Luteolin Attenuates Hypertension via Inhibiting NF-κB-Mediated Inflammation and PI3K/Akt Signaling Pathway in the Hypothalamic Paraventricular Nucleus
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal
2.2. Methods of Administration to PVN
2.3. Animal Treatments
2.4. Measurement of SBP, DBP and MAP
2.5. Immunofluorescence Staining
2.6. Dihydroethidium Staining
2.7. Real-Time Quantitative PCR
2.8. Biochemical Assays
2.9. Western Blotting
2.10. Statistical Analysis
3. Results
3.1. Luteolin Improved Elevated Blood Pressure and Heart Rate in SHRs
3.2. Luteolin Reduced the Circulating Levels of NE and EPI
3.3. Luteolin Alleviated Oxidative Stress in the PVN of SHRs
3.4. Luteolin Reduced the Levels of Inflammatory Cytokines in the PVN of SHRs
3.5. Luteolin Decreased the Activity of NF-κB in the PVN of SHRs
3.6. Luteolin Reduced the Production of TH in the PVN of SHRs
3.7. Luteolin Decreased the Production of GAD67 in the PVN of SHRs
3.8. Luteolin Lowered the Levels of p-PI3K and p-Akt in the PVN of SHRs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| aCSF | artificial cerebrospinal fluid |
| DBP | diastolic blood pressure |
| DHE | Dihydroethidium |
| EPI | epinephrine |
| GAD67 | 67-kDa isoform of glutamate decarboxylase |
| HR | heart rate |
| IL-1β | interleukin 1β |
| IL-6 | interleukin 6 |
| MAP | mean arterial pressure |
| NE | plasma norepinephrine |
| NF-κB | nuclear factor κB |
| p-AKT | Phosphorylated protein kinase-B |
| p-PI3K | phosphatidylinositol 3-kinase |
| PVN | the hypothalamic paraventricular nucleus |
| ROS | reactive oxygen species |
| SBP | systolic blood pressure |
| SHR | spontaneously hypertensive rat |
| SOD1 | superoxide dismutase (SOD1) |
| TH | tyrosine hydroxylase |
| WKY | Wistar Kyoto |
References
- Ge, W.; Guo, X.; Song, X.; Pang, J.; Zou, X.; Liu, Y.; Niu, Y.; Li, Z.; Zhao, H.; Gao, R.; et al. The role of immunoglobulin E and mast cells in hypertension. Cardiovasc. Res. 2022, 118, 2985–2999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.T.; Azali, L.; Rosen, L.; Zhao, Q.; Wiczer, T.; Palettas, M.; Gambril, J.; Kola-Kehinde, O.; Ruz, P.; Kalathoor, S.; et al. Hypertension and incident cardiovascular events after next-generation BTKi therapy initiation. J. Hematol. Oncol. 2022, 15, 92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richards, E.M.; Li, J.; Stevens, B.R.; Pepine, C.J.; Raizada, M.K. Gut Microbiome and Neuroinflammation in Hypertension. Circ. Res. 2022, 130, 401–417. [Google Scholar] [CrossRef] [Scilit]
- Bi, Q.; Wang, C.; Cheng, G.; Chen, N.; Wei, B.; Liu, X.; Li, L.; Lu, C.; He, J.; Weng, Y.; et al. Microglia-derived PDGFB promotes neuronal potassium currents to suppress basal sympathetic tonicity and limit hypertension. Immunity 2022, 55, 1466–1482 e1469. [Google Scholar] [CrossRef] [Scilit]
