Next Article in Journal
Sustainability in Higher Education during the COVID-19 Pandemic: A Systematic Review
Next Article in Special Issue
Roles of Economic Development Level and Other Human System Factors in COVID-19 Spread in the Early Stage of the Pandemic
Previous Article in Journal
Adaptive Dynamic Control Based Optimization of Renewable Energy Resources for Grid-Tied Microgrids
Previous Article in Special Issue
Occupational Safety Knowledge, Attitude, and Practice among Farmers in Northern Nigeria during Pesticide Application—A Case Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Estimating the Risk of Acute Gastrointestinal Disease Attributed to E. coli O157:H7 in Irrigation Water and Agricultural Soil: A Quantitative Microbial Risk Assessment

by
Chidozie Declan Iwu
1,2,
Chinwe Juliana Iwu-Jaja
3,
Anthony Ifeanyin Okoh
1,2,4,
Michael Ekubu Otim
5 and
Amina M. Al Marzouqi
5,*
1
SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice 5700, South Africa
2
Applied and Environmental Microbiology Research Group, Department of Biochemistry and Microbiology, University of Fort Hare, Alice 5700, South Africa
3
Division of Health Systems and Public Health, Department of Global Health, Stellenbosch University, Stellenbosch 7602, South Africa
4
Department of Environmental Health Sciences, University of Sharjah, Sharjah P.O. Box 27272, United Arab Emirates
5
Department of Health Sciences Administration, University of Sharjah, Sharjah P.O. Box 27272, United Arab Emirates
*
Author to whom correspondence should be addressed.
Sustainability 2022, 14(3), 1878; https://doi.org/10.3390/su14031878
Submission received: 19 December 2021 / Revised: 20 January 2022 / Accepted: 25 January 2022 / Published: 7 February 2022
(This article belongs to the Special Issue Global Environmental Health and Safety)

Abstract

Introduction: The occurrence of E. coli O157:H7 in the agricultural environment poses a serious threat to public health. The primary aim was to estimate the probability of illness caused by E. coli O157:H7 in irrigation water and agricultural soil niches. Methods: The Quantitative Microbial Risk Assessment was used and the risks were characterized using the Monte Carlo simulation with 10,000 iterations. Results: The mean levels of E. coli O157:H7 in the irrigation water and agricultural soil samples was 1.328 × 103 CFU/100 mL (Range: 0.00 to 13.000 × 103 CFU/100 mL) and 2.482 × 103 CFU/g (Range: 0.167 × 103 to 16.333 × 103 CFU/g), respectively. The risk of infection in humans exposed to this water and soil was 100%. In addition, a high risk of acute diarrheal disease was estimated at 25.0 × 10−2 for humans exposed to contaminated water and/or soil. Summary: These results exceeded the WHO diarrheal disease risk standard of 1.0 × 10−3. These findings demonstrated a high probability of acute gastrointestinal disease among humans exposed to E. coli O157:H7 in irrigation water and agricultural soil samples collected from the study sites representing a huge public health threat.

1. Introduction

The agricultural environment plays a huge role in the transmission of infectious disease pathogens [1]. At the pre-harvest level of agricultural production, the irrigation water, agricultural soil, biological amendments and animal intrusion serves as the main sources of fresh produce contamination, introducing pathogens into the food system [2]. Water used for irrigation are majorly sourced from groundwater, surface water, stored rainwater and human wastewater [3]. These water bodies are easily contaminated by human pathogens from various sources including surface runoffs [4]. In addition, the agricultural soil is a famous environmental niche for numerous foodborne pathogens which are usually introduced via contaminated irrigation water, surface runoffs and soil amendments [5]. For instance, E. coli O157:H7 was observed in slaughtered animals’ fecal samples including camels, goats, and cattle in Al Ain, United Arab Emirates (UAE) which may be used for soil amendment [6].
Several foodborne pathogens capable of causing severe gastrointestinal disease including Salmonella spp., Klebsiella spp., Enterobacter spp., E. coli O157:H7 and Listeria monocytogenes have been recovered from irrigation water and agricultural soil samples [7,8,9]. These pathogens have the potential to internalize leafy vegetables [10]. E. coli O157:H7 is of great concern because it is easily transferred to the food web from the farm and can cause severe disease under low ingestion dose. E. coli O157:H7 is ubiquitous in nature and is ecologically adaptable within the agro-ecosystem and the food processing environments [11]. E. coli O157:H7 can persist in water and soil for up to 60 to 120 days under acidic and dry conditions [12]. Once ingested, E. coli O157:H7 produces shigatoxins which causes syndromes such as dysentery, hemolytic anaemia, hemorrhagic colitis, haemolytic uremic syndrome (HUS), reduced platelet count and thrombic thrombocytopenic purpura (TTP) whose sequelae may include renal disorder and death [13]. Interestingly, some students from the New York University Abu Dhabi (NYUAD) recently developed a portable and affordable device called E.coLAMP that can detect E. coli O157:H7 in just 20 min [14].
While the presence of E. coli O157:H7 in irrigation water and agricultural soil poses a huge threat to human health, there is a need to quantitatively predict the risks attributed to this pathogen using a risk-based assessment technique. This approach systematically pools information about the presence and nature of a given microbial hazard within a particular system, including its fate, transmission routes, routes of human exposure and the health effects associated with the exposure [15]. A quantitative microbial risk assessment (QMRA) was, therefore, carried out to estimate the risk of acute gastrointestinal disease attributed to E. coli O157:H7 in irrigation water and agricultural soil samples collected from Amathole and Chris Hani District Municipalities, Eastern Cape Province, South Africa. To the best of our knowledge, this is the first QMRA study on E. coli O157:H7 in irrigation water and agricultural soil to be carried out in the Province. Food samples were not considered as they are beyond the scope of this study.

