Lutein Prevents Liver Injury and Intestinal Barrier Dysfunction in Rats Subjected to Chronic Alcohol Intake
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Experimental Models and Treatments
2.3. Histopathological Analysis of Liver and Small Intestine
2.4. Biochemical Index Measurement
2.5. Western Blot
2.6. Real-Time Quantitative Polymerase Chain Reaction
2.7. Determination of Microbiota in Cecal Contents
2.8. Statistical Analysis
3. Results
3.1. Effects of Lutein on Food Intake, Body Weight and Liver Tissue
3.2. Effect of Lutein on Serum Biochemical Indices
3.3. Effect of Lutein on Alcohol Metabolism in the Liver
3.4. Effect of Lutein on Oxidative Stress in the Liver
3.5. Effects of Lutein on Levels of Inflammatory Cytokines
3.6. Effects of Lutein on Expression of Proteins Associated with Inflammatory Pathways
3.7. Effect of Lutein on the Small Intestine Tissue
3.8. Effect of Lutein on the Ileal Barrier
3.9. Effect of Lutein on the Microbiota of Cecum Contents
3.10. Correlation of Differential Bacterial Genera with Biochemical Indicators
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Seitz, H.K.; Bataller, R.; Cortez-Pinto, H.; Gao, B.; Gual, A.; Lackner, C.; Mathurin, P.; Mueller, S.; Szabo, G.; Tsukamoto, H. Alcoholic liver disease. Nat. Rev. Dis. Prim. 2018, 4, 16. [Google Scholar] [CrossRef] [Scilit]
- Rocco, A.; Compare, D.; Angrisani, D.; Sanduzzi Zamparelli, M.; Nardone, G. Alcoholic disease: Liver and beyond. World J. Gastroenterol. 2014, 20, 14652–14659. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Zhuge, J.; Wang, X.; Bai, J.; Cederbaum, A.I. Cytochrome P450 2E1 contributes to ethanol-induced fatty liver in mice. Hepatology 2008, 47, 1483–1494. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Cederbaum, A.I. CYP2E1 and oxidative liver injury by alcohol. Free Radic. Biol. Med. 2008, 44, 723–738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forsyth, C.B.; Farhadi, A.; Jakate, S.M.; Tang, Y.; Shaikh, M.; Keshavarzian, A. Lactobacillus GG treatment ameliorates alcohol-induced intestinal oxidative stress, gut leakiness, and liver injury in a rat model of alcoholic steatohepatitis. Alcohol 2009, 43, 163–172. [Google Scholar] [CrossRef] [Scilit]
- Malaguarnera, G.; Giordano, M.; Nunnari, G.; Bertino, G.; Malaguarnera, M. Gut microbiota in alcoholic liver disease: Pathogenetic role and therapeutic perspectives. World J. Gastroenterol. 2014, 20, 16639–16648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghorbani, Z.; Hajizadeh, M.; Hekmatdoost, A. Dietary supplementation in patients with alcoholic liver disease: A review on current evidence. Hepatobiliary Pancreat. Dis. Int. 2016, 15, 348–360. [Google Scholar] [CrossRef] [Scilit]
- Ahn, Y.J.; Kim, H. Lutein as a Modulator of Oxidative Stress-Mediated Inflammatory Diseases. Antioxidants 2021, 10, 1448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chung, H.Y.; Rasmussen, H.M.; Johnson, E.J. Lutein bioavailability is higher from lutein-enriched eggs than from supplements and spinach in men. J. Nutr. 2004, 134, 1887–1893. [Google Scholar] [CrossRef] [Scilit]
- Alves-Rodrigues, A.; Shao, A. The science behind lutein. Toxicol. Lett. 2004, 150, 57–83. [Google Scholar] [CrossRef] [Scilit]
- Ranard, K.M.; Jeon, S.; Mohn, E.S.; Griffiths, J.C.; Johnson, E.J.; Erdman, J.W., Jr. Dietary guidance for lutein: Consideration for intake recommendations is scientifically supported. Eur. J. Nutr. 2017, 56, 37–42. [Google Scholar] [CrossRef] [Scilit]
