Gastric Mucosal Protective Effects of Cinnamomum cassia in a Rat Model of Ethanol-Induced Gastric Injury
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Cinnamon Extracts
2.2. Cinnamic Acid Analysis by High-Performance Liquid Chromatography (HPLC)
2.3. Animal Experiments
2.4. Measurement of Gastric Juice PH and Total Acidity
2.5. Gross Lesions Index
2.6. Histological Analysis
2.7. Measurement of Nitric Oxide (NO), Myeloperoxidase (MPO), Tumor Necrosis Factor-Alpha (TNF-α) and Interleukin (IL)-1β
2.8. Immunohistochemical (IHC) Staining for F4/80 and Periodic Acid and Schiff’s (PAS) Staining
2.9. Protein Extraction and Immunoblotting
2.10. mRNA Extraction and Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)
2.11. Statistical Analysis
3. Results
3.1. C. cassia Pretreament Protects against Ethanol-Induced Gastric Damage in Rats
3.2. C. cassia Affects Gastric Acid Secretion and Expression of Gastric Acid Secretion-Related Receptors in Ethanol-Induced Gastric Damage Rats
3.3. C. cassia Downregulates Pro-Inflammatory Signaling Pathway in Ethanol-Induced Gastric Damage in Rats
3.4. C. cassia Upregulates Antioxidant and Mucosal Defense-Associated Genes in Ethanol-Induced Gastric Damage Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sipponen, P.; Maaroos, H.-I. Chronic gastritis. Scand. J. Gastroenterol. 2015, 50, 657–667. [Google Scholar] [CrossRef] [PubMed]
- Ren, S.; Wei, Y.; Wang, R.; Wei, S.; Wen, J.; Yang, T.; Chen, X.; Wu, S.; Jing, M.; Li, H. Rutaecarpine ameliorates ethanol-induced gastric mucosal injury in mice by modulating genes related to inflammation, oxidative stress and apoptosis. Front. Pharmacol. 2020, 11, 600295. [Google Scholar] [CrossRef] [PubMed]
- Ren, S.; Chen, B.; Ma, Z.; Hu, H.; Xie, Y. Polygonum hydropiper extract attenuates ethanol-induced gastric damage through antioxidant and anti-inflammatory pathways. Braz. J. Med. Biol. Res. 2021, 54, e10841. [Google Scholar] [CrossRef] [PubMed]
- Davies, S.S.; Zhang, L.S. Reactive carbonyl species scavengers—Novel therapeutic approaches for chronic diseases. Curr. Pharmacol. Rep. 2017, 3, 51–67. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef] [PubMed]
- Engevik, A.C.; Kaji, I.; Goldenring, J.R. The physiology of the gastric parietal cell. Physiol. Rev. 2020, 100, 573–602. [Google Scholar] [CrossRef] [PubMed]
- Lanas, A.; Chan, F.K. Peptic ulcer disease. Lancet 2017, 390, 613–624. [Google Scholar] [CrossRef]
- Haastrup, P.F.; Thompson, W.; Søndergaard, J.; Jarbøl, D.E. Side effects of long-term proton pump inhibitor use: A review. Basic Clin. Pharmacol. Toxicol. 2018, 123, 114–121. [Google Scholar] [CrossRef]
- Yibirin, M.; De Oliveira, D.; Valera, R.; Plitt, A.E.; Lutgen, S. Adverse effects associated with proton pump inhibitor use. Cureus 2021, 13, e12759. [Google Scholar] [CrossRef]
- Dhar, A.; Maw, F.; Dallal, H.J.; Attwood, S. Side effects of drug treatments for gastro-oesophageal reflux disease: Current controversies. Frontline Gastroenterol. 2022, 13, 45–49. [Google Scholar] [CrossRef]
- Guo, H.; Zhang, R.; Zhang, P.; Chen, Z.; Hua, Y.; Huang, X.; Li, X. Association of proton pump inhibitors with gastric and colorectal cancer risk: A systematic review and meta-analysis. Front. Pharmacol. 2023, 14, 1129948. [Google Scholar] [CrossRef] [PubMed]