2. Materials and Methods

2.1. Study Setting

We carried out this study in Amathole (Figure 1A) and Chris Hani (Figure 1B) District Municipalities (DMs) in the Eastern Cape Province of South Africa. Located in the South-Eastern part of the country, the province is considered the second largest province and one of the most impoverished. Agriculture and agro-processing are among the major industries in the province. In 2016, Amathole DM was made up of 862,000 people which is about 12.3% of the Eastern Cape population and 1.55% of the South Africa population [16]. In 2017, Chris Hani District Municipality was made up of 849,000 people which is about 12.0% of the Eastern Cape population and 1.5% of South Africa population [17].

2.2. Microbiological Analysis

This section may be divided by subheadings. It should provide a concise and precise description of the experimental results, their interpretation, as well as the experimental conclusions that can be drawn.
Sterile sample bottles and sterile plastic bags were used to collect the irrigation water samples (n = 19, approximately 1 litre each) and agricultural soil samples (n = 13, approximately 30 g each), respectively. All the samples were properly labelled, kept on ice and shipped to the laboratory within 4 h for further processing.
Irrigation water samples were subjected to serial dilution (10−1, 10−2 and 10−3) and then membrane filtration (100 mL) for the enumeration of E. coli O157:H7 [7]. Agricultural soil samples were subjected to serial dilution (10−1, 10−2 and 10−3) and then spread plate culture method (100 µL) for the enumeration of E. coli O157:H7 [7]. All the culture was carried out in triplicates using Sorbitol-MacConkey agar (SMA) (Merck, Johannesburg, South Africa) supplemented with cefixime (50 μg/L) and tellurite (25 mg/L). E. coli O157:H7 concentrations were presented in CFU/100 mL of irrigation water samples and CFU/g of agricultural soil samples.
Molecular confirmation of the isolates was carried out by targeting the rfbEO157 (encodes the E. coli O157 serotype) and fliCH7 (encodes the E. coli flagellum H7 serotype) genes in a polymerase chain reaction (PCR) as described by Wang and colleagues [18]. The PCR products (5.0 μL aliquot each) were electrophoresed in 2% (w/v) agarose gel (Merck, Johannesburg, South Africa) as described by Wang and colleagues [18] and photographed using the ultraviolet transilluminator. A 100-bp DNA ladder (Inqaba Biotec, Pretoria, South Africa) was included in each reaction to serve as a DNA size marker. The primer sequences used in the PCR and the expected amplicon sizes are shown in Table 1. The PCR cycling conditions were: 5 min, 94 °C; 33 cycles [45 s, 94 °C; 30 s, 56 °C; 1 min, 72 °C]; 5 min, 72 °C.
Shiga toxins 1 and 2 encoded by the stx1 and stx2 genes were screened in the confirmed E. coli O157:H7 isolates using PCR as described by Paton and colleagues [19]. These toxins play a role in the development of HUS and happens to be the hallmark of virulence in E. coli O157:H7 [20]. The specific primers used in the screening of the Shiga toxins is shown in Table 1 while the cycling conditions include: 94 °C 3 min, 35 cycles [93 °C 60 s, 55 °C 60 s, 72 °C 60 s] 72 °C 7 min. “E. coli O157:H7 ATCC 35150” was used as a control strain.

2.3. Quantitative Microbial Risk Modelling

Quantitative microbial risk assessment modelling was carried out as described by Codex Alimentarius Commission [22] to determine the probability of illness caused by E. coli O157:H7 in irrigation water and agricultural soil. This was organized into a four-step science-based approach including hazard identification, hazard characterization, exposure assessment and risk characterization.

2.3.1. Hazard Identification

E. coli O157:H7 is an important foodborne pathogen. The identification of this pathogen, and its virulence potentials was carried out in the laboratory as described above. Its frequency distribution was analyzed to predict the health risks associated with contaminated irrigation water and agricultural soil.

2.3.2. Hazard Characterization

The adverse health effects associated with the occurrence of E. coli O157:H7 in irrigation water and agricultural soil was carried out using the hazard characterization. This analysis assumed that a single cell of E. coli O157:H7 will cause an infection and defines the relationship between the doses of E. coli O157:H7 and the corresponding negative health effects on the exposed population [23]. The ingestion dose of E. coli O157:H7 was therefore calculated using the following equation [24];
D = (Iv × Mc)
where D denotes the ingestion dose of E. coli O157:H7, Iv denotes the ingested volume of irrigation water and agricultural soil and Mc denotes the mean concentration of E. coli O157:H7.
A “Beta-Poisson model” [25] was used to estimate the risk allied to E. coli O157:H7 as shown in the following equation;
Pinf = 1 − (1 + D/β)α
where Pinf denotes the probability of infection that will occur in an individual exposed to a particular dose (D) of E. coli O157:H7, D denotes the ingestion dose of E. coli O157:H7, α and β denote the shape parameters and in this case, α is 0.0571 and β is 2.2183 [24].