- Qiu, X.; Gao, D.H.; Xiang, X.; Xiong, Y.F.; Zhu, T.S.; Liu, L.G.; Sun, X.F.; Hao, L.P. Ameliorative effects of lutein on non-alcoholic fatty liver disease in rats. World J. Gastroenterol. 2015, 21, 8061–8072. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Ding, Y.; Niu, Q.; Xu, S.; Pang, L.; Ma, R.; Jing, M.; Feng, G.; Tang, J.X.; Zhang, Q.; et al. Lutein has a protective effect on hepatotoxicity induced by arsenic via Nrf2 signaling. BioMed Res. Int. 2015, 2015, 315205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.H.; Na, H.J.; Kim, C.K.; Kim, J.Y.; Ha, K.S.; Lee, H.; Chung, H.T.; Kwon, H.J.; Kwon, Y.G.; Kim, Y.M. The non-provitamin A carotenoid, lutein, inhibits NF-kappaB-dependent gene expression through redox-based regulation of the phosphatidylinositol 3-kinase/PTEN/Akt and NF-kappaB-inducing kinase pathways: Role of H2O2 in NF-kappaB activation. Free Radic. Biol. Med. 2008, 45, 885–896. [Google Scholar] [CrossRef] [Scilit]
- Sindhu, E.R.; Firdous, A.P.; Preethi, K.C.; Kuttan, R. Carotenoid lutein protects rats from paracetamol-, carbon tetrachloride- and ethanol-induced hepatic damage. J. Pharm. Pharmacol. 2010, 62, 1054–1060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagira, M.; Tomita, M.; Mizuno, S.; Kumata, M.; Ayabe, T.; Hayashi, M. Ischemia/reperfusion injury in the monolayers of human intestinal epithelial cell line caco-2 and its recovery by antioxidants. Drug Metab. Pharmacokinet. 2006, 21, 230–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vieira, M.M.; Paik, J.; Blaner, W.S.; Soares, A.M.; Mota, R.M.; Guerrant, R.L.; Lima, A.A. Carotenoids, retinol, and intestinal barrier function in children from northeastern Brazil. J. Pediatr. Gastroenterol. Nutr. 2008, 47, 652–659. [Google Scholar] [CrossRef] [Scilit]
- Gao, M.; Li, X.; He, L.; Yang, J.; Ye, X.; Xiao, F.; Wei, H. Diammonium Glycyrrhizinate Mitigates Liver Injury Via Inhibiting Proliferation of NKT Cells And Promoting Proliferation of Tregs. Drug Des. Dev. Ther. 2019, 13, 3579–3589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ouyang, B.; Li, Z.; Ji, X.; Huang, J.; Zhang, H.; Jiang, C. The protective role of lutein on isoproterenol-induced cardiac failure rat model through improving cardiac morphology, antioxidant status via positively regulating Nrf2/HO-1 signalling pathway. Pharm. Biol. 2019, 57, 529–535. [Google Scholar] [CrossRef] [Scilit]
- Ge, N.; Liang, H.; Zhao, Y.Y.; Liu, Y.; Gong, A.J.; Zhang, W.L. Aplysin Protects Against Alcohol-Induced Liver Injury Via Alleviating Oxidative Damage and Modulating Endogenous Apoptosis-Related Genes Expression in Rats. J. Food Sci. 2018, 83, 2612–2621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, M.; Sun, J.; Zhao, Y.; Zhang, H.; Li, X.; Zhou, J.; Dang, H.; Zhang, J.; Huang, W.; Qi, C.; et al. Prevention of High-Fat Diet-Induced Hypercholesterolemia by Lactobacillus reuteri Fn041 Through Promoting Cholesterol and Bile Salt Excretion and Intestinal Mucosal Barrier Functions. Front. Nutr. 2022, 9, 851541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, M.; Qi, C.; Yang, L.; Zhang, M.; Wang, H.; She, G.; Yu, R.; Miao, T.; Sun, J. A pregnancy complication-dependent change in SIgA-targeted microbiota during third trimester. Food Funct. 2020, 11, 1513–1524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, W.; Wang, Y.; Liu, Z.; Cheng, H.; Xue, Y. HemI: A toolkit for illustrating heatmaps. PLoS ONE 2014, 9, e111988. [Google Scholar] [CrossRef] [Scilit]