- Rais, R.; Trikalinos, N.A.; Liu, J.; Chatterjee, D. Enterochromaffin-like cell hyperplasia–associated gastric neuroendocrine tumors may arise in the setting of proton pump inhibitor use: The need for a new clinicopathologic category. Arch. Pathol. Lab. Med. 2022, 146, 366–371. [Google Scholar] [CrossRef] [PubMed]
- Sharifi-Rad, M.; Fokou, P.V.T.; Sharopov, F.; Martorell, M.; Ademiluyi, A.O.; Rajkovic, J.; Salehi, B.; Martins, N.; Iriti, M.; Sharifi-Rad, J. Antiulcer agents: From plant extracts to phytochemicals in healing promotion. Molecules 2018, 23, 1751. [Google Scholar] [CrossRef] [PubMed]
- Gu, D.-T.; Tung, T.-H.; Jiesisibieke, Z.L.; Chien, C.-W.; Liu, W.-Y. Safety of cinnamon: An umbrella review of meta-analyses and systematic reviews of randomized clinical trials. Front. Pharmacol. 2022, 12, 790901. [Google Scholar] [CrossRef] [PubMed]
- Sharifi-Rad, J.; Dey, A.; Koirala, N.; Shaheen, S.; El Omari, N.; Salehi, B.; Goloshvili, T.; Cirone Silva, N.C.; Bouyahya, A.; Vitalini, S. Cinnamomum species: Bridging phytochemistry knowledge, pharmacological properties and toxicological safety for health benefits. Front. Pharmacol. 2021, 12, 600139. [Google Scholar] [CrossRef] [PubMed]
- Tajaldini, M.; Samadi, F.; Khosravi, A.; Ghasemnejad, A.; Asadi, J. Protective and anticancer effects of orange peel extract and naringin in doxorubicin treated esophageal cancer stem cell xenograft tumor mouse model. Biomed. Pharmacother. 2020, 121, 109594. [Google Scholar] [CrossRef] [PubMed]
- Caban, M.; Owczarek, K.; Lewandowska, U. Effects of Polyphenol-Rich Extracts on Inflammatory Bowel Diseases. In Food Reviews International; Taylor and Francis: Abingdon, UK, 2023; pp. 1–38. [Google Scholar]
- Bae, J.-M.; Kim, E.H. Dietary intakes of citrus fruit and risk of gastric cancer incidence: An adaptive meta-analysis of cohort studies. Epidemiol. Health 2016, 38, e2016034. [Google Scholar] [CrossRef]
- Zhang, C.; Fan, L.; Fan, S.; Wang, J.; Luo, T.; Tang, Y.; Chen, Z.; Yu, L. Cinnamomum cassia Presl: A review of its traditional uses, phytochemistry, pharmacology and toxicology. Molecules 2019, 24, 3473. [Google Scholar] [CrossRef]
- Lee, M.J.; Seo, H.J.; Hwang, G.S.; Choi, S.; Park, S.J.; Hwang, S.-J.; Kang, K.S. Molecular Mechanism of Cinnamomum cassia against Gastric Damage and Identification of Active Compounds. Biomolecules 2022, 12, 525. [Google Scholar] [CrossRef]
- Lee, J.H.; Kwak, H.J.; Shin, D.; Seo, H.J.; Park, S.J.; Hong, B.-H.; Shin, M.-S.; Kim, S.H.; Kang, K.S. Mitigation of Gastric Damage Using Cinnamomum cassia Extract: Network Pharmacological Analysis of Active Compounds and Protection Effects in Rats. Plants 2022, 11, 716. [Google Scholar] [CrossRef]
- Brierley, S.M.; Kelber, O. Use of natural products in gastrointestinal therapies. Curr. Opin. Pharmacol. 2011, 11, 604–611. [Google Scholar] [CrossRef] [PubMed]
- Valadbeigi, H.; Khoshnood, S.; Negahdari, B.; Abdullah, M.A.; Haddadi, M.H. Antibacterial and Immunoregulatory Effects of Metformin against Helicobacter pylori Infection in Rat Model. BioMed Res. Int. 2023, 2023, 5583286. [Google Scholar] [CrossRef]
- Liu, J.; Wu, J.; Wang, R.; Zhong, D.; Qiu, Y.; Wang, H.; Song, Z.; Zhu, Y. ANKRD22 drives rapid proliferation of lgr5+ cells and acts as a promising therapeutic target in gastric mucosal injury. Cell Mol. Gastroenterol. Hepatol. 2021, 12, 1433–1455. [Google Scholar] [CrossRef] [PubMed]
