-3 Fatty Acids. Cell. Immunol. 2001, 213, 122–133. [Google Scholar] [CrossRef] [PubMed]
- Calder, P.C. Mecanismos de Ação Dos Ácidos Graxos (n-3)1,2. J. Nutr. 2012, 142, 592S–599S. [Google Scholar] [CrossRef] [PubMed]
- Seok, H.; Cha, B.S. Refocusing Peroxisome Proliferator Activated Receptor-α: A New Insight for Therapeutic Roles in Diabetes. Diabetes Metab. J. 2013, 37, 326–332. [Google Scholar] [CrossRef] [PubMed]
- Calder, P.C. Immunoregulatory and Anti-Inflammatory Effects of n-3 Polyunsaturated Fatty Acids. Braz. J. Med. Biol. Res. 1998, 31, 467–490. [Google Scholar] [CrossRef] [PubMed]
- Pompéia, C.; Lopes, L.R.; Miyasaka, C.K.; Procópio, J.; Sannomiya, P.; Curi, R. Effect of Fatty Acids on Leukocyte Function. Braz. J. Med. Biol. Res. 2000, 33, 1255–1268. [Google Scholar] [CrossRef]
- Richard, C.; Lewis, E.D.; Goruk, S.; Field, C.J. The Content of Docosahexaenoic Acid in the Suckling and the Weaning Diet Beneficially Modulates the Ability of Immune Cells to Response to Stimuli. J. Nutr. Biochem. 2016, 35, 22–29. [Google Scholar] [CrossRef]
- Zhang, H.; Watanabe, R.; Berry, G.J.; Nadler, S.G.; Goronzy, J.J.; Weyand, C.M. CD28 Signaling Controls Metabolic Fitness of Pathogenic T Cells in Medium and Large Vessel Vasculitis. J. Am. Coll. Cardiol. 2019, 73, 1811–1823. [Google Scholar] [CrossRef]
- Chapman, N.M.; Boothby, M.R.; Chi, H. Metabolic Coordination of T Cell Quiescence and Activation. Nat. Rev. Immunol. 2020, 20, 55–70. [Google Scholar] [CrossRef]
- DiToro, D.; Winstead, C.J.; Pham, D.; Witte, S.; Andargachew, R.; Singer, J.R.; Wilson, C.G.; Zindl, C.L.; Luther, R.J.; Silberger, D.J.; et al. Differential IL-2 Expression Defines Developmental Fates of Follicular versus Nonfollicular Helper T Cells. Science 2018, 361, eaao2933. [Google Scholar] [CrossRef]
- Morrison, A.H.; Diamond, M.S.; Hay, C.A.; Byrne, K.T.; Vonderheide, R.H. Sufficiency of CD40 Activation and Immune Checkpoint Blockade for T Cell Priming and Tumor Immunity. Proc. Natl. Acad. Sci. USA 2020, 117, 8022–8031. [Google Scholar] [CrossRef]
- Sakaguchi, S.; Yamaguchi, T.; Nomura, T.; Ono, M. Regulatory T Cells and Immune Tolerance. Cell 2008, 133, 775–787. [Google Scholar] [CrossRef] [PubMed]
- Rasti, B.; Jinap, S.; Mozafari, M.R.; Abd-Manap, M.Y. Optimization on Preparation Condition of Polyunsaturated Fatty Acids Nanoliposome Prepared by Mozafari Method. J. Liposome Res. 2014, 24, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Rasti, B.; Jinap, S.; Mozafari, M.R.; Yazid, A.M. Comparative Study of the Oxidative and Physical Stability of Liposomal and Nanoliposomal Polyunsaturated Fatty Acids Prepared with Conventional and Mozafari Methods. Food Chem. 2012, 135, 2761–2770. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