- Lieber, C.S. Relationships between nutrition, alcohol use, and liver disease. Alcohol Res. Health 2003, 27, 220–231. [Google Scholar]
- Aruna, K.; Rukkumani, R.; Varma, P.S.; Menon, V.P. Therapeutic role of Cuminum cyminum on ethanol and thermally oxidized sunflower oil induced toxicity. Phytother. Res. PTR 2005, 19, 416–421. [Google Scholar] [CrossRef] [Scilit]
- Kołota, A.; Głąbska, D.; Oczkowski, M.; Gromadzka-Ostrowska, J. Influence of Alcohol Consumption on Body Mass Gain and Liver Antioxidant Defense in Adolescent Growing Male Rats. Int. J. Environ. Res. Public Health 2019, 16, 2320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Y.W.; Jiang, Y.; Zhang, D.Y.; Wang, M.; Chen, W.S.; Su, H.; Wang, Y.T.; Wan, J.B. Protective effects of Penthorum chinense Pursh against chronic ethanol-induced liver injury in mice. J. Ethnopharmacol. 2015, 161, 92–98. [Google Scholar] [CrossRef] [Scilit]
- Whitfield, J.B. Gamma glutamyl transferase. Crit. Rev. Clin. Lab. Sci. 2001, 38, 263–355. [Google Scholar] [CrossRef] [Scilit]
- El-Kholy, A.A.; Elkablawy, M.A.; El-Agamy, D.S. Lutein mitigates cyclophosphamide induced lung and liver injury via NF-κB/MAPK dependent mechanism. Biomed. Pharmacother. 2017, 92, 519–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- You, M.; Arteel, G.E. Effect of ethanol on lipid metabolism. J. Hepatol. 2019, 70, 237–248. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Su, B.; Fan, S.; Fei, H.; Zhao, W. Protective effect of oligomeric proanthocyanidins against alcohol-induced liver steatosis and injury in mice. Biochem. Biophys. Res. Commun. 2015, 458, 757–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, H.; Liu, S.; Zhao, H.; Liu, Y.; Xue, M.; Zhang, H.; Qiu, X.; Sun, Z.; Liang, H. Protective effects of fucoidan against ethanol-induced liver injury through maintaining mitochondrial function and mitophagy balance in rats. Food Funct. 2021, 12, 3842–3854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, N.; Wang, D.; Luo, G.; Zhou, J.; Tan, Z.; Du, Y.; Xie, H.; Liu, L.; Yang, X.; Hao, L. Lutein attenuates excessive lipid accumulation in differentiated 3T3-L1 cells and abdominal adipose tissue of rats by the SIRT1-mediated pathway. Int. J. Biochem. Cell Biol. 2021, 133, 105932. [Google Scholar] [CrossRef] [Scilit]
- Cioarca-Nedelcu, R.; Atanasiu, V.; Stoian, I. Alcoholic liver disease-from steatosis to cirrhosis—A biochemistry approach. J. Med. Life 2021, 14, 594–599. [Google Scholar] [CrossRef] [Scilit]
- Butura, A.; Nilsson, K.; Morgan, K.; Morgan, T.R.; French, S.W.; Johansson, I.; Schuppe-Koistinen, I.; Ingelman-Sundberg, M. The impact of CYP2E1 on the development of alcoholic liver disease as studied in a transgenic mouse model. J. Hepatol. 2009, 50, 572–583. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Huang, Y.; Su, H.; Zhu, W.; Wei, Y.; Long, Y.; Shi, Y.; Wei, J. The Integrated Analysis of Transcriptomics and Metabolomics Unveils the Therapeutical Effect of Asiatic Acid on Alcoholic Hepatitis in Rats. Inflammation 2022, 45, 1780–1799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Wan, T.; Ye, M.; Qiu, Y.; Pei, L.; Jiang, R.; Pang, N.; Huang, Y.; Liang, B.; Ling, W.; et al. Nicotinamide riboside attenuates alcohol induced liver injuries via activation of SirT1/PGC-1α/mitochondrial biosynthesis pathway. Redox Biol. 2018, 17, 89–98. [Google Scholar] [CrossRef] [Scilit]
