A Combination of Apple Vinegar Drink with Bacillus coagulans Ameliorates High Fat Diet-Induced Body Weight Gain, Insulin Resistance and Hepatic Steatosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Organic Vinegar Drink and Probiotic Strain
2.2. Animal and Experimental Design
2.3. Fasting Blood Glucose and Tolerance Test
2.4. Serum Biochemical Analysis
2.5. C-Peptide, GLP-1 and Leptin Analysis
2.6. Quantitative Real-Time PCR (RT-qPCR)
2.7. Liver Histology and Morphometry
2.8. Triglyceride Liver Content
2.9. Statistical Analysis
3. Results
3.1. Vinegar Drink Either Alone or in Combination with B. coagulans Attenuated High Caloric Diet-Induced Weight Gain
3.2. Vinegar Drink Either Alone or in Combination with B. coagulans Improves Glycemic and Glucose Tolerance
3.3. Vinegar Drink Together with B. coagulans Attenuates Dislipidemia in Obese Mice
3.4. Vinegar Supplemented with B. coagulans Ameliorated Fat Liver Accumulation: Histological Assessment of the Liver
3.5. Vinegar Drink Together with B. coagulans Ameliorates the Expression of Altered Lipid Metabolism-Related and Pro-Inflammatory Genes in the Livers of High Fat Diet Mice
3.6. Effect of Vinegar Drink and B. coagulans on Leptin, GLP-1 and Insulin Levels in Serum
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Ruderman, N.B.; Carling, D.; Prentki, M.; Cacicedo, J.M. AMPK, insulin resistance, and the metabolic syndrome. J. Clin. Investig. 2013, 123, 2764–2772. [Google Scholar] [CrossRef] [PubMed]
- Kahn, S.E.; Hull, R.L.; Utzschneider, K.M. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 2006, 444, 840–846. [Google Scholar] [CrossRef] [PubMed]
- Hermes, G.D.A.; Zoetendal, E.G.; Smidt, H. Molecular ecological tools to decipher the role of our microbial mass in obesity. Benef. Microbes 2015, 6, 61–81. [Google Scholar] [CrossRef] [PubMed]
- Turnbaugh, P.J.; Hamady, M.; Yatsunenko, T.; Cantarel, B.L.; Duncan, A.; Ley, R.E.; Sogin, M.L.; Jones, W.J.; Roe, B.A.; Affourtit, J.P.; et al. A core gut microbiome in obese and lean twins. Nature 2009, 457, 480–484. [Google Scholar] [CrossRef] [PubMed]
- Turnbaugh, P.J.; Bäckhed, F.; Fulton, L.; Gordon, J.I. Diet-Induced Obesity Is Linked to Marked but Reversible Alterations in the Mouse Distal Gut Microbiome. Cell Host Microbe 2008, 3, 213–223. [Google Scholar] [CrossRef] [PubMed]
- Turnbaugh, P.J.; Ley, R.E.; Mahowald, M.A.; Magrini, V.; Mardis, E.R.; Gordon, J.I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006, 444, 1027–1031. [Google Scholar] [CrossRef]
- Harakeh, S.M.; Khan, I.; Kumosani, T.; Barbour, E.; Almasaudi, S.B.; Bahijri, S.M.; Alfadul, S.M.; Ajabnoor, G.M.A.; Azhar, E.I. Gut microbiota: A contributing factor to obesity. Front. Cell. Infect. Microbiol. 2016, 6. [Google Scholar] [CrossRef]
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef]
- Kim, K.-H.; Park, Y. Food Components with Anti-Obesity Effect. Annu. Rev. Food Sci. Technol. 2011, 2, 237–257. [Google Scholar] [CrossRef]