Rplp0 | GAACATCTCCCCCTTCTCCTCC | ATTGCGGACACCCTCTAGGAA |
T-bet | GAGCCCCACGAGCAATTACAG | GTATAAGCGGTTCCCTGGCA |
IFN-γ | TGTCATCGAATCGCACCTGA | TGTGGGTTGTTCACCTCGAA |
TNF-α | ATGGGCTCCCTCTCATCAGT | GTCTGGTGGTTTGCTACGAC |
IL-18 | GACCGAACAGCCAACGAATC | GATAGGGTCACAGCCAGTCC |
IL-2 | CTGCAGCGTGTGTTGGATT | GGCTCATCATCGAATTGGCAC |
GATA-3 | AGTACCCCCTGACGGAAGAG | TAGTAGGACGGGAGTGGTT |
IL-4 | GTACCGGGAACGGTATCCAC | TTCTCCGTGGTGTTGACCTG |
RORα | AACATCTCGGGAGTTGCTGG | AGGAGTAGGCCACATTGCAC |
TGF-α | CTGCTGACCCCCACTGATA | AGCCCTGTATTCCGTCTCCT |
IL-17 | GGAGAATTCCATCCATGTGCC | ATGAGTACCGCTGCCTTCAC |
IL-6 | ACAAGTCCGGAGAGGAGACT | GAATTGCCATTGACAAACTCT |
FOXP3 | ACTCTGCCTTCACACGAGAC | GAGGCAGGCTGGATAACGG |
IL-35 | GTCTCTGGACCTGCCAAGTG | CCAGTGTGCTGGTTTTGTCC |
IL-10 | AAGACCCAGACATCAAGGCG | AATCGATGACAGCGCCGTAG |
Glut-1 | GTCGTACGGCAAGATCGCTGAG | TTCAATCATGTCACCCACGCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lobato, T.B.; Santos, E.S.d.S.; Iser-Bem, P.N.; Falcão, H.d.S.; Gimenes, G.M.; Pauferro, J.R.B.; Rodrigues, G.T.; Correa, I.S.; Pereira, A.C.G.; Passos, M.E.P.; et al. Omega-3 Fatty Acids Weaken Lymphocyte Inflammatory Features and Improve Glycemic Control in Nonobese Diabetic Goto-Kakizaki Rats. Nutrients 2024, 16, 4106. https://doi.org/10.3390/nu16234106
Lobato TB, Santos ESdS, Iser-Bem PN, Falcão HdS, Gimenes GM, Pauferro JRB, Rodrigues GT, Correa IS, Pereira ACG, Passos MEP, et al. Omega-3 Fatty Acids Weaken Lymphocyte Inflammatory Features and Improve Glycemic Control in Nonobese Diabetic Goto-Kakizaki Rats. Nutrients. 2024; 16(23):4106. https://doi.org/10.3390/nu16234106
Chicago/Turabian StyleLobato, Tiago Bertola, Elvirah Samantha de Sousa Santos, Patrícia Nancy Iser-Bem, Henrique de Souza Falcão, Gabriela Mandú Gimenes, Janaina Ribeiro Barbosa Pauferro, Glayce Tavares Rodrigues, Ilana Souza Correa, Ana Carolina Gomes Pereira, Maria Elizabeth Pereira Passos, and et al. 2024. "Omega-3 Fatty Acids Weaken Lymphocyte Inflammatory Features and Improve Glycemic Control in Nonobese Diabetic Goto-Kakizaki Rats" Nutrients 16, no. 23: 4106. https://doi.org/10.3390/nu16234106
APA StyleLobato, T. B., Santos, E. S. d. S., Iser-Bem, P. N., Falcão, H. d. S., Gimenes, G. M., Pauferro, J. R. B., Rodrigues, G. T., Correa, I. S., Pereira, A. C. G., Passos, M. E. P., Borges, J. C. d. O., Alves, A. C. d. A., Santos, C. S. d., Araújo, M. J. L. d., Diniz, V. L. S., Levada-Pires, A. C., Pithon-Curi, T. C., Masi, L. N., Curi, R., ... Gorjão, R. (2024). Omega-3 Fatty Acids Weaken Lymphocyte Inflammatory Features and Improve Glycemic Control in Nonobese Diabetic Goto-Kakizaki Rats. Nutrients, 16(23), 4106. https://doi.org/10.3390/nu16234106