- Yin, H.; Hu, M.; Liang, X.; Ajmo, J.M.; Li, X.; Bataller, R.; Odena, G.; Stevens, S.M., Jr.; You, M. Deletion of SIRT1 from hepatocytes in mice disrupts lipin-1 signaling and aggravates alcoholic fatty liver. Gastroenterology 2014, 146, 801–811. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Xue, L.; Li, B.; Zhang, Z.; Tao, S. Vitamin D Protects Against Alcohol-Induced Liver Cell Injury within an NRF2-ALDH2 Feedback Loop. Mol. Nutr. Food Res. 2019, 63, e1801014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rejitha, S.; Prathibha, P.; Indira, M. Nrf2-mediated antioxidant response by ethanolic extract of Sida cordifolia provides protection against alcohol-induced oxidative stress in liver by upregulation of glutathione metabolism. Redox Rep. Commun. Free Radic. Res. 2015, 20, 75–80. [Google Scholar] [CrossRef] [Scilit]
- Gong, P.; Cederbaum, A.I. Nrf2 is increased by CYP2E1 in rodent liver and HepG2 cells and protects against oxidative stress caused by CYP2E1. Hepatology 2006, 43, 144–153. [Google Scholar] [CrossRef] [Scilit]
- Cohen, J.I.; Roychowdhury, S.; DiBello, P.M.; Jacobsen, D.W.; Nagy, L.E. Exogenous thioredoxin prevents ethanol-induced oxidative damage and apoptosis in mouse liver. Hepatology 2009, 49, 1709–1717. [Google Scholar] [CrossRef] [Scilit]
- Hansen, J.M.; Watson, W.H.; Jones, D.P. Compartmentation of Nrf-2 redox control: Regulation of cytoplasmic activation by glutathione and DNA binding by thioredoxin-1. Toxicol. Sci. 2004, 82, 308–317. [Google Scholar] [CrossRef] [Scilit]
- Mandal, P.; Park, P.H.; McMullen, M.R.; Pratt, B.T.; Nagy, L.E. The anti-inflammatory effects of adiponectin are mediated via a heme oxygenase-1-dependent pathway in rat Kupffer cells. Hepatology 2010, 51, 1420–1429. [Google Scholar] [CrossRef] [Scilit]
- Das, S.K.; Vasudevan, D.M. Alcohol-induced oxidative stress. Life Sci. 2007, 81, 177–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Liu, M.; Zhang, C.; Li, S.; Yang, Q.; Zhang, J.; Gong, Z.; Han, J.; Jia, L. Antioxidant Activity and Protective Effects of Enzyme-Extracted Oudemansiella radiata Polysaccharides on Alcohol-Induced Liver Injury. Molecules 2018, 23, 481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, B.; Gao, X.; Liu, B.; Li, Y.; Bai, M.; Zhang, Z.; Xu, E.; Xiong, Z.; Hu, Y. Protective effects of curcumin against chronic alcohol-induced liver injury in mice through modulating mitochondrial dysfunction and inhibiting endoplasmic reticulum stress. Food Nutr. Res. 2019, 63, 147–158. [Google Scholar] [CrossRef] [Scilit]
- Szabo, G. Gut-liver axis in alcoholic liver disease. Gastroenterology 2015, 148, 30–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uesugi, T.; Froh, M.; Arteel, G.E.; Bradford, B.U.; Wheeler, M.D.; Gäbele, E.; Isayama, F.; Thurman, R.G. Role of lipopolysaccharide-binding protein in early alcohol-induced liver injury in mice. J. Immunol. 2002, 168, 2963–2969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boutagy, N.E.; McMillan, R.P.; Frisard, M.I.; Hulver, M.W. Metabolic endotoxemia with obesity: Is it real and is it relevant? Biochimie 2016, 124, 11–20. [Google Scholar] [CrossRef] [Scilit]