- Muñoz, R.; de las Rivas, B.; López de Felipe, F.; Reverón, I.; Santamaría, L.; Esteban-Torres, M.; Curiel, J.A.; Rodríguez, H.; Landete, J.M. Biotransformation of Phenolics by Lactobacillus plantarum in Fermented Foods. In Fermented Foods in Health and Disease Prevention; Elsevier: Amsterdam, The Netherlands, 2016; pp. 63–83. ISBN 9780128023099. [Google Scholar]
- Kondo, T.; Kishi, M.; Fushimi, T.; Ugajin, S.; Kaga, T. Vinegar intake reduces body weight, body fat mass, and serum triglyceride levels in obese Japanese subjects. Biosci. Biotechnol. Biochem. 2009, 73, 1837–1843. [Google Scholar] [CrossRef]
- Sugiyama, S.; Fushimi, T.; Kishi, M.; Irie, S.; Tsuji, S.; Hosokawa, N.; Kaga, T. Bioavailability of acetate from two vinegar supplements: Capsule and drink. J. Nutr. Sci. Vitaminol. (Tokyo) 2010, 56, 266–269. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Budak, N.H.; Aykin, E.; Seydim, A.C.; Greene, A.K.; Guzel-Seydim, Z.B. Functional Properties of Vinegar. J. Food Sci. 2014, 79, R757–R764. [Google Scholar] [CrossRef] [PubMed]
- Khezri, S.S.; Saidpour, A.; Hosseinzadeh, N.; Amiri, Z. Beneficial effects of Apple Cider Vinegar on weight management, Visceral Adiposity Index and lipid profile in overweight or obese subjects receiving restricted calorie diet: A randomized clinical trial. J. Funct. Foods 2018, 43, 95–102. [Google Scholar] [CrossRef]
- Kim, E.K.; An, S.Y.; Lee, M.S.; Kim, T.H.; Lee, H.K.; Hwang, W.S.; Choe, S.J.; Kim, T.Y.; Han, S.J.; Kim, H.J.; et al. Fermented kimchi reduces body weight and improves metabolic parameters in overweight and obese patients. Nutr. Res. 2011, 31, 436–443. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, H.; Fujisawa, K.; Ito, E.; Idei, S.; Kawaguchi, N.; Kimoto, M.; Hiemori, M.; Tsuji, H. Improvement of obesity and glucose tolerance by acetate in type 2 diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) rats. Biosci. Biotechnol. Biochem. 2007, 71, 1236–1243. [Google Scholar] [CrossRef]
- Bouazza, A.; Bitam, A.; Amiali, M.; Bounihi, A.; Yargui, L.; Koceir, E.A. Effect of fruit vinegars on liver damage and oxidative stress in high-fat-fed rats. Pharm. Biol. 2016, 54, 260–265. [Google Scholar] [CrossRef]
- Lebeer, S.; Bron, P.A.; Marco, M.L.; van Pijkeren, J.P.; O’Connell Motherway, M.; Hill, C.; Pot, B.; Roos, S.; Klaenhammer, T. Identification of probiotic effector molecules: Present state and future perspectives. Curr. Opin. Biotechnol. 2018, 49, 217–223. [Google Scholar] [CrossRef]
- Abdou, R.M.; Zhu, L.; Baker, R.D.; Baker, S.S. Gut Microbiota of Nonalcoholic Fatty Liver Disease. Dig. Dis. Sci. 2016, 61, 1268–1281. [Google Scholar] [CrossRef]
- Soares, M.B.; Santos-Junior, V.A.; Tavares Filho, E.R.; Lollo, P.C.B.; Morato, P.N.; Amaya-Farfan, J.; Pereira, E.P.R.; Balthazar, C.F.; Cruz, A.G.; Martinez, R.C.R.; et al. The step of incorporation of bacillus coagulans gbi-30 6086 into “requeijão cremoso” processed cheese does not affect metabolic homeostasis of rats. Front. Microbiol. 2019, 10, 2332. [Google Scholar] [CrossRef]