2.3.3. Exposure Assessment

This assessment was carried out to: (a) assess the pathways by which E. coli O157:H7 can be moved from irrigation water and agricultural soil to the point of contact with human beings and (b) evaluate the amount of exposure that exists between humans and E. coli O157:H7. The exposure parameter (E) was evaluated by considering factors such as the concentration of pathogen in the environmental matrix, ingested volumes of the matrix, viability of the pathogen, and recovery efficacy of the methods in the following equation [26]:
E = CR−1·IM
where E denotes Exposure., C denotes the mean concentration of E. coli O157:H7 per 100 mL of irrigation water samples or per gram of soil samples., R denotes the recovery efficacy of the isolation method., I denote the fraction of detected E. coli O157:H7 capable of causing severe infection- that is, the isolates that produce the shiga toxins., and M denotes the amount of irrigation water and soil ingested per day. Parameters inputted for exposure assessment are shown in Table 2.
Recovery efficacy (R) was considered to prevent the over/underestimation of the pathogen concentration as well as the exposure using the following equation [26]:
R = (Po − P/Po) × 100
where “Po” denotes the presumptive number of E. coli O157:H7 isolates in irrigation water and agricultural soil samples and “P” denotes the confirmed isolates following cultural and molecular methods.

2.3.4. Risk Characterization

This was carried out to predict the incidence of health issues related to E. coli O157:H7 based on hazard identification, hazard characterization and exposure assessment. In this study, data from the dose-response and exposure assessment were integrated into a yearly probability of infection (Pinf/y) equation [24] as shown below.
Pinf/y = 1 − (1 − Pinf) E
where Pinf/y denotes the yearly probability of infection, Pinf denotes the probability of infection due to a single exposure to an ingested dose (D) of E. coli O157:H7 and E denote the exposure.
To predict the annual risk of acute gastrointestinal disease, the following risk of illness equation was used [24];
Pill = Pinf/y × Pill/inf
where Pill denotes the annual risk of diarrheal disease, Pinf/y denotes the annual probability of infection and Pill/inf denotes the illness constant with respect to the etiologic agents. Pill/inf for E. coli is 0.25 [29].
A Monte Carlo simulation with 10,000 iterations was used to evaluate the risk associated with the exposure to E. coli O157:H7. The modelling was performed using R software version 3.0.3 (Development Core Team from Vienna, Austria) with the application of the R package (fitdistrplus) to fit the distribution of pathogen concentrations.

3. Results

3.1. The Concentration and Identification of E. coli O157:H7 in the Samples

In this study, the concentration of E. coli O157:H7 in irrigation water samples ranged from 0.000 in S12 and S17 to 13.000 × 103 CFU/100 mL in S18 with a mean level of 1.328 × 103 CFU/100 mL as shown in Figure 2. In addition, the concentration of E. coli O157:H7 in agricultural soil samples ranged from 0.167 × 103 in S12 to 16.333 × 103 CFU/g in S9 with a mean level of 2.482 × 103 CFU/g as shown in Figure 2.
The occurrence of the confirmed E. coli O157:H7 and its shigatoxigenic variants in the samples are shown in Figure 3. Out of 202 presumptive isolates recovered from the irrigation water and soil samples, 46 (23%) were confirmed following the molecular techniques. Here, 18 (39%) of these were confirmed in the irrigation water samples while 28 (61%) were confirmed in the soil samples.
Of the confirmed E. coli O157:H7, 13 (28%) are shiga toxin E. coli O157:H7 (STEC O157:H7). Nine (50%) of which were detected in irrigation water samples and 4 (14%) were detected in the soil samples. Of the STEC O157:H7 isolated from the irrigation water samples, 2 (22%) harbored the stx1 gene while 7 (78%) harbored the stx2 gene. All the STEC O157:H7 isolated from the soil samples harbored the stx1 gene as shown in Figure 3.

3.2. Dose Modelling and Hazard Characterization

The results of dose modelling and hazard characterization of E. coli O157:H7 in irrigation water and agricultural soil in the study sites are presented in Table 3. In adults, a 3.30 × 10−1 probability of infection due to 13.28 × 103 ingestion dose of E. coli O157:H7 in irrigation water was recorded. At maximum ingestion dose of 130.00 × 103, a 4.70 × 10−1 probability of infection was recorded. A 0.00 probability of infection was recorded at minimum ingestion dose of 0.00. The probability of infection in children was not recorded because the parameter for the ingested volume of irrigation water by children was not available. Conversely, a 4.30 × 10−1 probability of infection due to 124.10 × 103 ingestion dose of E. coli O157:H7 in agricultural soil was recorded for adults. At minimum ingestion dose of 8.33 × 103, the probability of infection was 3.80 × 10−1 while at maximum ingestion dose of 816.67 × 103, the probability of infection was 5.20 × 10−1. In children, a 4.50 × 10−1 probability of infection at 248.21 × 103 ingestion dose of E. coli O157:H7 in agricultural soil was recorded. At minimum ingestion dose of 16.67 × 103, a 4.00 × 10−1 probability of infection was recorded while at maximum ingestion dose of 1633.33 × 103, a 5.40 × 10−1 probability of infection was recorded.

3.3. Exposure Assessment

The scope of human exposure to E. coli O157:H7 in irrigation water and agricultural soil is shown in Figure 4. Based on the parameters inputted for exposure assessment, the estimated adult exposure to E. coli O157:H7 in irrigation water was found to be 8.000 × 103 ranging from 0.000 to 78.313 × 103 as shown in Table 4. The exposure parameter for children exposed to E. coli O157:H7 in irrigation water was not determined. In addition, the estimated exposure for adults exposed to E. coli O157:H7 in agricultural soil was found to be 24.470 × 103 ranging from 1.647 × 103 to 161.030 × 103. In children, the exposure to E. coli O157:H7 in agricultural soil was 48.941 ×103 ranging from 3.293 × 103 to 322.059 × 103 as shown in Table 4.