- Chao, Y.M.; Tain, Y.L.; Lee, W.C.; Wu, K.L.H.; Yu, H.R.; Chan, J.Y.H. Protection by -Biotics against Hypertension Programmed by Maternal High Fructose Diet: Rectification of Dysregulated Expression of Short-Chain Fatty Acid Receptors in the Hypothalamic Paraventricular Nucleus of Adult Offspring. Nutrients 2022, 14, 4306. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Woods, C.; Johnson, M.A.; Milner, T.A.; Glass, M.J. Angiotensin II Infusion Results in Both Hypertension and Increased AMPA GluA1 Signaling in Hypothalamic Paraventricular Nucleus of Male but not Female Mice. Neuroscience 2022, 485, 129–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, X.J.; Liu, X.J.; Guo, J.; Su, Y.K.; Zhang, N.; Qi, J.; Li, Y.; Fu, L.Y.; Liu, K.L.; Li, Y.; et al. Blockade of Microglial Activation in Hypothalamic Paraventricular Nucleus Improves High Salt-Induced Hypertension. Am. J. Hypertens. 2022, 35, 820–827. [Google Scholar] [CrossRef] [Scilit]
- Su, Q.; Yu, X.J.; Wang, X.M.; Peng, B.; Bai, J.; Li, H.B.; Li, Y.; Xia, W.J.; Fu, L.Y.; Liu, K.L.; et al. Na(+)/K(+)-ATPase Alpha 2 Isoform Elicits Rac1-Dependent Oxidative Stress and TLR4-Induced Inflammation in the Hypothalamic Paraventricular Nucleus in High Salt-Induced Hypertension. Antioxidants 2022, 11, 288. [Google Scholar] [CrossRef] [Scilit]
- Wang, K.; You, S.; Hu, H.; Li, X.; Yin, J.; Shi, Y.; Qi, L.; Li, P.; Zhao, Y.; Yan, S. Effect of TLR4/MyD88/NF-kB axis in paraventricular nucleus on ventricular arrhythmias induced by sympathetic hyperexcitation in post-myocardial infarction rats. J. Cell. Mol. Med. 2022, 26, 2959–2971. [Google Scholar] [CrossRef] [Scilit]
- Qi, J.; Fu, L.Y.; Liu, K.L.; Li, R.J.; Qiao, J.A.; Yu, X.J.; Yu, J.Y.; Li, Y.; Feng, Z.P.; Yi, Q.Y.; et al. Resveratrol in the Hypothalamic Paraventricular Nucleus Attenuates Hypertension by Regulation of ROS and Neurotransmitters. Nutrients 2022, 14, 4177. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Pan, B.; Zhang, Z.; Li, X.; Leng, Y.; Ji, Y.; Sun, K.; Chen, A.F. Caspase-4/11-Mediated Pulmonary Artery Endothelial Cell Pyroptosis Contributes to Pulmonary Arterial Hypertension. Hypertension 2022, 79, 536–548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, Y.; Fan, Y.; He, Q.; Li, Y.; Wu, D.; Jiang, E. Exogenous H2S Ameliorates High Salt-Induced Hypertension by Alleviating Oxidative Stress and Inflammation in the Paraventricular Nucleus in Dahl S Rats. Cardiovasc. Toxicol. 2022, 22, 477–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, X.; Jiao, P.L.; Wang, Y.K.; Wu, Z.T.; Zeng, X.R.; Li, M.L.; Wang, W.Z. The phosphoinositide-3 kinase signaling is involved in neuroinflammation in hypertensive rats. Cns Neurosci. Ther. 2017, 23, 350–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Duan, H.; Liu, Q.; Umar, M.; Luo, W.; Yang, X.; Zhu, J.; Li, M. Construction of a Pichia pastoris strain efficiently secreting irisin and assessment of its bioactivity in HepG2 cells. Int. J. Biol. Macromol. 2019, 124, 60–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veerasingham, S.J.; Yamazato, M.; Berecek, K.H.; Wyss, J.M.; Raizada, M.K. Increased PI3-kinase in presympathetic brain areas of the spontaneously hypertensive rat. Circ. Res. 2005, 96, 277–279. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.S.; Cui, Y.; Zheng, J.X.; Quan, Y.Q.; Wu, S.X.; Xu, H.; Han, Y. Luteolin relieves lung cancer-induced bone pain by inhibiting NLRP3 inflammasomes and glial activation in the spinal dorsal horn in mice. Phytomedicine 2022, 96, 153910. [Google Scholar] [CrossRef] [Scilit]