- Jäger, R.; Purpura, M.; Farmer, S.; Cash, H.A.; Keller, D. Probiotic Bacillus coagulans GBI-30, 6086 improves protein absorption and utilization. Probiotics Antimicrob. Proteins 2018, 10, 611–615. [Google Scholar] [CrossRef]
- Kim, B.; Kwon, J.; Kim, M.-S.; Park, H.; Ji, Y.; Holzapfel, W.; Hyun, C.-K. Protective effects of Bacillus probiotics against high-fat diet-induced metabolic disorders in mice. PLoS ONE 2018, 13, e0210120. [Google Scholar] [CrossRef]
- Cao, G.T.; Dai, B.; Wang, K.L.; Yan, Y.; Xu, Y.L.; Wang, Y.X.; Yang, C.M. Bacillus Licheniformis, a potential probiotic, inhibits obesity by modulating colonic microflora in C57BL/6J mice model. J. Appl. Microbiol. 2019, 127, 880–888. [Google Scholar] [CrossRef]
- Orrù, L.; Salvetti, E.; Cattivelli, L.; Lamontanara, A.; Michelotti, V.; Capozzi, V.; Spano, G.; Keller, D.; Cash, H.; Martina, A.; et al. Draft genome sequence of Bacillus coagulans GBI-30, 6086, a widely used spore-forming probiotic strain. Genome Announc. 2014, 2, e01080-14. [Google Scholar] [CrossRef] [PubMed]
- Beh, B.K.; Mohamad, N.E.; Yeap, S.K.; Ky, H.; Boo, S.Y.; Chua, J.Y.H.; Tan, S.W.; Ho, W.Y.; Sharifuddin, S.A.; Long, K.; et al. Anti-obesity and anti-inflammatory effects of synthetic acetic acid vinegar and Nipa vinegar on high-fat-diet-induced obese mice. Sci. Rep. 2017, 7, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Mohamad, N.E.; Yeap, S.K.; Lim, K.L.; Yusof, H.M.; Beh, B.K.; Tan, S.W.; Ho, W.Y.; Sharifuddin, S.A.; Jamaluddin, A.; Long, K.; et al. Antioxidant effects of pineapple vinegar in reversing of paracetamol-induced liver damage in mice. Chin. Med. 2015, 10. [Google Scholar] [CrossRef] [PubMed]
- Santos, H.O.; de Moraes, W.M.A.M.; da Silva, G.A.R.; Prestes, J.; Schoenfeld, B.J. Vinegar (acetic acid) intake on glucose metabolism: A narrative review. Clin. Nutr. ESPEN 2019, 32, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Saw, C.Y.; Chang, T.J.; Chen, P.Y.; Dai, F.J.; Lau, Y.Q.; Chen, T.Y.; Chau, C.F. Presence of Bacillus coagulans spores and vegetative cells in rat intestine and feces and their physiological effects. Biosci. Biotechnol. Biochem. 2019, 83, 2327–2333. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.; Li, X.; Song, P.; Xu, L. Optimal cut-off values for the homeostasis model assessment of insulin resistance (HOMA-IR) and pre-diabetes screening: Developments in research and prospects for the future. Drug Discov. Ther. 2015, 9, 380–385. [Google Scholar] [CrossRef]
- Patsouris, D.; Reddy, J.K.; Müller, M.; Kersten, S. Peroxisome Proliferator-Activated Receptor α Mediates the Effects of High-Fat Diet on Hepatic Gene Expression. Endocrinology 2006, 147, 1508–1516. [Google Scholar] [CrossRef]
- Zhao, L.; Zhong, S.; Qu, H.; Xie, Y.; Cao, Z.; Li, Q.; Yang, P.; Varghese, Z.; Moorhead, J.F.; Chen, Y.; et al. Chronic inflammation aggravates metabolic disorders of hepatic fatty acids in high-fat diet-induced obese mice. Sci. Rep. 2015, 5, 1–12. [Google Scholar] [CrossRef]