- An, J.M.; Kim, E.; Lee, H.J.; Park, M.H.; Son, D.J.; Hahm, K.B. Dolichos lablab L. extracts as pharmanutrient for stress-related mucosal disease in rat stomach. J. Clin. Biochem. Nutr. 2020, 67, 89–101. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.-M.; Han, Y.-M.; Song, M.-Y.; Lee, D.-Y.; Kim, H.S.; Kim, S.-H.; Kim, E.-H. Xanthohumol Interferes with the Activation of TGF-β Signaling in the Process Leading to Intestinal Fibrosis. Nutrients 2022, 15, 99. [Google Scholar] [CrossRef] [PubMed]
- Zhou, D.; Yang, Q.; Tian, T.; Chang, Y.; Li, Y.; Duan, L.-R.; Li, H.; Wang, S.-W. Gastroprotective effect of gallic acid against ethanol-induced gastric ulcer in rats: Involvement of the Nrf2/HO-1 signaling and anti-apoptosis role. Biomed. Pharmacother 2020, 126, 110075. [Google Scholar] [CrossRef]
- Al-Wajeeh, N.S.; Hajrezaie, M.; Al-Henhena, N.; Kamran, S.; Bagheri, E.; Zahedifard, M.; Saremi, K.; Noor, S.M.; Ali, H.M.; Abdulla, M.A. The antiulcer effect of Cibotium barometz leaves in rats with experimentally induced acute gastric ulcer. Drug Des. Devel. 2017, 11, 995–1009. [Google Scholar] [CrossRef]
- Shin, J.-K.; Park, J.H.; Kim, K.S.; Kang, T.H.; Kim, H.S. Antiulcer activity of steamed ginger extract against ethanol/HCl-induced gastric mucosal injury in rats. Molecules 2020, 25, 4663. [Google Scholar] [CrossRef]
- Shi, Z.; Long, X.; Li, Y.; Jin, J.; Li, J.; Yuan, C.; Jin, R. Protective Effect of Tea Saponins on Alcohol-Induced Gastric Mucosal Injury in Mice. ACS Omega 2022, 8, 673–681. [Google Scholar] [CrossRef]
- Abdelfattah, M.S.; Elmallah, M.I.; Ebrahim, H.Y.; Almeer, R.S.; Eltanany, R.M.; Abdel Moneim, A.E. Prodigiosins from a marine sponge-associated actinomycete attenuate HCl/ethanol-induced gastric lesion via antioxidant and anti-inflammatory mechanisms. PLoS ONE 2019, 14, e0216737. [Google Scholar] [CrossRef]
- Liang, T.-Y.; Deng, R.-M.; Li, X.; Xu, X.; Chen, G. The role of nitric oxide in peptic ulcer: A narrative review. Med. Gas Res. 2021, 11, 42. [Google Scholar] [PubMed]
- Zhang, X.; Jiang, A.; Qi, B.; Ma, Z.; Xiong, Y.; Dou, J.; Wang, J. Resveratrol protects against Helicobacter pylori-associated gastritis by combating oxidative stress. Int. J. Mol. Sci. 2015, 16, 27757–27769. [Google Scholar] [CrossRef] [PubMed]
- El-Shafey, R.S.; Baloza, S.H.; Mohammed, L.A.; Nasr, H.E.; Soliman, M.M.; Ghamry, H.I.; Elgendy, S.A. The ameliorative impacts of wheat germ oil against ethanol-induced gastric ulcers: Involvement of anti-inflammatory, antiapoptotic, and antioxidant activities. Toxicol. Res. 2022, 11, 325–338. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Wo, G.; Li, B.; Xu, C.; Wu, J.; Jiang, C.; Wei, J. The anti-inflammatory NHE-06 restores antitumor immunity by targeting NF-κB/IL-6/STAT3 signaling in hepatocellular carcinoma. Biomed. Pharmacother. 2018, 102, 420–427. [Google Scholar] [CrossRef] [PubMed]
- Kunnumakkara, A.B.; Sailo, B.L.; Banik, K.; Harsha, C.; Prasad, S.; Gupta, S.C.; Bharti, A.C.; Aggarwal, B.B. Chronic diseases, inflammation, and spices: How are they linked? J. Transl. Med. 2018, 16, 14. [Google Scholar] [CrossRef] [PubMed]
- Pérez, S.; Taléns-Visconti, R.; Rius-Pérez, S.; Finamor, I.; Sastre, J. Redox signaling in the gastrointestinal tract. Free Radic. Biol. Med. 2017, 104, 75–103. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.C.; Wu, S.J.; Chang, C.H.; Ng, L.T. Antioxidant activity of Cinnamomum cassia. Phytother. Res. 2003, 17, 726–730. [Google Scholar] [CrossRef]
- Campbell, N.K.; Fitzgerald, H.K.; Dunne, A. Regulation of inflammation by the antioxidant haem oxygenase 1. Nat. Rev. Immunol 2021, 21, 411–425. [Google Scholar] [CrossRef]