3.4. Risk Characterization

The annuitized risk of infection and risk of acute gastrointestinal disease in exposed adults and children to E. coli O157:H7 in irrigation water and agricultural soil are presented in Table 5. The mean and maximum annual risk of infection in adults exposed to contaminated irrigation water was 1.0, with a 0.0 minimum risk of infection. The annual risk of infection among children exposed to contaminated irrigation water was not determined. Interestingly, the mean, minimum and maximum annual risk of infection in both adults and children exposed to contaminated agricultural soil was 1.0.
The annuitized risk of diarrheal disease in adults exposed to E. coli O157:H7 in irrigation water was 25.0 × 10−2 with a range of 0.0 to 25.0 × 10−2. The annual risk of diarrheal disease in children exposed to E. coli O157:H7 in irrigation water was not evaluated. However, the mean, minimum and maximum annual risk of diarrheal disease in both adults and children exposed to E. coli O157:H7 in agricultural soil was 25.0 × 10−2.

4. Discussion

In this study, the probability of infection and risk of acute gastrointestinal disease attributed to E. coli O157:H7 in irrigation water and agricultural soil samples collected from Amathole and Chris Hani District Municipalities were estimated using the science-based stochastic QMRA approach. For over 35 years, the QMRA has been employed to proffer recommendations for improving the general wellbeing of the population with respect to food, water, environment, remediation and so on [30]. Through the combination of exposure assessments and microbial analysis, the QMRA can complement epidemiological studies in assessing public health risks especially in developing countries [31].
E. coli O157:H7 represents one of the significant foodborne pathogens due to its high virulence potentials and ability to cause severe diseases in humans. The perseverance of this pathogen within the agricultural niche is detrimental to food safety and the general wellbeing of the population. In this study, a relatively high abundance of E. coli O157:H7 was recorded in the irrigation water and agricultural soil samples, exacerbating the risk of infection among the exposed population. The mean concentration of E. coli O157:H7 in irrigation water samples exceeded the South African Department of Water Affairs (DWAF) standard for faecal coliforms in domestic water (0.0 CFU/100 mL) [32] as well as the World Health Organization (WHO) standard for coliforms in wastewater used for agriculture and aquaculture (≤100 CFU/100 mL) [33], thus making it a chief exposure medium for E. coli O157:H7. There are no established guidelines for the tolerable concentration of E. coli O157:H7 in agricultural soil. However, the soil naturally harbours diverse pathogenic bacteria and it’s open to several points and non-point sources of contamination, also making it a chief exposure medium for E. coli O157:H7.
The occurrence of confirmed E. coli O157:H7 and its shigatoxigenic strains in agricultural niches such as irrigation water an agricultural soil indicates a threat to food safety and the general wellbeing of the potential exposed population. At a prevalence rate of 23%, the occurrence of E. coli O157:H7 in the irrigation water and agricultural soil in the present study is relatively high, exceeding that recorded in diverse farm environments including beef, dairy, poultry and swine environments [34]. This is catastrophic as 28% of the confirmed isolates are shigatoxigenic with great potential of causing severe forms of gastrointestinal disease.
The common routes by which susceptible population including adults and children can be exposed to E. coli O157:H7 in irrigation water and agricultural soil were presented in the present study (Figure 4). It was indicated that the consumption of fresh produce contaminated by irrigation water and soil is an important exposure pathway for E. coli O157:H7, potentially putting the lives of consumers, distributors and processors in peril. This is consistent with the findings of Park et al., 2012 who indicated that irrigation water is a significant contamination route of fresh produce during primary agricultural production [35]. The unintentional inhalation, dermal contact and ingestion of irrigation water and soil particles containing E. coli O157:H7 could potentially endanger the lives of farmers, co-workers and family members carrying out agricultural activities on the farms. Children and community residents playing in the soil, swimming and fetching water from irrigation water sources for domestic reasons could potentially become exposed to E. coli O157:H7 via ingestion, inhalation and dermal contact, thus increasing their risks of infection.
Generally, the risk of infection resulting from the exposure to pathogenic microbes is contingent upon certain factors such as the virulence and infectivity of the pathogen, the exposure routes which is usually influenced by the behaviour of the environmental matrix, and the ingestion dose of the pathogen [36]. According to the WHO, the annual tolerable reference level of human health risk attributed to drinking water is 1 × 10−4 [37] and that attributed to excreta and greywater used for agricultural activities is 1 × 10−6 DALY [38]. These standards were used as benchmarks to critique the health risks generated in the present study.
In this study, the daily risk (probability) of infection among adults exposed to E. coli O157:H7 in irrigation water was 3.3 × 10−1 and 4.7 × 10−1 at maximum, assuming they intentionally or unintentionally ingest 10 mL of contaminated irrigation water per day. At the same ingestion volume, the minimum probability of infection was 0. This is because the minimum concentration of E. coli O157:H7 in the water samples was 0 CFU/100 mL. This indicates that the absence of pathogens in irrigation water results in zero health risks among the population utilizing the irrigation water sources for agricultural and domestic activities. Unfortunately, the mean and maximum annuitized risk of infection among adults exposed to E. coli O157:H7 in irrigation water was 1, exceeding the permissible WHO benchmark. This also surpassed the findings of Kouame et al. who documented an annual risk of 20.0 × 10−2 attributed to E. coli O157:H7 in water used for the irrigation of vegetables [24]. Interestingly, our findings corroborate a previous study that documented a high infection risk that ranged from 90.07% to 99.9% attributed to E. coli O157:H7 in reclaimed wastewater and lagoon [31]. This confirms that the quality of water used for irrigation purposes in the study sites are poor, thus endangering the lives of the possible exposed population.
There is a scarcity of studies that estimate the health risks attributed to E. coli O157:H7 in agricultural soil. In this study, the mean (4.3 × 10−1), minimum (3.8 × 10−1) and maximum (5.2 × 10−1) daily risk of infection among adults exposed to E. coli O157:H7 in agricultural soil are relatively high, assuming they intentionally or accidentally ingest 50 mg of contaminated soil particles per day. A much higher mean (4.5 × 10−1), minimum (4.0 × 10−1) and maximum (5.4 × 10−1) daily risk of infection was recorded for children based on the assumption that they intentionally or accidentally ingest 100 mg of contaminated soil particles per day. This consequently led to a 100% annual risk of infection among adults and children exposed to E. coli O157:H7 in agricultural soil, exceeding the WHO tolerable limits. This corroborates a similar finding whereby the mean annual infection risk attributed to Cryptosporidium oocyst in the soil was 85% for adults and 100% for children as well as the mean annual infection risk attributed to Giardia cyst in the soil was 100% for both adults and children [26]. However, a lower annual risk of 54.7% was recorded for E. coli in a contaminated soil from open space and a playground for children [36].
The sequence of events that occur between E. coli O157:H7 infection and the establishment of a disease is poorly understood. However, it has been shown that the ingestion of an inoculum size as low as 100 organisms is capable of causing an illness [39]. A portion of that inoculum must be able to survive the acidic nature of the stomach and then inhabit the intestine [40]. In this study, a very high probability of acute intestinal disease (diarrhoea) attributed to E. coli O157:H7 in irrigation water and agricultural soil in both adults and children was reported (estimated at 25.0 × 10−2 per person per year). This exceeded the maximum allowable diarrheal disease risk of 1.0 × 10−3 per person per year stipulated by the WHO [38,41]. Our results also exceeded the findings of Kouamé et al. who reported a 4.6 × 10−2 probability of diarrheal disease attributed to E. coli O157:H7 in wastewater used for farming activities [24]. This indicates that a high probability of diarrheal disease could occur in adults and children exposed to the irrigation water and agricultural soil within the study sites of the present study. This is catastrophic and can lead to a disease outbreak if nothing is urgently carried out.