- Bagarolli, R.A.; Tobar, N.; Oliveira, A.G.; Araújo, T.G.; Carvalho, B.M.; Rocha, G.Z.; Vecina, J.F.; Calisto, K.; Guadagnini, D.; Prada, P.O.; et al. Probiotics modulate gut microbiota and improve insulin sensitivity in DIO mice. J. Nutr. Biochem. 2017, 50, 16–25. [Google Scholar] [CrossRef] [PubMed]
- Holst, J.J. The physiology of glucagon-like peptide 1. Physiol. Rev. 2007, 87, 1409–1439. [Google Scholar] [CrossRef] [PubMed]
- Hui, S.; Huang, L.; Wang, X.; Zhu, X.; Zhou, M.; Chen, M.; Yi, L.; Mi, M. Capsaicin improves glucose homeostasis by enhancing glucagon-like peptide-1 secretion through the regulation of bile acid metabolism via the remodeling of the gut microbiota in male mice. FASEB J. 2020, 34, 8558–8573. [Google Scholar] [CrossRef] [PubMed]
- Müller, M.; Hernández, M.A.G.; Goossens, G.H.; Reijnders, D.; Holst, J.J.; Jocken, J.W.E.; van Eijk, H.; Canfora, E.E.; Blaak, E.E. Circulating but not faecal short-chain fatty acids are related to insulin sensitivity, lipolysis and GLP-1 concentrations in humans. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [PubMed]
- De Lorenzo, A.; Gratteri, S.; Gualtieri, P.; Cammarano, A.; Bertucci, P.; Di Renzo, L. Why primary obesity is a disease? J. Transl. Med. 2019, 17, 169. [Google Scholar] [CrossRef] [PubMed]
- Marques, E.S.; Leite, T.H.; Azeredo, C.M.; Cunha, D.B.; Verly Júnior, E. Effective strategies for prevention, control, and treatment of obesity in primary health care setting for adolescents, adults, and elderly people. Medicine 2018, 97, e10925. [Google Scholar] [CrossRef]
- Hall, K.D.; Guo, J. Obesity Energetics: Body Weight Regulation and the Effects of Diet Composition. Gastroenterology 2017, 152, 1718–1727. [Google Scholar] [CrossRef]
- Hernández, M.A.G.; Canfora, E.E.; Jocken, J.W.E.; Blaak, E.E. The short-chain fatty acid acetate in body weight control and insulin sensitivity. Nutrients 2019, 11, 1943. [Google Scholar] [CrossRef]
- Abuajah, C.I.; Ogbonna, A.C.; Osuji, C.M. Functional components and medicinal properties of food: A review. J. Food Sci. Technol. 2015, 52, 2522–2529. [Google Scholar] [CrossRef]
- Stoffers, D.A.; Kieffer, T.J.; Hussain, M.A.; Drucker, D.J.; Bonner-Weir, S.; Habener, J.F.; Egan, J.M. Insulinotropic glucagon-like peptide 1 agonists stimulate expression of homeodomain protein IDX-1 and increase islet size in mouse pancreas. Diabetes 2000, 49, 741–748. [Google Scholar] [CrossRef]
- Richards, P.; Pais, R.; Habib, A.M.; Brighton, C.A.; Yeo, G.S.H.; Reimann, F.; Gribble, F.M. High fat diet impairs the function of glucagon-like peptide-1 producing L-cells. Peptides 2016, 77, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Kappe, C.; Zhang, Q.; Nyström, T.; Sjöholm, Å. Effects of high-fat diet and the anti-diabetic drug metformin on circulating GLP-1 and the relative number of intestinal L-cells. Diabetol. Metab. Syndr. 2014, 6, 70. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Jin, C.; Zhang, X.; Jia, W.; Le, J.; Ye, J. Restoration of GLP-1 secretion by Berberine is associated with protection of colon enterocytes from mitochondrial overheating in diet-induced obese mice. Nutr. Diabetes 2018, 8, 53. [Google Scholar] [CrossRef] [PubMed]