- Nowak, A.J.; Relja, B. The Impact of Acute or Chronic Alcohol Intake on the NF-κB Signaling Pathway in Alcohol-Related Liver Disease. Int. J. Mol. Sci. 2020, 21, 9407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takeda, K.; Akira, S. TLR signaling pathways. Semin. Immunol. 2004, 16, 3–9. [Google Scholar] [CrossRef] [Scilit]
- Wardyn, J.D.; Ponsford, A.H.; Sanderson, C.M. Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem. Soc. Trans. 2015, 43, 621–626. [Google Scholar] [CrossRef] [Scilit]
- Keshavarzian, A.; Farhadi, A.; Forsyth, C.B.; Rangan, J.; Jakate, S.; Shaikh, M.; Banan, A.; Fields, J.Z. Evidence that chronic alcohol exposure promotes intestinal oxidative stress, intestinal hyperpermeability and endotoxemia prior to development of alcoholic steatohepatitis in rats. J. Hepatol. 2009, 50, 538–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Förster, C. Tight junctions and the modulation of barrier function in disease. Histochem. Cell Biol. 2008, 130, 55–70. [Google Scholar] [CrossRef] [Scilit]
- Zhong, W.; McClain, C.J.; Cave, M.; Kang, Y.J.; Zhou, Z. The role of zinc deficiency in alcohol-induced intestinal barrier dysfunction. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 298, G625–G633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- March, D.S.; Marchbank, T.; Playford, R.J.; Jones, A.W.; Thatcher, R.; Davison, G. Intestinal fatty acid-binding protein and gut permeability responses to exercise. Eur. J. Appl. Physiol. 2017, 117, 931–941. [Google Scholar] [CrossRef] [Scilit]
- Sato, Y.; Kobayashi, M.; Itagaki, S.; Hirano, T.; Noda, T.; Mizuno, S.; Sugawara, M.; Iseki, K. Protective effect of lutein after ischemia-reperfusion in the small intestine. Food Chem. 2011, 127, 893–898. [Google Scholar] [CrossRef] [Scilit]
- Ogura, W.; Itagaki, S.; Kurokawa, T.; Noda, T.; Hirano, T.; Mizuno, S.; Iseki, K. Protective effect of lutein on ischemia-reperfusion injury in rat small intestine. Biol. Pharm. Bull. 2006, 29, 1764–1766. [Google Scholar] [CrossRef] [Scilit]
- Chang, C.J.; Lin, J.F.; Chang, H.H.; Lee, G.A.; Hung, C.F. Lutein protects against methotrexate-induced and reactive oxygen species-mediated apoptotic cell injury of IEC-6 cells. PLoS ONE 2013, 8, e72553. [Google Scholar] [CrossRef] [Scilit]
- Yan, A.W.; Fouts, D.E.; Brandl, J.; Stärkel, P.; Torralba, M.; Schott, E.; Tsukamoto, H.; Nelson, K.E.; Brenner, D.A.; Schnabl, B. Enteric dysbiosis associated with a mouse model of alcoholic liver disease. Hepatology 2011, 53, 96–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghosh, T.S.; Shanahan, F.; O’Toole, P.W. The gut microbiome as a modulator of healthy ageing. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 565–584. [Google Scholar] [CrossRef] [Scilit]
- Tang, X.; Wang, W.; Hong, G.; Duan, C.; Zhu, S.; Tian, Y.; Han, C.; Qian, W.; Lin, R.; Hou, X. Gut microbiota-mediated lysophosphatidylcholine generation promotes colitis in intestinal epithelium-specific Fut2 deficiency. J. Biomed. Sci. 2021, 28, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuge, A.; Li, S.; Yuan, Y.; Li, B.; Li, L. The synergy of dietary supplements Lactobacillus salivarius LI01 and Bifidobacterium longum TC01 in alleviating liver failure in rats treated with D-galactosamine. Food Funct. 2021, 12, 10239–10252. [Google Scholar] [CrossRef] [Scilit]