5. Study Limitations

While this study detailed the probability of infection and the probability of illness attributed to E. coli O157:H7 in irrigation water and agricultural soil, it is worthy to note that the assessment assumed that all the exposed individuals will have the same chance of becoming infected. In reality, this might not always be the case as certain factors such as the immune status, ingestion dose, age, gender and presence of co-morbidities in the exposed population might influence the outcome of the exposure to E. coli O157:H7 in irrigation water and agricultural soil [37].

6. Conclusions

This study demonstrated a high concentration of E. coli O157:H7 in the irrigation water and agricultural soil samples collected from the study sites. Consequently, a high probability of infection and risk of acute gastrointestinal disease among the exposed population living around the study sites was recorded, thus posing serious health risks to the general public. This suggests the need to urgently develop evidence-based interventions to manage and minimize the health risks attributed to E. coli O157:H7 in the agricultural milieu. We recommend that QMRA of other preharvest contamination routes such as harvesting tools, organic manure and feral faecal materials be carried out to have a complete profile of the health risks emanating from the preharvest agricultural production for more balanced interventions.

Author Contributions

C.D.I., A.I.O. and A.M.A.M. conceptualized and designed the study. C.D.I. collected the data. C.D.I., C.J.I.-J. and M.E.O. analysed the data and prepared the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the South African Medical Research Council.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cook, K.L.; Givan, E.C.; Mayton, H.M.; Parekh, R.R.; Taylor, R.; Walker, S.L. Using the agricultural environment to select better surrogates for foodborne pathogens associated with fresh produce. Int. J. Food Microbiol. 2017, 262, 80–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Murray, K.; Wu, F.; Shi, J.; Xue, S.J.; Warriner, K. Challenges in the microbiological food safety of fresh produce: Limitations of post-harvest washing and the need for alternative interventions. Food Qual. Saf. 2017, 1, 289–301. [Google Scholar] [CrossRef] [Scilit]
  3. Steele, M.; Odumeru, J. Irrigation water as source of foodborne pathogens on fruit and vegetables. J. Food Prot. 2004, 67, 2839–2849. [Google Scholar] [CrossRef] [Scilit]
  4. Jongman, M.; Korsten, L. Irrigation water quality and microbial safety of leafy greens in different vegetable production systems: A review. Food Rev. Int. 2018, 34, 308–328. [Google Scholar] [CrossRef] [Scilit]
  5. Islam, M.; Morgan, J.; Doyle, M.P.; Phatak, S.C.; Millner, P.; Jiang, X. Persistence of Salmonella enterica Serovar Typhimurium on Lettuce and Parsley and in Soils on Which They Were Grown in Fields Treated with Contaminated Manure Composts or Irrigation Water. Foodborne Pathog. Dis. 2004, 1, 27–35. [Google Scholar] [CrossRef] [Scilit]
  6. Al-Ajmi, D.; Rahman, S.; Banu, S. Occurrence, virulence genes, and antimicrobial profiles of Escherichia coli O157 isolated from ruminants slaughtered in Al Ain, United Arab Emirates. BMC Microbiol. 2020, 20, 210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Iwu, C.D.; du Plessis, E.; Korsten, L.; Okoh, A.I. Prevalence of Escherichia coli O157:H7 strains in irrigation water and agricultural soil in two district municipalities in South Africa. Int. J. Environ. Stud. 2020, 78, 474–483. [Google Scholar] [CrossRef] [Scilit]
  8. Iwu, C.D.; Okoh, A.I. Characterization of antibiogram fingerprints in Listeria monocytogenes recovered from irrigation water and agricultural soil samples. PLoS ONE 2020, 15, e0228956. [Google Scholar] [CrossRef] [Scilit]
  9. Iwu, C.D.; du Plessis, E.M.; Korsten, L.; Nontongana, N.; Okoh, A.I. Antibiogram Signatures of Some Enterobacteria Recovered from Irrigation Water and Agricultural Soil in two District Municipalities of South Africa. Microorganisms 2020, 8, 1206. [Google Scholar] [CrossRef] [Scilit]
  10. Erickson, M.C.; Webb, C.C.; Davey, L.E.; Payton, A.S.; Flitcroft, I.D.; Doyle, M. Internalization and Fate of Escherichia coli O157:H7 in Leafy Green Phyllosphere Tissue Using Various Spray Conditions. J. Food Prot. 2014, 77, 713–721. [Google Scholar] [CrossRef] [Scilit]
