Protective Effects of Hydroxyphenyl Propionic Acids on Lipid Metabolism and Gut Microbiota in Mice Fed a High-Fat Diet
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animal Experimental Scheme
2.3. Sample Collection
2.4. Measurements of Serum Biochemicals and Liver Lipids Levels
2.5. Histopathological Examination
2.6. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.7. Gut Microbiota Analysis by 16S rRNA Sequencing
2.8. Measurement of Short Chain Fatty Acids (SCFAs) Content in Feces
2.9. Statistical Analysis
3. Results
3.1. HPPs Reduced BW and Liver Index in HFD Mice
3.2. HPPs Improved Hepatic Steatosis and Ameliorated Liver Injury
3.3. HPPs Affected the Maker Levels in Serum
3.4. HPPs Influenced the α and β Diversity of Gut Microbiota
3.5. HPPs Modulated the Composition of Gut Flora
3.6. HPPs Affected the Predicted Functions and SCFAs Production of Gut Flora
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Powell, E.E.; Wong, V.W.S.; Rinella, M. Non-alcoholic fatty liver disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef] [PubMed]
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef] [PubMed]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef] [PubMed]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Yu, X.H.; Ou, X.; Ouyang, X.P.; Tang, C.K. Hepatic cholesterol transport and its role in non-alcoholic fatty liver disease and atherosclerosis. Prog. Lipid Res. 2021, 83, 101109. [Google Scholar] [CrossRef]
- Sonnenburg, J.L.; Bäckhed, F. Diet–microbiota interactions as moderators of human metabolism. Nature 2016, 535, 56–64. [Google Scholar] [CrossRef]
- Schoeler, M.; Caesar, R. Dietary lipids, gut microbiota and lipid metabolism. Rev. Endocr. Metab. Disord. 2019, 20, 461–472. [Google Scholar] [CrossRef] [Green Version]
- Sanyal, A.J. Past, present and future perspectives in nonalcoholic fatty liver disease. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 377–386. [Google Scholar] [CrossRef]
- Kolodziejczyk, A.A.; Zheng, D.P.; Shibolet, O.; Elinav, E. The role of the microbiome in NAFLD and NASH. Embo Mol. Med. 2019, 11, e9302. [Google Scholar] [CrossRef]
- Aron-Wisnewsky, J.; Vigliotti, C.; Witjes, J.; Le, P.; Holleboom, A.G.; Verheij, J.; Nieuwdorp, M.; Clement, K. Gut microbiota and human NAFLD: Disentangling microbial signatures from metabolic disorders. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 279–297. [Google Scholar] [CrossRef]
- Demir, M.; Lang, S.; Hartmann, P.; Duan, Y.; Martin, A.; Miyamoto, Y.; Bondareva, M.; Zhang, X.; Wang, Y.; Kasper, P.; et al. The fecal mycobiome in non-alcoholic fatty liver disease. J. Hepatol. 2022, 76, 788–799. [Google Scholar] [CrossRef]
- Zhuge, A.; Li, S.; Lou, P.; Wu, W.; Wang, K.; Yuan, Y.; Xia, J.; Li, B.; Li, L. Longitudinal 16S rRNA sequencing reveals relationships among alterations of gut microbiota and nonalcoholic fatty liver disease progression in mice. Microbiol. Spectr. 2022, 10, 47–52. [Google Scholar] [CrossRef]
- Rabot, S.; Membrez, M.; Bruneau, A.; Gerard, P.; Harach, T.; Moser, M.; Raymond, F.; Mansourian, R.; Chou, C.J. Germ-free C57BL/6J mice are resistant to high-fat-diet-induced insulin resistance and have altered cholesterol metabolism. Faseb J. 2010, 24, 4948–4959. [Google Scholar]
- Safari, Z.; Gerard, P. The links between the gut microbiome and non-alcoholic fatty liver disease (NAFLD). Cell. Mol. Life Sci. 2019, 76, 1541–1558. [Google Scholar] [CrossRef]