- Kim, W.G.; Kim, H.I.; Kwon, E.K.; Han, M.J.; Kim, D.H. Lactobacillus plantarum LC27 and Bifidobacterium longum LC67 mitigate alcoholic steatosis in mice by inhibiting LPS-mediated NF-κB activation through restoration of the disturbed gut microbiota. Food Funct. 2018, 9, 4255–4265. [Google Scholar] [CrossRef] [Scilit]
- Gurwara, S.; Dai, A.; Ajami, N.J.; Graham, D.Y.; White, D.L.; Chen, L.; Jang, A.; Chen, E.; El-Serag, H.B.; Petrosino, J.F.; et al. Alcohol use alters the colonic mucosa-associated gut microbiota in humans. Nutr. Res. 2020, 83, 119–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bjørkhaug, S.T.; Aanes, H.; Neupane, S.P.; Bramness, J.G.; Malvik, S.; Henriksen, C.; Skar, V.; Medhus, A.W.; Valeur, J. Characterization of gut microbiota composition and functions in patients with chronic alcohol overconsumption. Gut Microbes 2019, 10, 663–675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leclercq, S.; Matamoros, S.; Cani, P.D.; Neyrinck, A.M.; Jamar, F.; Stärkel, P.; Windey, K.; Tremaroli, V.; Bäckhed, F.; Verbeke, K.; et al. Intestinal permeability, gut-bacterial dysbiosis, and behavioral markers of alcohol-dependence severity. Proc. Natl. Acad. Sci. USA 2014, 111, E4485–E4493. [Google Scholar] [CrossRef] [Scilit]
- Du, S.Y.; Zhang, Y.L.; Bai, R.X.; Ai, Z.L.; Xie, B.S.; Yang, H.Y. Lutein prevents alcohol-induced liver disease in rats by modulating oxidative stress and inflammation. Int. J. Clin. Exp. Med. 2015, 8, 8785–8793. [Google Scholar]
- Bardag-Gorce, F.; Oliva, J.; Dedes, J.; Li, J.; French, B.A.; French, S.W. Chronic ethanol feeding alters hepatocyte memory which is not altered by acute feeding. Alcohol. Clin. Exp. Res. 2009, 33, 684–692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.; Fan, X.; Miyata, T.; Kim, A.; Cajigas-Du Ross, C.K.; Ray, S.; Huang, E.; Taiwo, M.; Arya, R.; Wu, J.; et al. Recent Advances in Understanding of Pathogenesis of Alcohol-Associated Liver Disease. Annu. Rev. Pathol. 2023, 18, 411–438. [Google Scholar] [CrossRef] [Scilit]
- Ge, N.; Liang, H.; Liu, Y.; Ma, A.G.; Han, L. Protective effect of Aplysin on hepatic injury in ethanol-treated rats. Food Chem. Toxicol. 2013, 62, 361–372. [Google Scholar] [CrossRef] [Scilit]
- Ma, Y.; Li, R.; Liu, Y.; Liu, M.; Liang, H. Protective Effect of Aplysin Supplementation on Intestinal Permeability and Microbiota in Rats Treated with Ethanol and Iron. Nutrients 2018, 10, 681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, W.X.; Manley, S.; Ni, H.M. The emerging role of autophagy in alcoholic liver disease. Exp. Biol. Med. 2011, 236, 546–556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomes, P.G.; Trambly, C.S.; Fox, H.S.; Tuma, D.J.; Donohue, T.M., Jr. Acute and Chronic Ethanol Administration Differentially Modulate Hepatic Autophagy and Transcription Factor EB. Alcohol. Clin. Exp. Res. 2015, 39, 2354–2363. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Wang, S.; Yu, L.; Mueller, J.; Fortunato, F.; Rausch, V.; Mueller, S. H2O2-mediated autophagy during ethanol metabolism. Redox Biol. 2021, 46, 102081. [Google Scholar] [CrossRef] [Scilit]
- Chang, C.J.; Lin, J.F.; Hsiao, C.Y.; Chang, H.H.; Li, H.J.; Chang, H.H.; Lee, G.A.; Hung, C.F. Lutein Induces Autophagy via Beclin-1 Upregulation in IEC-6 Rat Intestinal Epithelial Cells. Am. J. Chin. Med. 2017, 45, 1273–1291. [Google Scholar] [CrossRef] [Scilit]