- Tolhurst, G.; Heffron, H.; Lam, Y.S.; Parker, H.E.; Habib, A.M.; Diakogiannaki, E.; Cameron, J.; Grosse, J.; Reimann, F.; Gribble, F.M. Short-chain fatty acids stimulate glucagon-like peptide-1 secretion via the G-protein-coupled receptor FFAR2. Diabetes 2012, 61, 364–371. [Google Scholar] [CrossRef] [PubMed]
- Harris, R.B.S. Direct and indirect effects of leptin on adipocyte metabolism. Biochim. Biophys. Acta-Mol. Basis Dis. 2014, 1842, 414–423. [Google Scholar] [CrossRef]
- Koch, C.E.; Lowe, C.; Pretz, D.; Steger, J.; Williams, L.M.; Tups, A. High-Fat Diet Induces Leptin Resistance in Leptin-Deficient Mice. J. Neuroendocrinol. 2014, 26, 58–67. [Google Scholar] [CrossRef]
- Zhao, S.; Zhu, Y.; Schultz, R.D.; Li, N.; He, Z.; Zhang, Z.; Caron, A.; Zhu, Q.; Sun, K.; Xiong, W.; et al. Partial Leptin Reduction as an Insulin Sensitization and Weight Loss Strategy. Cell Metab. 2019, 30, 706–719. [Google Scholar] [CrossRef]
- Zhao, S.; Li, N.; Zhu, Y.; Straub, L.; Zhang, Z.; Wang, M.Y.; Zhu, Q.; Kusminski, C.M.; Elmquist, J.K.; Scherer, P.E. Partial leptin deficiency confers resistance to diet-induced obesity in mice. Mol. Metab. 2020, 37, 823–829. [Google Scholar] [CrossRef]
- Chen, Z.; Yu, R.; Xiong, Y.; Du, F.; Zhu, S. A vicious circle between insulin resistance and inflammation in nonalcoholic fatty liver disease. Lipids Health Dis. 2017, 16, 203. [Google Scholar] [CrossRef]
- Chen, Y.; Yousaf, M.N.; Mehal, W.Z. Role of sterile inflammation in fatty liver diseases. Liver Res. 2018, 2, 21–29. [Google Scholar] [CrossRef]
- Wilson, C.G.; Tran, J.L.; Erion, D.M.; Vera, N.B.; Febbraio, M.; Weiss, E.J. Hepatocyte-specific disruption of CD36 attenuates fatty liver and improves insulin sensitivity in HFD-fed mice. Endocrinology 2016, 157, 570–585. [Google Scholar] [CrossRef]
- Yang, X.; Gonzalez, F.J.; Huang, M.; Bi, H. Nuclear receptors and non-alcoholic fatty liver disease: An update. Liver Res. 2020, 4, 88–93. [Google Scholar] [CrossRef]
- Moslehi, A.; Hamidi-zad, Z. Role of SREBPs in Liver Diseases: A Mini-review. J. Clin. Transl. Hepatol. 2018, 6, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Han, X.; Bian, Z.; Peng, Y.; You, Z.; Wang, Q.; Chen, X.; Qiu, D.; Ma, X. Activation of liver X receptors attenuates endotoxin-induced liver injury in mice with nonalcoholic fatty liver disease. Dig. Dis. Sci. 2012, 57, 390–398. [Google Scholar] [CrossRef] [PubMed]
- Liebergall, S.R.; Angdisen, J.; Chan, S.H.; Chang, Y.; Osborne, T.F.; Koeppel, A.F.; Turner, S.D.; Schulman, I.G. Inflammation Triggers Liver X Receptor-Dependent Lipogenesis. Mol. Cell. Biol. 2020, 40, e00364–19. [Google Scholar] [CrossRef]
- Polizzi, A.; Fouché, E.; Ducheix, S.; Lasserre, F.; Marmugi, A.P.; Mselli-Lakhal, L.; Loiseau, N.; Wahli, W.; Guillou, H.; Montagner, A. Hepatic fasting-induced PPARα activity does not depend on essential fatty acids. Int. J. Mol. Sci. 2016, 17, 1624. [Google Scholar] [CrossRef]
