Lactobacillus helveticus-Fermented Milk Whey Suppresses Melanin Production by Inhibiting Tyrosinase through Decreasing MITF Expression
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of Fermented Milk Whey
2.3. Cell Culture
2.4. WST-1 Assay
2.5. Measurement of Melanin Content
2.6. Measurement of Tyrosinase Activity
2.7. Real-Time PCR
2.8. Real-Time PCR Preparation of Samples for Western Blotting
2.9. Western Blotting
2.10. Statistical Analyses
3. Results
3.1. Effect of LHMW on Melanin Production Stimulated by α-MSH
3.2. Effect of LHMW on Tyrosinase Activity
3.3. Effects of LHMW on the Protein Expression of Tyrosinase, TRP1, and DCT
3.4. Effects of LHMW on Tyrosinase, Trp1, and Dct mRNA Levels
3.5. Effect of LHMW on MITF Expression
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Regad, T. Molecular and cellular pathogenesis of melanoma initiation and progression. Cell. Mol. Life Sci. CMLS 2013, 70, 4055–4065. [Google Scholar] [CrossRef]
- Videira, I.F.; Moura, D.F.; Magina, S. Mechanisms regulating melanogenesis. An. Bras. Dermatol. 2013, 88, 76–83. [Google Scholar] [CrossRef] [PubMed]
- Osborne, R.; Hakozaki, T.; Laughlin, T.; Finlay, D.R. Application of genomics to breakthroughs in the cosmetic treatment of skin ageing and discoloration. Br. J. Dermatol. 2012, 166 (Suppl. 2), 16–19. [Google Scholar] [CrossRef]
- Dika, E.; Patrizi, A.; Lambertini, M.; Manuelpillai, N.; Fiorentino, M.; Altimari, A.; Ferracin, M.; Lauriola, M.; Fabbri, E.; Campione, E.; et al. Estrogen receptors and melanoma: A Review. Cells 2019, 8, 1463. [Google Scholar] [CrossRef] [PubMed]
- Natale, C.A.; Duperret, E.K.; Zhang, J.; Sadeghi, R.; Dahal, A.; O’Brien, K.T.; Cookson, R.; Winkler, J.D.; Ridky, T.W. Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors. eLife 2016, 5, e15104. [Google Scholar] [CrossRef]
- Huang, H.C.; Yen, H.; Lu, J.Y.; Chang, T.M.; Hii, C.H. Theophylline enhances melanogenesis in B16F10 murine melanoma cells through the activation of the MEK 1/2, and Wnt/beta-catenin signaling pathways. Food Chem. Toxicol. 2020, 137, 111165. [Google Scholar] [CrossRef]
- Martinez-Liarte, J.H.; Solano, F.; Garcia-Borron, J.C.; Jara, J.R.; Lozano, J.A. Alpha-MSH and other melanogenic activators mediate opposite effects on tyrosinase and dopachrome tautomerase in B16/F10 mouse melanoma cells. J. Investig. Dermatol. 1992, 99, 435–439. [Google Scholar] [CrossRef]
- Imokawa, G.; Ishida, K. Inhibitors of intracellular signaling pathways that lead to stimulated epidermal pigmentation: Perspective of anti-pigmenting agents. Int. J. Mol. Sci. 2014, 15, 8293–8315. [Google Scholar] [CrossRef] [PubMed]
- Del Marmol, V.; Beermann, F. Tyrosinase and related proteins in mammalian pigmentation. FEBS Lett. 1996, 381, 165–168. [Google Scholar] [CrossRef]
- Sulaimon, S.S.; Kitchell, B.E. The biology of melanocytes. Vet. Dermatol. 2003, 14, 57–65. [Google Scholar] [CrossRef]
- Yokoyama, K.; Yasumoto, K.; Suzuki, H.; Shibahara, S. Cloning of the human DOPAchrome tautomerase/tyrosinase-related protein 2 gene and identification of two regulatory regions required for its pigment cell-specific expression. J. Biolog. Chem. 1994, 269, 27080–27087. [Google Scholar]
- Kobayashi, T.; Urabe, K.; Winder, A.; Jimenez-Cervantes, C.; Imokawa, G.; Brewington, T.; Solano, F.; Garcia-Borron, J.C.; Hearing, V.J. Tyrosinase related protein 1 (TRP1) functions as a DHICA oxidase in melanin biosynthesis. EMBO J. 1994, 13, 5818–5825. [Google Scholar] [CrossRef] [PubMed]