- Fung, F.K.; Law, B.Y.; Lo, A.C. Lutein Attenuates Both Apoptosis and Autophagy upon Cobalt (II) Chloride-Induced Hypoxia in Rat Műller Cells. PLoS ONE 2016, 11, e0167828. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Scheme | Scoring Criteria | |
|---|---|---|
| The Percentage of Cells that Contain Fat | The Number of Lesions with Inflammation or Cell Necrosis | |
| 1 | ≤25% | 1 |
| 2 | 26 to 50% | ≥2 |
| 3 | 51 to 75% | |
| 4 | ≥75% | |
| Primer Name | Sequence |
|---|---|
| Liver-ADH1 | Forward (5′–3′) GGTGTTGGTCTGTCTGTCGT Reverse (5′–3′) ATGGTGTCAAGACGGCCAAT |
| Liver-ALDH2 | Forward (5′–3′) GCTGACAAGTACCACGGGAA Reverse (5′–3′) CACGTTTCCAGTTGCCAAGG |
| Ileum-Claudin-1 | Forward (5′–3′) GGCTTCGCTGGGATGGATCG Reverse (5′–3′) TGCACTGTATCTGCCCGGTG |
| Ileum-Occludin | Forward (5′–3′) TGTGCTCACAGGTGGTTGCC Reverse (5′–3′) AGACCAAACTGGGCTGGATGC |
| Ileum-ZO-1 | Forward (5′–3′) ACAAGCGCAGCCACAAGCTA Reverse (5′–3′) TGGGCTCCTCCAGGTTGACA |
| β-actin | Forward (5′–3′) AAGTGCGACGTGGACATCCG Reverse (5′–3′) GGGCGGTGATCTCCTTCTGC |
| Group | ALT (U/L) | AST (U/L) | GGT (U/L) | TG (mmol/L) | TC (mmol/L) |
|---|---|---|---|---|---|
| Co | 46.24 ± 2.35 | 38.34 ± 1.50 | 1.90 ± 0.28 | 0.51 ± 0.04 | 1.52 ± 0.07 |
| CoLU | 50.10 ± 4.33 b | 35.34 ± 3.17 bc | 2.10 ± 0.55 | 0.61 ± 0.07 | 1.70 ± 0.17 |
| Et | 64.22 ± 5.87 a | 51.76 ± 2.68 a | 3.10 ± 0.62 | 0.72 ± 0.07 a | 2.28 ± 0.25 a |
| LLU | 58.02 ± 5.33 | 45.26 ± 2.19 | 2.50 ± 0.64 | 0.62 ± 0.04 | 1.54 ± 0.09 |
| MLU | 50.80 ± 5.63 b | 37.25 ± 3.41 bc | 1.30 ± 0.30 | 0.62 ± 0.06 | 1.51 ± 0.12 |
| HLU | 49.71 ± 5.41 b | 39.77 ± 3.15 b | 1.50 ± 0.31 | 0.52 ± 0.05 b | 1.87 ± 0.17 |
| DG | 39.04 ± 2.79 bc | 34.65±1.40 bc | 1.30 ± 0.21 | 0.45 ± 0.03 bcd | 1.69 ± 0.11 |
| Group | TNF-α (pg/mL) | IL-1β (pg/mL) | LBP (mg/mL) | LPS (ng/mL) |
|---|---|---|---|---|
| Co | 9.03 ± 0.54 | 18.87 ± 1.14 | 1.38 ± 0.13 | 143.57 ± 8.27 |
| CoLU | 9.52 ± 0.33 b | 24.49 ± 2.60 b | 1.41 ± 0.08 | 158.05 ± 6.86 |
| Et | 11.43 ± 1.08 a | 31.75 ± 3.26 a | 1.85 ± 0.09 | 174.33 ± 6.81 a |
| LLU | 10.25 ± 0.52 | 27.01 ± 2.92 a | 1.67 ± 0.16 | 166.31 ± 7.14 a |
| MLU | 9.26 ± 0.50 b | 27.78 ± 2.69 a | 1.60 ± 0.12 | 158.79 ± 5.70 |
| HLU | 9.70 ± 0.54 b | 24.26 ± 1.58 b | 1.48 ± 0.12 | 155.79 ± 3.87 b |
| DG | 8.41 ± 0.42 bc | 23.42 ± 2.99 b | 1.47 ± 0.16 | 165.63 ± 5.54 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, S.; Zhang, Y.; Ding, H.; Hu, S.; Wu, X.; Ma, A.; Ma, Y. Lutein Prevents Liver Injury and Intestinal Barrier Dysfunction in Rats Subjected to Chronic Alcohol Intake. Nutrients 2023, 15, 1229. https://doi.org/10.3390/nu15051229
Zhao S, Zhang Y, Ding H, Hu S, Wu X, Ma A, Ma Y. Lutein Prevents Liver Injury and Intestinal Barrier Dysfunction in Rats Subjected to Chronic Alcohol Intake. Nutrients. 2023; 15(5):1229. https://doi.org/10.3390/nu15051229
Chicago/Turabian StyleZhao, Suli, Yebing Zhang, Haoyue Ding, Shouna Hu, Xiaoqing Wu, Aiguo Ma, and Yan Ma. 2023. "Lutein Prevents Liver Injury and Intestinal Barrier Dysfunction in Rats Subjected to Chronic Alcohol Intake" Nutrients 15, no. 5: 1229. https://doi.org/10.3390/nu15051229
APA StyleZhao, S., Zhang, Y., Ding, H., Hu, S., Wu, X., Ma, A., & Ma, Y. (2023). Lutein Prevents Liver Injury and Intestinal Barrier Dysfunction in Rats Subjected to Chronic Alcohol Intake. Nutrients, 15(5), 1229. https://doi.org/10.3390/nu15051229