- Lopez-Lazaro, M. Distribution and biological activities of the flavonoid luteolin. Mini Rev. Med. Chem. 2009, 9, 31–59. [Google Scholar] [CrossRef] [Scilit]
- Gao, H.L.; Yu, X.J.; Hu, H.B.; Yang, Q.W.; Liu, K.L.; Chen, Y.M.; Zhang, Y.; Zhang, D.D.; Tian, H.; Zhu, G.Q.; et al. Apigenin Improves Hypertension and Cardiac Hypertrophy Through Modulating NADPH Oxidase-Dependent ROS Generation and Cytokines in Hypothalamic Paraventricular Nucleus. Cardiovasc. Toxicol. 2021, 21, 721–736. [Google Scholar] [CrossRef] [Scilit]
- Yu, X.J.; Xin, G.R.; Liu, K.L.; Liu, X.J.; Fu, L.Y.; Qi, J.; Kang, K.B.; Meng, T.T.; Yi, Q.Y.; Li, Y.; et al. Paraventricular Nucleus Infusion of Oligomeric Proantho Cyanidins Improves Renovascular Hypertension. Front. Neurosci. 2021, 15, 642015. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Park, T.J.; Park, J.S.; Kim, M.S.; Chi, W.J.; Kim, S.Y. Luteolin-3’-O-Phosphate Inhibits Lipopolysaccharide-Induced Inflammatory Responses by Regulating NF-kappaB/MAPK Cascade Signaling in RAW 264.7 Cells. Molecules 2021, 26, 7393. [Google Scholar] [CrossRef] [Scilit]
- Zhou, W.; Hu, M.; Hu, J.; Du, Z.; Su, Q.; Xiang, Z. Luteolin Suppresses Microglia Neuroinflammatory Responses and Relieves Inflammation-Induced Cognitive Impairments. Neurotox. Res. 2021, 39, 1800–1811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Y.Z.; Peng, C.W.; Su, Z.Q.; Huang, H.T.; Liu, X.H.; Zhan, S.F.; Huang, X.F. A Practical Strategy for Exploring the Pharmacological Mechanism of Luteolin Against COVID-19/Asthma Comorbidity: Findings of System Pharmacology and Bioinformatics Analysis. Front. Immunol. 2021, 12, 769011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Juszczak, A.M.; Woelfle, U.; Koncic, M.Z.; Tomczyk, M. Skin cancer, including related pathways and therapy and the role of luteolin derivatives as potential therapeutics. Med. Res. Rev. 2022, 42, 1423–1462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, Y.; Huang, Z.; Chen, M.; Mo, Y.; Mo, Z. Luteolin Potentially Treating Prostate Cancer and COVID-19 Analyzed by the Bioinformatics Approach: Clinical Findings and Drug Targets. Front. Endocrinol. 2021, 12, 802447. [Google Scholar] [CrossRef] [Scilit]
- Tang, L.; Gao, J.; Li, X.; Cao, X.; Zhou, B. Molecular Mechanisms of Luteolin Against Atopic Dermatitis Based on Network Pharmacology and in vivo Experimental Validation. Drug Des. Dev. Ther. 2022, 16, 4205–4221. [Google Scholar] [CrossRef] [Scilit]
- Qi, Y.; Fu, S.; Pei, D.; Fang, Q.; Xin, W.; Yuan, X.; Cao, Y.; Shu, Q.; Mi, X.; Luo, F. Luteolin attenuated cisplatin-induced cardiac dysfunction and oxidative stress via modulation of Keap1/Nrf2 signaling pathway. Free Radic. Res. 2022, 56, 209–221. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Wang, J.; Lin, Y.; Chen, J.; Liu, J.; Zhang, X. Nutritional activities of luteolin in obesity and associated metabolic diseases: An eye on adipose tissues. Crit. Rev. Food Sci. Nutr. 2022, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Tian, H.; Kang, Y.M.; Gao, H.L.; Shi, X.L.; Fu, L.Y.; Li, Y.; Jia, X.Y.; Liu, K.L.; Qi, J.; Li, H.O.; et al. Chronic infusion of berberine into the hypothalamic paraventricular nucleus attenuates hypertension and sympathoexcitation via the ROS/Erk1/2/iNOS pathway. Phytomedicine 2019, 52, 216–224. [Google Scholar] [CrossRef] [Scilit]