- Iwata, M.; Corn, T.; Iwata, S.; Everett, M.A.; Fuller, B.B. The relationship between tyrosinase activity and skin color in human foreskins. J. Investig. Dermatol. 1990, 95, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J.; Uyama, H. Tyrosinase inhibitors from natural and synthetic sources: Structure, inhibition mechanism and perspective for the future. Cell. Mol. Life Sci. CMLS 2005, 62, 1707–1723. [Google Scholar] [CrossRef] [PubMed]
- Aihara, K.; Kajimoto, O.; Hirata, H.; Takahashi, R.; Nakamura, Y. Effect of powdered fermented milk with Lactobacillus helveticus on subjects with high-normal blood pressure or mild hypertension. J. Am. Coll. Nutr. 2005, 24, 257–265. [Google Scholar] [CrossRef]
- Nakamura, Y.; Masuda, O.; Takano, T. Decrease of tissue angiotensin I-converting enzyme activity upon feeding sour milk in spontaneously hypertensive rats. Biosci. Biotechnol. Biochem. 1996, 60, 488–489. [Google Scholar] [CrossRef]
- Ohsawa, K.; Uchida, N.; Ohki, K.; Nakamura, Y.; Yokogoshi, H. Lactobacillus helveticus-fermented milk improves learning and memory in mice. Nutr. Neurosci. 2015, 18, 232–240. [Google Scholar] [CrossRef]
- Arai, K.; Murota, I.; Hayakawa, K.; Kataoka, M.; Mitsuoka, T. Effects of administration of pasteurized fermented milk to mice on the life-span and intestinal flora. J. Jpn. Soc. Food Nutr. 1980, 23, 219–223. [Google Scholar]
- Takano, T.; Arai, K.; Murota, I.; Hayakawa, K.; Mizutani, T.; Mitsuoka, T. Effects of feeding sour milk on longevity and tumorigenesis in mice and rats. Bifidobact. Microflora 1985, 4, 31–37. [Google Scholar] [CrossRef][Green Version]
- Baba, H.; Masuyama, A.; Yoshimura, C.; Aoyama, Y.; Takano, T.; Ohki, K. Oral intake of Lactobacillus helveticus-fermented milk whey decreased transepidermal water loss and prevented the onset of sodium dodecylsulfate-induced dermatitis in mice. Biosci. Biotechnol. Biochem. 2010, 74, 18–23. [Google Scholar] [CrossRef]
- Baba, H.; Masuyama, A.; Takano, T. Short communication: Effects of Lactobacillus helveticus-fermented milk on the differentiation of cultured normal human epidermal keratinocytes. J. Dairy Sci. 2006, 89, 2072–2075. [Google Scholar] [CrossRef]
- Li, H.R.; Habasi, M.; Xie, L.Z.; Aisa, H.A. Effect of chlorogenic acid on melanogenesis of B16 melanoma cells. Molecules 2014, 19, 12940–12948. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.C.; Lin, Y.Y.; Yang, S.Y.; Weng, Y.T.; Tsai, Y.T. Antimelanogenic effect of c-phycocyanin through modulation of tyrosinase expression by upregulation of ERK and downregulation of p38 MAPK signaling pathways. J. Biomed. Sci. 2011, 18, 74. [Google Scholar] [CrossRef] [PubMed]
- Park, S.Y.; Jin, M.L.; Kim, Y.H.; Kim, Y.; Lee, S.J. Aromatic-turmerone inhibits alpha-MSH and IBMX-induced melanogenesis by inactivating CREB and MITF signaling pathways. Arch. Dermatol. Res. 2011, 303, 737–744. [Google Scholar] [CrossRef] [PubMed]
- Tu, C.X.; Lin, M.; Lu, S.S.; Qi, X.Y.; Zhang, R.X.; Zhang, Y.Y. Curcumin inhibits melanogenesis in human melanocytes. Phytother. Res. PTR 2012, 26, 174–179. [Google Scholar] [CrossRef]
- Levy, C.; Khaled, M.; Fisher, D.E. MITF: Master regulator of melanocyte development and melanoma oncogene. Trends Mol. Med. 2006, 12, 406–414. [Google Scholar] [CrossRef]
- Ye, Y.; Chu, J.H.; Wang, H.; Xu, H.; Chou, G.X.; Leung, A.K.; Fong, W.F.; Yu, Z.L. Involvement of p38 MAPK signaling pathway in the anti-melanogenic effect of San-bai-tang, a Chinese herbal formula, in B16 cells. J. Ethnopharmacol. 2010, 132, 533–535. [Google Scholar] [CrossRef]