  11. Njie, C.; Carlos, C. International Journal of Food Microbiology Characterisation of Escherichia coli O157 strains from humans, cattle and pigs in the North–West Province, South Africa. Int. J. Food Microbiol. 2008, 128, 181–188. [Google Scholar] [CrossRef] [Scilit]
  12. Ibekwe, A.M.; Papiernik, S.K.; Grieve, C.M.; Yang, C.H. Quantification of persistence of Escherichia coli O157:H7 in contrasting soils. Int. J. Microbiol. 2011, 2011, 421379. [Google Scholar] [CrossRef] [Scilit]
  13. Lupindu, A.M. Epidemiology of Shiga toxin-producing Escherichia coli O157:H7 in Africa in review. S. Afr. J. Infect. Dis. 2018, 33, 24–30. [Google Scholar] [CrossRef] [Scilit]
  14. Geronimo Portable Device Can Detect Escherichia coli in 20 Min.—NYU Abu Dhabi. Available online: https://nyuad.nyu.edu/en/news/latest-news/science-and-technology/2017/november/portable-device-can-detect-e-coli-in-20-minutes.html (accessed on 21 January 2021).
  15. World Health Organization. Quantitative Microbial Risk Assessment: Application for Water Safety Management. Available online: http://www.who.int/water_sanitation_health/publications/qmra/en/ (accessed on 25 April 2018).
  16. ECSECC Eastern Cape Socio Economic Consultative Council. Amathole District Municipality Socio Economic Review and Outlook, 2017; ECSECC: Vincent, Italy, 2017. [Google Scholar]
  17. CHDM. About Us—Chris Hani District Municipality. Available online: https://www.chrishanidm.gov.za/municipality/about-us/ (accessed on 30 January 2021).
  18. Wang, G.; Clark, C.G.; Rodgers, F.G. Detection in Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J. Clin. Microbiol. 2002, 40, 3613–3619. [Google Scholar] [CrossRef] [Scilit]
  19. Paton, A.W.; Paton, J.C. Detection and Characterization of Shiga Toxigenic Escherichia coli by Using Multiplex PCR Assays for stx 1, stx 2, eaeA, Enterohemorrhagic Escherichia coli hlyA, rfb O111, and rfb O157. J. Clin. Microbiol. 1998, 36, 598–602. [Google Scholar] [CrossRef] [Scilit]
  20. Rahal, E.A.; Kazzi, N.; Nassar, F.J.; Matar, G.M. Escherichia coli O157:H7—Clinical aspects and novel treatment approaches. Front. Cell. Infect. Microbiol. 2012, 2, 138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Nazemi, A.; Mirinargasi, M.; Khataminezhad, M.R.; Shokouhi Mostafavi, S.K.; Sharifi, S.H. Detection of stx1, stx2, LT and ST toxin genes and O157 and H7 antigen genes among uropathogenic Escherichia coli isolates from Iran. Afr. J. Microbiol. Res. 2012, 6, 867–869. [Google Scholar] [CrossRef] [Scilit]
  22. CAC Codex Alimentarius Commission. Principles and Guidelines for the Conduct of Microbiological Risk Management (MRM). Available online: http://www.fao.org/docrep/004/y1579e/y1579e05.htm (accessed on 26 April 2018).
  23. Haas, C.N.; Rose, J.B.; Gerba, C.P. Quantitative Microbial Risk Assessment; John Wiley & Sons, Inc.: New York, NY, USA, 1999; ISBN 9780471183976. [Google Scholar]
  24. Kouamé, P.K.; Nguyen-viet, H.; Dongo, K.; Zurbrügg, C.; Biémi, J.; Bonfoh, B. Microbiological risk infection assessment using QMRA in agriculture systems in Côte d’ Ivoire, West Africa. Environ. Monit. Assess. 2017, 189, 587. [Google Scholar] [CrossRef] [Scilit]
  25. Mok, H.-F.; Barker, S.F.; Hamilton, A.J. A probabilistic quantitative microbial risk assessment model of norovirus disease burden from wastewater irrigation of vegetables in Shepparton, Australia. Water Res. 2014, 54, 347–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Balderrama-Carmona, A.P.; Gortáres-Moroyoqui, P.; Álvarez-Valencia, L.H.; Castro-Espinoza, L.; Mondaca-Fernández, I.; Balderas-Cortés, J.d.J.; Chaidez-Quiroz, C.; Meza-Montenegro, M.M. Occurrence and quantitative microbial risk assessment of Cryptosporidium and Giardia in soil and air samples. Int. J. Infect. Dis. 2014, 26, 123–127. [Google Scholar] [CrossRef] [Scilit]
  27. Shuval, H.; Lampert, Y.; Fattal, B. Development of a risk assessment approach for evaluating wastewater reuse standards for agriculture. Water Sci. Technol. 1997, 35, 15–20. [Google Scholar] [CrossRef] [Scilit]
  28. United States Environmental Protection Agency. Exposure Factors Handbook (1997, Final Report); EPA/600/P-95/002F a–c; U.S. Environmental Protection Agency: Washington, DC, USA, 1997.