- Whitfield, C.; Trent, M.S. Biosynthesis and export of bacterial lipopolysaccharides. Annu. Rev. Biochem. 2014, 83, 99–128. [Google Scholar] [CrossRef]
- Kessoku, T.; Kobayashi, T.; Tanaka, K.; Yamamoto, A.; Takahashi, K.; Iwaki, M.; Ozaki, A.; Kasai, Y.; Nogami, A.; Honda, Y.; et al. The role of leaky gut in nonalcoholic fatty liver disease: A novel therapeutic target. Int. J. Mol. Sci. 2021, 22, 8161. [Google Scholar] [CrossRef]
- Chen, X.; Zhang, C.; Zhao, M.; Shi, C.-E.; Zhu, R.-M.; Wang, H.; Zhao, H.; Wei, W.; Li, J.-B.; Xu, D.-X. Melatonin alleviates lipopolysaccharide-induced hepatic SREBP-1c activation and lipid accumulation in mice. J. Pineal Res. 2011, 51, 416–425. [Google Scholar] [CrossRef]
- Ohtani, N.; Hara, E. Gut-liver axis-mediated mechanism of liver cancer: A special focus on the role of gut microbiota. Cancer Sci. 2021, 112, 4433–4443. [Google Scholar] [CrossRef]
- Kimura, I.; Ozawa, K.; Inoue, D.; Imamura, T.; Kimura, K.; Maeda, T.; Terasawa, K.; Kashihara, D.; Hirano, K.; Tani, T.; et al. The gut microbiota suppresses insulin-mediated fat accumulation via the short-chain fatty acid receptor GPR43. Nat. Commun. 2013, 4, 1829. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Gao, J.; Ke, W.; Wang, J.; Li, D.; Liu, R.; Jia, Y.; Wang, X.; Chen, X.; Chen, F.; et al. Resveratrol reduces obesity in high-fat diet-fed mice via modulating the composition and metabolic function of the gut microbiota. Free Radic. Biol. Med. 2020, 156, 83–98. [Google Scholar] [CrossRef]
- Cui, Q.L.; Pan, Y.N.; Zhang, W.; Zhang, Y.A.; Ren, S.M.; Wang, D.M.; Wang, Z.Z.; Liu, X.Q.; Xiao, W. Metabolites of dietary acteoside: Profiles, isolation, identification, and hepatoprotective capacities. J. Agric. Food Chem. 2018, 66, 2660–2668. [Google Scholar] [CrossRef] [PubMed]
- Selma, M.V.; Espín, J.C.; Tomás-Barberán, F.A. Interaction between phenolics and gut microbiota: Role in human health. J. Agric. Food Chem. 2009, 57, 6485–6501. [Google Scholar] [CrossRef] [PubMed]
- Monagas, M.; Urpi-Sarda, M.; Sánchez-Patán, F.; Llorach, R.; Garrido, I.; Gómez-Cordovés, C.; Andres-Lacueva, C.; Bartolomé, B. Insights into the metabolism and microbial biotransformation of dietary flavan-3-ols and the bioactivity of their metabolites. Food Funct. 2010, 1, 233–253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ward, N.C.; Croft, K.D.; Puddey, I.B.; Hodgson, J.M. Supplementation with grape seed polyphenols results in increased urinary excretion of 3-hydroxyphenylpropionic Acid, an important metabolite of proanthocyanidins in humans. J. Agric. Food Chem. 2004, 52, 5545–5549. [Google Scholar] [CrossRef]
- Khairudin, M.A.S.; Mhd Jalil, A.M.; Hussin, N. Effects of polyphenols in tea (Camellia sinensis sp.) on the modulation of gut microbiota in human trials and animal studies. Gastroenterol. Insights 2021, 12, 202–216. [Google Scholar] [CrossRef]
- Shen, L.; Ji, H.-F. Reciprocal interactions between resveratrol and gut microbiota deepen our understanding of molecular mechanisms underlying its health benefits. Trends Food Sci. Technol. 2018, 81, 232–236. [Google Scholar] [CrossRef]
- Makarewicz, M.; Drozdz, I.; Tarko, T.; Duda-Chodak, A. The interactions between polyphenols and microorganisms, especially gut microbiota. Antioxidants 2021, 10, 188. [Google Scholar] [CrossRef]