- Goto, H.; Sagitani, A.; Ashida, N.; Kato, S.; Hirota, T.; Shinoda, T.; Yamamoto, N. Anti-influenza virus effects of both live and non-live Lactobacillus acidophilus L-92 accompanied by the activation of innate immunity. Br. J. Nutr. 2013, 110, 1810–1818. [Google Scholar] [CrossRef]
- Lee, E.S.; Song, E.J.; Nam, Y.D.; Lee, S.Y. Probiotics in human health and disease: From nutribiotics to pharmabiotics. J. Microbiol. 2018, 56, 773–782. [Google Scholar] [CrossRef]
- Parisa, A.; Roya, G.; Mahdi, R.; Shabnam, R.; Maryam, E.; Malihe, T. Anti-cancer effects of Bifidobacterium species in colon cancer cells and a mouse model of carcinogenesis. PLoS ONE 2020, 15, e0232930. [Google Scholar] [CrossRef]
- Saez-Lara, M.J.; Gomez-Llorente, C.; Plaza-Diaz, J.; Gil, A. The role of probiotic lactic acid bacteria and bifidobacteria in the prevention and treatment of inflammatory bowel disease and other related diseases: A systematic review of randomized human clinical trials. BioMed Res. Int. 2015, 2015, 505878. [Google Scholar] [CrossRef] [PubMed]
- Sugawara, T.; Sawada, D.; Ishida, Y.; Aihara, K.; Aoki, Y.; Takehara, I.; Takano, K.; Fujiwara, S. Regulatory effect of paraprobiotic Lactobacillus gasseri CP2305 on gut environment and function. Microb. Ecol. Health Dis. 2016, 27, 30259. [Google Scholar]
- Garcia, G.; Agosto, M.E.; Cavaglieri, L.; Dogi, C. Effect of fermented whey with a probiotic bacterium on gut immune system. J. Dairy Res. 2020, 87, 134–137. [Google Scholar] [CrossRef] [PubMed]
- Imaizumi, K.; Hirata, K.; Zommara, M.; Sugano, M.; Suzuki, Y. Effects of cultured milk products by Lactobacillus and Bifidobacterium species on the secretion of bile acids in hepatocytes and in rats. J. Nutr. Sci. Vitaminol. 1992, 38, 343–351. [Google Scholar] [CrossRef] [PubMed]
- Marshall, K. Therapeutic applications of whey protein. Altern. Med. Rev. 2004, 9, 136–156. [Google Scholar] [PubMed]
- Yamamoto, N.; Akino, A.; Takano, T. Antihypertensive effect of the peptides derived from casein by an extracellular proteinase from Lactobacillus helveticus CP790. J. Dairy Sci. 1994, 77, 917–922. [Google Scholar] [CrossRef]
- Chen, Y.J.; Chen, Y.Y.; Lin, Y.F.; Hu, H.Y.; Liao, H.F. Resveratrol inhibits alpha-melanocyte-stimulating hormone signaling, viability, and invasiveness in melanoma cells. Evid. Based Complement. Altern. Med. eCAM 2013, 2013, 632121. [Google Scholar] [CrossRef]
- Zhou, J.; Ren, T.; Li, Y.; Cheng, A.; Xie, W.; Xu, L.; Peng, L.; Lin, J.; Lian, L.; Diao, Y.; et al. Oleoylethanolamide inhibits alpha-melanocyte stimulating hormone-stimulated melanogenesis via ERK, Akt and CREB signaling pathways in B16 melanoma cells. Oncotarget 2017, 8, 56868–56879. [Google Scholar] [CrossRef]
- Pillaiyar, T.; Manickam, M.; Namasivayam, V. Skin whitening agents: Medicinal chemistry perspective of tyrosinase inhibitors. J. Enzym. Inhibid. Med. Chem. 2017, 32, 403–425. [Google Scholar] [CrossRef]
- Bentley, N.J.; Eisen, T.; Goding, C.R. Melanocyte-specific expression of the human tyrosinase promoter: Activation by the microphthalmia gene product and role of the initiator. Mol. Cell. Biol. 1994, 14, 7996–8006. [Google Scholar] [CrossRef]
- Busca, R.; Ballotti, R. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 2000, 13, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Tachibana, M. Cochlear melanocytes and MITF signaling. J. Investig. Dermatol. Symp. Proc. 2001, 6, 95–98. [Google Scholar] [CrossRef] [PubMed]
- D’Mello, S.A.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling pathways in melanogenesis. Int. J. Mol. Sci. 2016, 17, 1144. [Google Scholar] [CrossRef]