- Li, H.B.; Qin, D.N.; Ma, L.; Miao, Y.W.; Zhang, D.M.; Lu, Y.; Song, X.A.; Zhu, G.Q.; Kang, Y.M. Chronic infusion of lisinopril into hypothalamic paraventricular nucleus modulates cytokines and attenuates oxidative stress in rostral ventrolateral medulla in hypertension. Toxicol. Appl. Pharmacol. 2014, 279, 141–149. [Google Scholar] [CrossRef] [Scilit]
- Sun, W.; Wang, X.; Hou, C.; Yang, L.; Li, H.; Guo, J.; Huo, C.; Wang, M.; Miao, Y.; Liu, J.; et al. Oleuropein improves mitochondrial function to attenuate oxidative stress by activating the Nrf2 pathway in the hypothalamic paraventricular nucleus of spontaneously hypertensive rats. Neuropharmacology 2017, 113, 556–566. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.L.; Bo, J.H.; Zheng, F.; Zhang, F.; Chen, Q.; Li, Y.H.; Kang, Y.M.; Zhu, G.Q. Salusin-beta in Intermediate Dorsal Motor Nucleus of the Vagus Regulates Sympathetic-Parasympathetic Balance and Blood Pressure. Biomedicines 2021, 9, 1118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.B.; Xu, M.L.; Du, M.M.; Yu, X.J.; Bai, J.; Xia, W.J.; Dai, Z.M.; Li, C.X.; Li, Y.; Su, Q.; et al. Curcumin ameliorates hypertension via gut-brain communication in spontaneously hypertensive rat. Toxicol. Appl. Pharmacol. 2021, 429, 115701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Lu, Y.X.; Chi, H.L.; Xiao, T.; Chen, Y.M.; Fu, L.Y.; Zibrila, A.I.; Qi, J.; Li, H.B.; Su, Q.; et al. Chronic Blockade of NMDAR Subunit 2A in the Hypothalamic Paraventricular Nucleus Alleviates Hypertension Through Suppression of MEK/ERK/CREB Pathway. Am. J. Hypertens. 2021, 34, 840–850. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Yu, X.J.; Xiao, T.; Chi, H.L.; Zhu, G.Q.; Kang, Y.M. Nrf1 Knock-Down in the Hypothalamic Paraventricular Nucleus Alleviates Hypertension Through Intervention of Superoxide Production-Removal Balance and Mitochondrial Function. Cardiovasc. Toxicol. 2021, 21, 472–489. [Google Scholar] [CrossRef] [Scilit]
- Geng, Z.; Ye, C.; Tong, Y.; Zhang, F.; Zhou, Y.B.; Xiong, X.Q. Exacerbated pressor and sympathoexcitatory effects of central Elabela in spontaneously hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 2020, 318, H124–H134. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.J.; Chen, D.; Han, Y.; Zhou, Y.B.; Wang, J.J.; Chen, Q.; Li, Y.H.; Gao, X.Y.; Kang, Y.M.; Zhu, G.Q. Relaxin in paraventricular nucleus contributes to sympathetic overdrive and hypertension via PI3K-Akt pathway. Neuropharmacology 2016, 103, 247–256. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Chen, Z.; Zhang, L.; Wang, X.; Hao, G.; Zhang, Z.; Shao, L.; Tian, Y.; Dong, Y.; Zheng, C.; et al. Status of Hypertension in China: Results From the China Hypertension Survey, 2012–2015. Circulation 2018, 137, 2344–2356. [Google Scholar] [CrossRef] [Scilit]