- Guo, J.L.; Wang, P.; Cui, Y.F.; Hu, X.S.; Chen, F.; Ma, C. Alleviation effects of microbial metabolites from resveratrol on non-alcoholic fatty liver disease. Foods 2023, 12, 94. [Google Scholar] [CrossRef]
- Wang, J.; Wang, P.; Li, D.; Hu, X.; Chen, F. Beneficial effects of ginger on prevention of obesity through modulation of gut microbiota in mice. Eur. J. Nutr. 2020, 59, 699–718. [Google Scholar] [CrossRef]
- Ke, W.X.; Wang, P.; Wang, X.H.; Zhou, X.L.; Hu, X.S.; Chen, F. Dietary platycodon grandiflorus attenuates hepatic insulin resistance and oxidative stress in high-fat-diet induced non-alcoholic fatty liver disease. Nutrients 2020, 12, 480. [Google Scholar] [CrossRef] [Green Version]
- Li, D.; Feng, Y.; Tian, M.; Ji, J.; Hu, X.; Chen, F. Gut microbiota-derived inosine from dietary barley leaf supplementation attenuates colitis through PPAR gamma signaling activation. Microbiome 2021, 9, 83. [Google Scholar] [CrossRef]
- Hsu, Y.-L.; Chen, C.-C.; Lin, Y.-T.; Wu, W.-K.; Chang, L.-C.; Lai, C.-H.; Wu, M.-S.; Kuo, C.-H. Evaluation and optimization of sample handling methods for quantification of short-chain fatty acids in human fecal samples by GC-MS. J. Proteome Res. 2019, 18, 1948–1957. [Google Scholar] [CrossRef]
- He, M.M.; Fang, Z.; Hang, D.; Wang, F.; Polychronidis, G.; Wang, L.; Lo, C.H.; Wang, K.; Zhong, R.; Knudsen, M.D.; et al. Circulating liver function markers and colorectal cancer risk: A prospective cohort study in the UK Biobank. Int. J. Cancer 2021, 148, 1867–1878. [Google Scholar] [CrossRef]
- Martin, A.; Lang, S.; Goeser, T.; Demir, M.; Steffen, H.M.; Kasper, P. Management of dyslipidemia in patients with non-alcoholic fatty liver disease. Curr. Atheroscler. Rep. 2022, 24, 533–546. [Google Scholar] [CrossRef]
- Fei, N.; Bruneau, A.; Zhang, X.J.; Wang, R.R.; Wang, J.X.; Rabot, S.; Gerard, P.; Zhao, L.P. Endotoxin producers overgrowing in human gut microbiota as the causative agents for nonalcoholic fatty liver disease. Mbio 2020, 11, e03263-19. [Google Scholar] [CrossRef] [Green Version]
- Backhed, F.; Ding, H.; Wang, T.; Hooper, L.V.; Koh, G.Y.; Nagy, A.; Semenkovich, C.F.; Gordon, J.I. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. USA 2004, 101, 15718–15723. [Google Scholar] [CrossRef] [Green Version]
- Younossi, Z.; Tacke, F.; Arrese, M.; Sharma, B.C.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Sun, W.; Yilmaz, Y.; George, J.; et al. Global perspectives on nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef] [Green Version]
- Ryan, M.C.; Wilson, A.M.; Slavin, J.; Best, J.D.; Jenkins, A.J.; Desmond, P.V. Associations between liver histology and severity of the metabolic syndrome in subjects with nonalcoholic fatty liver disease. Diabetes Care 2005, 28, 1222–1224. [Google Scholar] [CrossRef] [Green Version]
- Zhu, M.Z.; Hao, S.J.; Liu, T.; Yang, L.L.; Zheng, P.Y.; Zhang, L.; Ji, G. Lingguizhugan decoction improves non-alcoholic fatty liver disease by altering insulin resistance and lipid metabolism related genes: A whole trancriptome study by RNA-Seq. Oncotarget 2017, 8, 82621–82631. [Google Scholar] [CrossRef] [Green Version]
- Mu, H.N.; Zhou, Q.; Yang, R.Y.; Tang, W.Q.; Li, H.X.; Wang, S.M.; Li, J.; Chen, W.X.; Dong, J. Caffeic acid prevents non-alcoholic fatty liver disease induced by a high-fat diet through gut microbiota modulation in mice. Food Res. Int. 2021, 143, 110240. [Google Scholar] [CrossRef]