- Gillbro, J.M.; Olsson, M.J. The melanogenesis and mechanisms of skin-lightening agents—Existing and new approaches. Int. J. Cosmet. Sci. 2011, 33, 210–221. [Google Scholar] [CrossRef]
- Seo, G.Y.; Ha, Y.; Park, A.H.; Kwon, O.W.; Kim, Y.J. Leathesia difformis extract inhibits alpha-MSH-induced melanogenesis in B16F10 cells via down-regulation of CREB signaling pathway. Int. J. Mol. Sci. 2019, 20, 536. [Google Scholar] [CrossRef] [PubMed]
- Aoki, H.; Moro, O. Involvement of microphthalmia-associated transcription factor (MITF) in expression of human melanocortin-1 receptor (MC1R). Life Sci. 2002, 71, 2171–2179. [Google Scholar] [CrossRef]
- Brenner, M.; Hearing, V.J. The protective role of melanin against UV damage in human skin. Photochem. Photobiol. 2008, 84, 539–549. [Google Scholar] [CrossRef]
- He, W.; Li, X.; Peng, Y.; He, X.; Pan, S. Anti-oxidant and anti-melanogenic properties of essential oil from peel of Pomelo cv. Guan Xi. Molecules 2019, 24, 242. [Google Scholar] [CrossRef]
- Wang, J.J.; Wu, C.C.; Lee, C.L.; Hsieh, S.L.; Chen, J.B.; Lee, C.I. Antimelanogenic, antioxidant and antiproliferative effects of Antrodia camphorata fruiting bodies on B16-F0 melanoma cells. PLoS ONE 2017, 12, e0170924. [Google Scholar] [CrossRef]
- Corrochano, A.R.; Buckin, V.; Kelly, P.M.; Giblin, L. Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways. J. Dairy Sci. 2018, 101, 4747–4761. [Google Scholar] [CrossRef]
- Svanborg, S.; Johansen, A.G.; Abrahamsen, R.K.; Skeie, S.B. The composition and functional properties of whey protein concentrates produced from buttermilk are comparable with those of whey protein concentrates produced from skimmed milk. J. Dairy Sci. 2015, 98, 5829–5840. [Google Scholar] [CrossRef] [PubMed]
- Wakai, T.; Shinoda, T.; Uchida, N.; Hattori, M.; Nakamura, Y.; Beresford, T.; Ross, R.P.; Yamamoto, N. Comparative analysis of proteolytic enzymes need for processing of antihypertensive peptides between Lactobacillus helveticus CM4 and DPC4571. J. Biosci. Bioeng. 2013, 115, 246–252. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
Tyrosinase | CAAAGGGGTGGATGACCGTG | AACTTACAGTTTCCGCAGTTGA |
Trp1 | ATGAAATCTTACAACGTCCTCCC | GCACACTCTCGTGGAAACTGA |
Dct | TTCAACCGGACATGCAAATGC | GCTTCTTCCGATTACAGTCGGG |
MITF | CAAATGGCAAATACGTTACCCG | CAATGCTCTTGCTTCAGACTCT |
GAPDH | GGCAAATTCAACGGCACAGT | AGATGGTGATGGGCTTCCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ikarashi, N.; Fukuda, N.; Ochiai, M.; Sasaki, M.; Kon, R.; Sakai, H.; Hatanaka, M.; Kamei, J. Lactobacillus helveticus-Fermented Milk Whey Suppresses Melanin Production by Inhibiting Tyrosinase through Decreasing MITF Expression. Nutrients 2020, 12, 2082. https://doi.org/10.3390/nu12072082
Ikarashi N, Fukuda N, Ochiai M, Sasaki M, Kon R, Sakai H, Hatanaka M, Kamei J. Lactobacillus helveticus-Fermented Milk Whey Suppresses Melanin Production by Inhibiting Tyrosinase through Decreasing MITF Expression. Nutrients. 2020; 12(7):2082. https://doi.org/10.3390/nu12072082
Chicago/Turabian StyleIkarashi, Nobutomo, Natsuko Fukuda, Makiba Ochiai, Mami Sasaki, Risako Kon, Hiroyasu Sakai, Misaki Hatanaka, and Junzo Kamei. 2020. "Lactobacillus helveticus-Fermented Milk Whey Suppresses Melanin Production by Inhibiting Tyrosinase through Decreasing MITF Expression" Nutrients 12, no. 7: 2082. https://doi.org/10.3390/nu12072082
APA StyleIkarashi, N., Fukuda, N., Ochiai, M., Sasaki, M., Kon, R., Sakai, H., Hatanaka, M., & Kamei, J. (2020). Lactobacillus helveticus-Fermented Milk Whey Suppresses Melanin Production by Inhibiting Tyrosinase through Decreasing MITF Expression. Nutrients, 12(7), 2082. https://doi.org/10.3390/nu12072082