- Zuo, W.; Liu, N.; Zeng, Y.; Xiao, Z.; Wu, K.; Yang, F.; Li, B.; Song, Q.; Xiao, Y.; Liu, Q. Luteolin Ameliorates Experimental Pulmonary Arterial Hypertension via Suppressing Hippo-YAP/PI3K/AKT Signaling Pathway. Front. Pharmacol. 2021, 12, 663551. [Google Scholar] [CrossRef] [Scilit]
- Kou, J.J.; Shi, J.Z.; He, Y.Y.; Hao, J.J.; Zhang, H.Y.; Luo, D.M.; Song, J.K.; Yan, Y.; Xie, X.M.; Du, G.H.; et al. Luteolin alleviates cognitive impairment in Alzheimer’s disease mouse model via inhibiting endoplasmic reticulum stress-dependent neuroinflammation. Acta Pharmacol. Sin. 2022, 43, 840–849. [Google Scholar] [CrossRef] [Scilit]
- Kempuraj, D.; Thangavel, R.; Kempuraj, D.D.; Ahmed, M.E.; Selvakumar, G.P.; Raikwar, S.P.; Zaheer, S.A.; Iyer, S.S.; Govindarajan, R.; Chandrasekaran, P.N.; et al. Neuroprotective effects of flavone luteolin in neuroinflammation and neurotrauma. Biofactors 2021, 47, 190–197. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.T.; Lin, J.; Liu, Y.E.; Chen, H.F.; Hsu, K.W.; Lin, S.H.; Peng, K.Y.; Lin, K.J.; Hsieh, C.C.; Chen, D.R. Luteolin suppresses androgen receptor-positive triple-negative breast cancer cell proliferation and metastasis by epigenetic regulation of MMP9 expression via the AKT/mTOR signaling pathway. Phytomedicine 2021, 81, 153437. [Google Scholar] [CrossRef] [Scilit]
- Su, Q.; Qin, D.N.; Wang, F.X.; Ren, J.; Li, H.B.; Zhang, M.; Yang, Q.; Miao, Y.W.; Yu, X.J.; Qi, J.; et al. Inhibition of reactive oxygen species in hypothalamic paraventricular nucleus attenuates the renin-angiotensin system and proinflammatory cytokines in hypertension. Toxicol. Appl. Pharmacol. 2014, 276, 115–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.L.; Wang, J.X.; Chen, J.L.; Hao, W.Y.; Xu, W.Z.; Xu, Z.Q.; Jiang, Y.T.; Luo, P.Q.; Chen, Q.; Li, Y.H.; et al. Asprosin in the Paraventricular Nucleus Induces Sympathetic Activation and Pressor Responses via cAMP-Dependent ROS Production. Int. J. Mol. Sci. 2022, 23, 12595. [Google Scholar] [CrossRef] [Scilit]
- Park, J.H.; Seo, Y.H.; Jang, J.H.; Jeong, C.H.; Lee, S.; Park, B. Asiatic acid attenuates methamphetamine-induced neuroinflammation and neurotoxicity through blocking of NF-kappa B/STAT3/ERK and mitochondria-mediated apoptosis pathway. J. Neuroinflammation 2017, 14, 240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, G.; Cheng, J.; Zhang, T.; Shao, Y.; Chen, X.; Han, L.; Zhou, R.; Wu, B. Inhibition of Microbiota-dependent Trimethylamine N-Oxide Production Ameliorates High Salt Diet-Induced Sympathetic Excitation and Hypertension in Rats by Attenuating Central Neuroinflammation and Oxidative Stress. Front. Pharmacol. 2022, 13, 856914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Chen, Y.; Gua, C.; Wu, B. Elevated Oxidative Stress and Inflammation in Hypothalamic Paraventricular Nucleus Are Associated with Sympathetic Excitation and Hypertension in Rats Exposed to Chronic Intermittent Hypoxia. Front. Physiol. 2018, 9, 840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, J.; Li, R.J.; Fu, L.Y.; Liu, K.L.; Qiao, J.A.; Yang, Y.; Yu, X.J.; Yu, J.Y.; Li, Y.; Tan, H.; et al. Exercise Training Attenuates Hypertension via Suppressing ROS/MAPK/NF-kappa B/AT-1R Pathway in the Hypothalamic Paraventricular Nucleus. Nutrients 2022, 14, 3968. [Google Scholar] [CrossRef] [Scilit]