- Tóth, M.E.; Vígh, L.; Sántha, M. Alcohol stress, membranes, and chaperones. Cell Stress Chaperones 2014, 19, 299–309. [Google Scholar] [CrossRef]
- Laine, L.; Takeuchi, K.; Tarnawski, A. Gastric mucosal defense and cytoprotection: Bench to bedside. Gastroenterology 2008, 135, 41–60. [Google Scholar] [CrossRef]
- Dhanisha, S.S.; Guruvayoorappan, C.; Drishya, S.; Abeesh, P. Mucins: Structural diversity, biosynthesis, its role in pathogenesis and as possible therapeutic targets. Crit. Rev. Oncol. Hematol. 2018, 122, 98–122. [Google Scholar] [CrossRef] [PubMed]
Group | Route | Inducer | Tested Substance | Dose |
---|---|---|---|---|
NC | Oral | - | Saline | - |
E | Oral | Ethanol | Saline | - |
CL | Oral | Ethanol | C. cassia | 20 mg/kg/day |
CH | Oral | Ethanol | C. cassia | 30 mg/kg/day |
PC | Oral | Ethanol | Rebamipide | 30 mg/kg/day |
Name | Cat. No. | Company |
---|---|---|
p-IkBα | #2859 | Cell Signaling Technology (Danvers, MA, USA) |
IkBα | #9242 | Cell Signaling Technology (Danvers, MA, USA) |
p-p65 | #3033 | Cell Signaling Technology (Danvers, MA, USA) |
p65 | #8242 | Cell Signaling Technology (Danvers, MA, USA) |
p- STAT3 | sc-8001-R | Santa Cruz Biotechnology (Dallas, TX, USA) |
STAT3 | sc-483 | Santa Cruz Biotechnology (Dallas, TX, USA) |
HSP90 | #4874 | Cell Signaling Technology (Danvers, MA, USA) |
HSP27 | #50353 | Cell Signaling Technology (Danvers, MA, USA) |
HO1 | ADI-SPA-895-F | Enzo Life Sciences (Farmingdale, NY, USA) |
β-actin | sc-47778 | Santa Cruz Biotechnology (Dallas, TX, USA) |
Gene | Primer Sequence | |
---|---|---|
18S rRNA | Forward | GCAATTATTCCCCATGAACG |
Reverse | GGCCTCACTAAACCATCCAA | |
H2R | Forward | CCATCCTGTACGCTGCTCTCA |
Reverse | TGCGAACTTGCAGTGGAAGA | |
CCK2R | Forward | GCGGAAACGTGCTCATCAT |
Reverse | GGCGTTGGTGACCGTTCTT | |
M3R | Forward | GCCTGGGTCTCTTAATTCCTATCA |
Reverse | ATGGGATCTGGATGGACACTTT | |
iNOS | Forward | GAGAAGCTGAGGCCCAGG |
Reverse | ACCTTCCGCATTAGCACAGA | |
IL-6 | Forward | TCCTACCCCAACTTCCAATGCTC |
Reverse | TTGGATGGTCTTGGTCCTTAGCC | |
TNF-α | Forward | ACTGAACTTCGGGGTGATCG |
Reverse | GCTTGGTGGTTTGCTACGAC | |
MUC5A | Forward | TACCCCGAGCGTAGTGTACC |
Reverse | CAGGGGTCTTCACAGACGA | |
MUC6 | Forward | ACCAGCCAAGTGACATCAACC |
Reverse | TGACCATGACTGATGCGTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, Y.-M.; Song, M.-Y.; Lee, D.-Y.; Lee, S.-W.; Ahn, H.-R.; Yoo, J.; Kim, H.J.; Kim, E.-H. Gastric Mucosal Protective Effects of Cinnamomum cassia in a Rat Model of Ethanol-Induced Gastric Injury. Nutrients 2024, 16, 55. https://doi.org/10.3390/nu16010055
Han Y-M, Song M-Y, Lee D-Y, Lee S-W, Ahn H-R, Yoo J, Kim HJ, Kim E-H. Gastric Mucosal Protective Effects of Cinnamomum cassia in a Rat Model of Ethanol-Induced Gastric Injury. Nutrients. 2024; 16(1):55. https://doi.org/10.3390/nu16010055
Chicago/Turabian StyleHan, Young-Min, Moon-Young Song, Da-Young Lee, Seung-Won Lee, Hye-Rin Ahn, Jihee Yoo, Hyo Jun Kim, and Eun-Hee Kim. 2024. "Gastric Mucosal Protective Effects of Cinnamomum cassia in a Rat Model of Ethanol-Induced Gastric Injury" Nutrients 16, no. 1: 55. https://doi.org/10.3390/nu16010055
APA StyleHan, Y.-M., Song, M.-Y., Lee, D.-Y., Lee, S.-W., Ahn, H.-R., Yoo, J., Kim, H. J., & Kim, E.-H. (2024). Gastric Mucosal Protective Effects of Cinnamomum cassia in a Rat Model of Ethanol-Induced Gastric Injury. Nutrients, 16(1), 55. https://doi.org/10.3390/nu16010055