Component | Unit | Amount |
---|---|---|
Energy value | Kcal/100 mL | 24 |
Energy value | KJ/100 mL | 100 |
Fat | g/100 mL | <0.05 |
Saturated Fat | g/100 mL | <0.05 |
Monounsaturated fat | g/100 mL | <0.05 |
Polyunsaturated fat | g/100 mL | <0.05 |
Trans fat | g/100 mL | <0.10 |
Total sugar | g/100 mL | 5 |
Glucose | g/100 mL | 2.1 |
Fructose | g/100 mL | 2.9 |
Sucrose | g/100 mL | <1 |
Maltose | g/100 mL | <1 |
Lactose | g/100 mL | <1 |
Fiber | g/100 mL | <0.05 |
Protein | g/100 mL | 0.11 |
Sodium | mg/100 mL | 8.7 |
Ash | g/100 mL | 0.18 |
Moisture | g/100 mL | 93.8 |
Gene | Sequence | |
---|---|---|
RPLPO | Forward | AACATCTCCCCCTTCTCCTT |
Reverse | GAAGGCCTTGACCTTTTCAG | |
LXR | Forward | CTCAATGCCTGATGTTTCTCCT |
Reverse | TCCAACCCTATCCCTAAAGCAA | |
CD36 | Forward | CACAGCTGCCTTCTGAAATGTGTGG |
Reverse | TTTCTACGTGGCCCGGTTCTAATTC | |
PPARα | Forward | ACTGGTAGTCTGCAAAACCAAA |
Reverse | AGAGCCCCATCTGTCCTCTC | |
SREBP | Forward | CACTTCATCAAGGCAGACTC |
Reverse | CGGTAGCGCTTCTCAATGGC | |
FASN | Forward | AGCCATGGAGGAGGTGGTGAT |
Reverse | GTGTGCCTGCTTGGGGTGGAC | |
IL-1β | Forward | TCGCTCAGGGTCACAAGAAA |
Reverse | CATCAGAGGCAAGGAGGAAAAC | |
IL-6 | Forward | ACAAGTCGGAGGCTTAATTACACAT |
Reverse | TTGCCATTGCACAACTCTTTTC | |
CPT-1 | Forward | TCTAGGCAATGCCGTTCAC |
Reverse | GAGCACATGGGCACCATAC | |
ACC | Forward | GCATGTCTGGCTTGCACCTAG |
Reverse | CATCTTAATGTATTCTGCATTGGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Urtasun, R.; Díaz-Gómez, J.; Araña, M.; Pajares, M.J.; Oneca, M.; Torre, P.; Jiménez, M.; Munilla, G.; Barajas, M.; Encío, I. A Combination of Apple Vinegar Drink with Bacillus coagulans Ameliorates High Fat Diet-Induced Body Weight Gain, Insulin Resistance and Hepatic Steatosis. Nutrients 2020, 12, 2504. https://doi.org/10.3390/nu12092504
Urtasun R, Díaz-Gómez J, Araña M, Pajares MJ, Oneca M, Torre P, Jiménez M, Munilla G, Barajas M, Encío I. A Combination of Apple Vinegar Drink with Bacillus coagulans Ameliorates High Fat Diet-Induced Body Weight Gain, Insulin Resistance and Hepatic Steatosis. Nutrients. 2020; 12(9):2504. https://doi.org/10.3390/nu12092504
Chicago/Turabian StyleUrtasun, Raquel, Joana Díaz-Gómez, Miriam Araña, María José Pajares, María Oneca, Paloma Torre, Maddalen Jiménez, Germán Munilla, Miguel Barajas, and Ignacio Encío. 2020. "A Combination of Apple Vinegar Drink with Bacillus coagulans Ameliorates High Fat Diet-Induced Body Weight Gain, Insulin Resistance and Hepatic Steatosis" Nutrients 12, no. 9: 2504. https://doi.org/10.3390/nu12092504
APA StyleUrtasun, R., Díaz-Gómez, J., Araña, M., Pajares, M. J., Oneca, M., Torre, P., Jiménez, M., Munilla, G., Barajas, M., & Encío, I. (2020). A Combination of Apple Vinegar Drink with Bacillus coagulans Ameliorates High Fat Diet-Induced Body Weight Gain, Insulin Resistance and Hepatic Steatosis. Nutrients, 12(9), 2504. https://doi.org/10.3390/nu12092504