- Qi, J.; Yu, X.J.; Shi, X.L.; Gao, H.L.; Yi, Q.Y.; Tan, H.; Fan, X.Y.; Zhang, Y.; Song, X.A.; Cui, W.; et al. NF-kappa B Blockade in Hypothalamic Paraventricular Nucleus Inhibits High-Salt-Induced Hypertension Through NLRP3 and Caspase-1. Cardiovasc. Toxicol. 2016, 16, 345–354. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.M.; Huang, J.N.; Jiang, Z.Y.; Jiao, Y.; Wang, H. FGF21 inhibitor suppresses the proliferation and migration of human umbilical vein endothelial cells through the eNOS/PI3K/AKT pathway. Am. J. Transl. Res. 2017, 9, 5299–5307. [Google Scholar]
- Ji, L.; Su, S.; Xin, M.; Zhang, Z.; Nan, X.; Li, Z.; Lu, D. Luteolin ameliorates hypoxia-induced pulmonary hypertension via regulating HIF-2alpha-Arg-NO axis and PI3K-AKT-eNOS-NO signaling pathway. Phytomedicine 2022, 104, 154329. [Google Scholar] [CrossRef] [Scilit]
- Yao, X.; Jiang, W.; Yu, D.; Yan, Z. Luteolin inhibits proliferation and induces apoptosis of human melanoma cells in vivo and in vitro by suppressing MMP-2 and MMP-9 through the PI3K/AKT pathway. Food Funct. 2019, 10, 703–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Rat Genes | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| NOX4 | GGATCACAGAAGGTCCCTAGC | AGAAGTTCAGGGCGTTCACC |
| IL-1β | GCAATGGTCGGGACATAGTT | AGACCTGACTTGGCAGAGGA |
| IL-6 | TCTCTCCGCAAGAGACTTCCA | ATACTGGTCTGTTGTGGGTGG |
| GAPDH | AGACAGCCGCATCTTCTTGT | CTTGCCGTGGGTAGAGTCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, H.-L.; Yu, X.-J.; Feng, Y.-Q.; Yang, Y.; Hu, H.-B.; Zhao, Y.-Y.; Zhang, J.-H.; Liu, K.-L.; Zhang, Y.; Fu, L.-Y.; et al. Luteolin Attenuates Hypertension via Inhibiting NF-κB-Mediated Inflammation and PI3K/Akt Signaling Pathway in the Hypothalamic Paraventricular Nucleus. Nutrients 2023, 15, 502. https://doi.org/10.3390/nu15030502
Gao H-L, Yu X-J, Feng Y-Q, Yang Y, Hu H-B, Zhao Y-Y, Zhang J-H, Liu K-L, Zhang Y, Fu L-Y, et al. Luteolin Attenuates Hypertension via Inhibiting NF-κB-Mediated Inflammation and PI3K/Akt Signaling Pathway in the Hypothalamic Paraventricular Nucleus. Nutrients. 2023; 15(3):502. https://doi.org/10.3390/nu15030502
Chicago/Turabian StyleGao, Hong-Li, Xiao-Jing Yu, Yu-Qi Feng, Yu Yang, Han-Bo Hu, Yu-Yang Zhao, Jia-Hao Zhang, Kai-Li Liu, Yan Zhang, Li-Yan Fu, and et al. 2023. "Luteolin Attenuates Hypertension via Inhibiting NF-κB-Mediated Inflammation and PI3K/Akt Signaling Pathway in the Hypothalamic Paraventricular Nucleus" Nutrients 15, no. 3: 502. https://doi.org/10.3390/nu15030502
APA StyleGao, H.-L., Yu, X.-J., Feng, Y.-Q., Yang, Y., Hu, H.-B., Zhao, Y.-Y., Zhang, J.-H., Liu, K.-L., Zhang, Y., Fu, L.-Y., Li, Y., Qi, J., Qiao, J.-A., & Kang, Y.-M. (2023). Luteolin Attenuates Hypertension via Inhibiting NF-κB-Mediated Inflammation and PI3K/Akt Signaling Pathway in the Hypothalamic Paraventricular Nucleus. Nutrients, 15(3), 502. https://doi.org/10.3390/nu15030502
