Text Correction
Upon review, we have identified an error in the human TNF-α primer sequence reported in Table 1 of our paper titled “Erythritol can inhibit the expression of senescence molecules in mouse gingival tissues and human gingival fibroblasts” [1]. The incorrect sequence was inadvertently included due to an oversight during manuscript preparation. The sequence did not yield successful amplification in our experiments and was not used in the data presented. We provide here the correct primer sequences that were utilized:
TNF-α (F)—CCCAGGGACCTCTCTCTAATC
TNF-α (R)—ATGGCTACAGGCTTGTCACT
The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.
The authors thank the readers and the journal for their understanding.
Reference
- Yokoi, H.; Furukawa, M.; Wang, J.; Aoki, Y.; Raju, R.; Ikuyo, Y.; Yamada, M.; Shikama, Y.; Matsushita, K. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).