  29. Howard, G.; Pedley, S.; Tibatemwa, S. Quantitative microbial risk assessment to estimate health risks attributable to water supply: Can the technique be applied in developing countries with limited data? J. Water Health 2006, 4, 49–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Haas, C.N. Quantitative Microbial Risk Assessment and Molecular Biology: Paths to Integration. Environ. Sci. Technol. 2020, 54, 8539–8546. [Google Scholar] [CrossRef] [Scilit]
  31. Yapo, R.I.; Koné, B.; Bonfoh, B.; Cissé, G.; Zinsstag, J.; Nguyen-Viet, H. Quantitative microbial risk assessment related to urban wastewater and lagoon water reuse in Abidjan, Côte d’Ivoire. J. Water Health 2014, 12, 301–309. [Google Scholar] [CrossRef] [Scilit]
  32. DWAF, Department of Water Affairs and Forestry. South African Water Quality Guidelines. Domest. Water Use 2012, 1, 1–197. [Google Scholar]
  33. WHO, World Health Organization. Health Guidelines for the Use of Wastewater in Agriculture and Aquaculture. Available online: https://apps.who.int/iris/bitstream/handle/10665/39401/WHO_TRS_778.pdf?sequence=1&isAllowed=y (accessed on 3 June 2020).
  34. Doane, C.A.; Pangloli, P.; Richards, H.A.; Mount, J.R.; Golden, D.A.; Draughon, F.A. Occurrence of Escherichia coli O157:H7 in diverse farm environments. J. Food Prot. 2007, 70, 6–10. [Google Scholar] [CrossRef] [Scilit]
  35. Park, S.; Szonyi, B.; Gautam, R.; Nightingale, K.; Anciso, J.; Ivanek, R. Risk Factors for Microbial Contamination in Fruits and Vegetables at the Preharvest Level: A Systematic Review. J. Food Prot. 2012, 75, 2055–2081. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Katukiza, A.Y.; Ronteltap, M.; van der Steen, P.; Foppen, J.W.A.; Lens, P.N.L. Quantification of microbial risks to human health caused by waterborne viruses and bacteria in an urban slum. J. Appl. Microbiol. 2014, 116, 447–463. [Google Scholar] [CrossRef] [Scilit]
  37. Fewtrell, L.; Bartram, J. Water Quality: Guidelines, Standards and Health: Assessment of Risk and Risk Management for Water-Related Infectious Diseases; IWA Publishing: London, UK, 2001. [Google Scholar]
  38. WHO World Health Organization. Guidelines for the Safe Use of Wastewater, Excreta and Greywater—Volume 4. Available online: http://www.who.int/water_sanitation_health/publications/gsuweg4/en/ (accessed on 18 January 2021).
  39. Tilden, J.; Young, W.; McNamara, A.M.; Custer, C.; Boesel, B.; Lambert-Fair, M.A.; Majkowski, J.; Vugia, D.; Werner, S.B.; Hollingsworth, J.; et al. A new route of transmission for Escherichia coli: Infection from dry fermented salami. Am. J. Public Health 1996, 86, 1142–1145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Foster, J.W. Escherichia coli acid resistance: Tales of an amateur acidophile. Nat. Rev. Microbiol. 2004, 2, 898–907. [Google Scholar] [CrossRef] [Scilit]
  41. Forslund, A.; Ensink, J.H.J.; Markussen, B.; Battilani, A.; Psarras, G.; Gola, S.; Sandei, L.; Fletcher, T.; Dalsgaard, A. Escherichia coli contamination and health aspects of soil and tomatoes (Solanum lycopersicum L.) subsurface drip irrigated with on-site treated domestic wastewater. Water Res. 2012, 46, 5917–5934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. (A) Study sites in Amathole District Municipality, Eastern Cape Province, South Africa; (B) Study sites in Chris Hani District Municipality, Eastern Cape Province, South Africa.
Figure 1. (A) Study sites in Amathole District Municipality, Eastern Cape Province, South Africa; (B) Study sites in Chris Hani District Municipality, Eastern Cape Province, South Africa.
Sustainability 14 01878 g001aSustainability 14 01878 g001b
Figure 2. The Concentration of E. coli O157:H7 in irrigation water and agricultural soil samples. Soil samples were not collected from S1, S4, S6, S10, S15 and S19 due to our inaccessibility to the farms.
Figure 2. The Concentration of E. coli O157:H7 in irrigation water and agricultural soil samples. Soil samples were not collected from S1, S4, S6, S10, S15 and S19 due to our inaccessibility to the farms.
Sustainability 14 01878 g002
Figure 3. The number of confirmed E. coli O157:H7, its shiga toxigenic strains and stx genes in irrigation water and agricultural soil samples.
Figure 3. The number of confirmed E. coli O157:H7, its shiga toxigenic strains and stx genes in irrigation water and agricultural soil samples.
Sustainability 14 01878 g003