- Shi, A.M.; Li, T.; Zheng, Y.; Song, Y.H.; Wang, H.T.; Wang, N.; Dong, L.; Shi, H.T. Chlorogenic Acid Improves NAFLD by Regulating gut Microbiota and GLP-1. Front. Pharmacol. 2021, 12, 693048. [Google Scholar] [CrossRef] [PubMed]
- Montaigne, D.; Butruille, L.; Staels, B. PPAR control of metabolism and cardiovascular functions. Nat. Rev. Cardiol. 2021, 18, 809–823. [Google Scholar] [CrossRef] [PubMed]
- Chi, Y.; Wu, Z.; Du, C.; Zhang, M.; Wang, X.; Xie, A.; Wang, P.; Li, R. Regulatory effects mediated by ulvan oligosaccharide and its zinc complex on lipid metabolism in high-fat diet-fed mice. Carbohydr. Polym. 2023, 300, 120249. [Google Scholar] [CrossRef] [PubMed]
- Nalbantoglu, I.; Brunt, E.M. Role of liver biopsy in nonalcoholic fatty liver disease. World J. Gastroenterol. 2014, 20, 9026–9037. [Google Scholar]
- Leung, C.; Rivera, L.; Furness, J.B.; Angus, P.W. The role of the gut microbiota in NAFLD. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 412–425. [Google Scholar] [CrossRef]
- Shen, F.; Zheng, R.D.; Sun, X.Q.; Ding, W.J.; Wang, X.Y.; Fan, J.G. Gut microbiota dysbiosis in patients with non-alcoholic fatty liver disease. Hepatobiliary Pancreat. Dis. Int. 2017, 16, 375–381. [Google Scholar] [CrossRef]
- Hu, W.B.; Gao, W.Y.; Liu, Z.M.; Fang, Z.F.; Wang, H.C.; Zhao, J.X.; Zhang, H.; Lu, W.W.; Chen, W. Specific strains of Faecalibacterium prausnitzii ameliorate nonalcoholic fatty liver disease in mice in association with gut microbiota regulation. Nutrients 2022, 14, 2945. [Google Scholar] [CrossRef]
- Wan, F.; Han, H.; Zhong, R.Q.; Wang, M.Y.; Tang, S.L.; Zhang, S.F.; Hou, F.J.; Yi, B.; Zhang, H.F. Dihydroquercetin supplement alleviates colonic inflammation potentially through improved gut microbiota community in mice. Food Funct. 2021, 12, 11420–11434. [Google Scholar] [CrossRef]
- Liu, S.L.; Dai, J.J.; Lan, X.; Fan, B.B.; Dong, T.Y.; Zhang, Y.; Han, M.Y. Intestinal bacteria are potential biomarkers and therapeutic targets for gastric cancer. Microb. Pathog. 2021, 151, 104747. [Google Scholar] [CrossRef]
- Vacca, M.; Celano, G.; Calabrese, F.M.; Portincasa, P.; Gobbetti, M.; De Angelis, M. The controversial role of human gut Lachnospiraceae. Microorganisms 2020, 8, 573. [Google Scholar] [CrossRef]
- Shi, H.J.; Chang, Y.G.; Gao, Y.; Wang, X.; Chen, X.; Wang, Y.M.; Xue, C.H.; Tang, Q.J. Dietary fucoidan of Acaudina molpadioides alters gut microbiota and mitigates intestinal mucosal injury induced by cyclophosphamide. Food Funct. 2017, 8, 3383–3393. [Google Scholar] [CrossRef]
- Cai, W.; Xu, J.X.; Li, G.; Liu, T.; Guo, X.L.; Wang, H.J.; Luo, L.P. Ethanol extract of propolis prevents high-fat diet-induced insulin resistance and obesity in association with modulation of gut microbiota in mice. Food Res. Int. 2020, 130, 108939. [Google Scholar] [CrossRef]
- Wang, S.M.; Ishima, T.; Qu, Y.; Shan, J.J.; Chang, L.J.; Wei, Y.; Zhang, J.C.; Pu, Y.Y.; Fujita, Y.; Tan, Y.F.; et al. Ingestion of Faecalibaculum rodentium causes depression-like phenotypes in resilient Ephx2 knock-out mice: A role of brain-gut-microbiota axis via the subdiaphragmatic vagus nerve. J. Affect. Disord. 2021, 292, 565–573. [Google Scholar] [CrossRef]
- Cueva, C.; Victoria Moreno-Arribas, M.; Martin-Alvarez, P.J.; Bills, G.; Francisca Vicente, M.; Basilio, A.; Lopez Rivas, C.; Requena, T.; Rodriguez, J.M.; Bartolome, B. Antimicrobial activity of phenolic acids against commensal, probiotic and pathogenic bacteria. Res. Microbiol. 2010, 161, 372–382. [Google Scholar] [CrossRef]
- Schoenfeld, P.; Wojtczak, L. Short- and medium-chain fatty acids in energy metabolism: The cellular perspective. J. Lipid Res. 2016, 57, 943–954. [Google Scholar] [CrossRef] [Green Version]
- den Besten, G.; Bleeker, A.; Gerding, A.; van Eunen, K.; Havinga, R.; van Dijk, T.H.; Oosterveer, M.H.; Jonker, J.W.; Groen, A.K.; Reijngoud, D.-J.; et al. Short-chain fatty acids protect against high-fat diet-induced obesity via a PPAR-dependent switch from lipogenesis to fat oxidation. Diabetes 2015, 64, 2398–2408. [Google Scholar] [CrossRef] [Green Version]
- Wu, S.S.; Hu, R.Z.; Nakano, H.; Chen, K.Y.; Liu, M.; He, X.; Zhang, H.F.; He, J.H.; Hou, D.X. Modulation of gut microbiota by Lonicera caerulea L. Berry polyphenols in a mouse model of fatty liver induced by high fat diet. Molecules 2018, 23, 3213. [Google Scholar] [CrossRef] [Green Version]
- Zhou, D.; Pan, Q.; Xin, F.-Z.; Zhang, R.-N.; He, C.-X.; Chen, G.-Y.; Liu, C.; Chen, Y.-W.; Fan, J.-G. Sodium butyrate attenuates high-fat diet-induced steatohepatitis in mice by improving gut microbiota and gastrointestinal barrier. World J. Gastroenterol. 2017, 23, 60–75. [Google Scholar] [CrossRef]
- Yang, W.; Yu, T.; Huang, X.; Bilotta, A.J.; Xu, L.; Lu, Y.; Sun, J.; Pan, F.; Zhou, J.; Zhang, W.; et al. Intestinal microbiota-derived short-chain fatty acids regulation of immune cell IL-22 production and gut immunity. Nat. Commun. 2020, 11, 4457. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
fasn | ATGAGCGCACCTTTGATGAC | GATGCCGTCAGGTTTCAGTC |
acaca | ATGTCTGGCTTGCACCTAGT | ATCGCATGCATTTCACTGCT |
thrsp | ACCTAGAAGCCCAGTTCCAC | CTACAGAACCTGCCCTGTCA |
elovl6 | GTGCAGAGGCTTGAGAAGTG | TAATCTCCGCAGGCCCTTAG |
dgat1 | GTGCCATCGTCTGCAAGATT | GATCAGCATCACCACACACC |
dgat2 | CTTCTCTGTCACCTGGCTCA | CGTGTTCCAGTCAAATGCCA |
sqle | TCGCTGCCTTCTCGGATATT | CTGAGGTAGCTGCTCCTGTT |
acly | GCCAAGACCATCCTCTCACT | GAAGTTTGCAATGCTGCCT |
ppara | TACTGCCGTTTTCACAAGTGC | AGGTCGTGTTCACAGGTAAGA |
gapdh | AACGGATTTGGCCGTATTGG | CATTCTCGGCCTTGACTGTG |
Parameter | ND | HFD | 3-HPP | 4-HPP |
---|---|---|---|---|
TC (mg/dL) | 2.07 ± 0.32 c | 6.26 ± 0.13 a | 5.31 ± 0.12 b | 4.99 ± 0.18 b |
TG (mg/dL) | 0.81 ± 0.19 c | 1.37 ± 0.07 a | 1.02 ± 0.05 b | 0.99 ± 0.03 b |
HDL-c (mmol/L) | 1.25 ± 0.39 b | 4.06 ± 0.08 a | 3.59 ± 0.06 a | 3.59 ± 0.05 a |
LDL-c (mmol/L) | 0.42 ± 0.06 c | 1.18 ± 0.24 a | 1.04 ± 0.36 a,b | 0.92 ± 0.07 b |
Endotoxin (ng/L) | 179.28 ± 5.28 c | 359.61 ± 8.29 a | 240.05 ± 13.66 b | 236.83 ± 14.51 b |
FFA (mmol/L) | 1.27 ± 0.20 a,b | 1.44 ± 0.07 a | 1.17 ± 0.14 b | 1.12 ± 0.18 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, J.; Wang, P.; Cui, Y.; Hu, X.; Chen, F.; Ma, C. Protective Effects of Hydroxyphenyl Propionic Acids on Lipid Metabolism and Gut Microbiota in Mice Fed a High-Fat Diet. Nutrients 2023, 15, 1043. https://doi.org/10.3390/nu15041043
Guo J, Wang P, Cui Y, Hu X, Chen F, Ma C. Protective Effects of Hydroxyphenyl Propionic Acids on Lipid Metabolism and Gut Microbiota in Mice Fed a High-Fat Diet. Nutrients. 2023; 15(4):1043. https://doi.org/10.3390/nu15041043
Chicago/Turabian StyleGuo, Jingling, Pan Wang, Yifan Cui, Xiaosong Hu, Fang Chen, and Chen Ma. 2023. "Protective Effects of Hydroxyphenyl Propionic Acids on Lipid Metabolism and Gut Microbiota in Mice Fed a High-Fat Diet" Nutrients 15, no. 4: 1043. https://doi.org/10.3390/nu15041043