Figure 4. Possible ways humans can be exposed to E. coli O157:H7 in irrigation water and agricultural soil.
Figure 4. Possible ways humans can be exposed to E. coli O157:H7 in irrigation water and agricultural soil.
Sustainability 14 01878 g004
Table 1. Primer sequence and expected amplicon sequence sizes used in the detection of E. coli O157:H7 and the screening of shiga toxins.
Table 1. Primer sequence and expected amplicon sequence sizes used in the detection of E. coli O157:H7 and the screening of shiga toxins.
PrimerPrimer Sequence (5′-3′)Target Genes Amplicon Size (bp)Reference
FliCH7F: TACCATCGCAAAAGCAACTCCfliCH7247[18]
R: GTCGGCAACGTTAGTGATACC
RfbEF: CTACAGGTGAAGGTGGAATGGrfbEO157327[21]
R: ATTCCTCTCTTTCCTCTGCGG
Stx1F: ATAAATCGCCATTCGTTGACTACstx1180[19]
R: AGAACGCCCACTGAGATCATC
Stx2F: GGCACTGTCTGAAACTGCTCCstx2255[19]
R: TCGCCAGTTATCTGACATTCTG
Table 2. Exposure assessment parameters in children and adult population.
Table 2. Exposure assessment parameters in children and adult population.
Irrigation WaterAgricultural Soil
ParameterDataSourceParameterDataSource
Concentration (C) of E. coli O157:H7 (CFU/100mL)Min: 0.000
Mean: 1.328 × 103
Max: 13.000 × 103
This studyConcentration (C) of E. coli O157:H7 (CFU/g)Min: 0.167 × 103
Mean: 2.482 × 103
Max: 16.333 × 103
This study
Recovery efficiency (R) (%)83This studyRecovery efficiency (R) (%)71This study
Proportion (I) of E. coli O157:H7 capable of causing severe infection (that is STEC O157:H7) (%)50This studyProportion (I) of E. coli O157:H7 capable of causing severe infection (that is STEC O157:H7) (%)14This study
Amount (M) of water ingested by adults during farming (mL/day)10[27]Amount (M) of soil and dust ingested by adults (mg/day)50[28]
Amount (M) of water ingested by children during farmingNot given Amount (M) of soil and dust ingested by children (mg/day)100[28]
Min: Minimum, Max: Maximum.
Table 3. The daily probability of infection based on hazard characterization in irrigation water and agricultural soil samples.
Table 3. The daily probability of infection based on hazard characterization in irrigation water and agricultural soil samples.
ParameterIrrigation WaterAgricultural Soil
MinMeanMaxMinMeanMax
Ingestion dose (D) in adults 0.0013.28 × 103130.00 × 1038.33 × 103124.10 × 103816.67 × 103
Ingestion dose (D) in children---16.67 × 103248.21 × 1031633.33 × 103
Probability of infection (Pinf) in adults (daily risk)0.003.30 × 10−14.70 × 10−13.80 × 10−14.30 × 10−15.20 × 10−1
Probability of infection (Pinf) in children (daily risk)---4.00 × 10−14.50 × 10−15.40 × 10−1
Min: Minimum, Max: Maximum.
Table 4. The evaluated exposures in children and adults.
Table 4. The evaluated exposures in children and adults.
ParameterIrrigation WaterAgricultural Soil
Exposure (E) in adultsMin: 0.000
Mean: 8.000 × 103
Max: 78.313 × 103
Min: 1.647 ×103
Mean: 24.470 × 103
Max: 161.030 × 103
Exposure (E) in childrenNot determinedMin: 3.293 × 103
Mean: 48.941 × 103
Max: 322.059 × 103
Min: Minimum, Max: Maximum.
Table 5. The annual health risk due to ingestion of E. coli O157:H7 in irrigation water and agricultural soil.
Table 5. The annual health risk due to ingestion of E. coli O157:H7 in irrigation water and agricultural soil.
ParameterIrrigation WaterAgricultural Soil
MinMeanMaxMinMeanMax
Annual risk (Pinf/y) in adults0.01.01.01.01.01.0
Annual risk (Pinf/y) in children---1.01.01.0
Annual risk of diarrheal disease (Pill) in adults0.025.0 × 10−225.0 × 10−225.0 × 10−225.0 × 10−225.0 × 10−2
Annual risk of diarrheal disease (Pill) in children---25.0 × 10−225.0 × 10−225.0 × 10−2
Min: Minimum, Max: Maximum.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Iwu, C.D.; Iwu-Jaja, C.J.; Okoh, A.I.; Otim, M.E.; Al Marzouqi, A.M. Estimating the Risk of Acute Gastrointestinal Disease Attributed to E. coli O157:H7 in Irrigation Water and Agricultural Soil: A Quantitative Microbial Risk Assessment. Sustainability 2022, 14, 1878. https://doi.org/10.3390/su14031878

AMA Style

Iwu CD, Iwu-Jaja CJ, Okoh AI, Otim ME, Al Marzouqi AM. Estimating the Risk of Acute Gastrointestinal Disease Attributed to E. coli O157:H7 in Irrigation Water and Agricultural Soil: A Quantitative Microbial Risk Assessment. Sustainability. 2022; 14(3):1878. https://doi.org/10.3390/su14031878

Chicago/Turabian Style

Iwu, Chidozie Declan, Chinwe Juliana Iwu-Jaja, Anthony Ifeanyin Okoh, Michael Ekubu Otim, and Amina M. Al Marzouqi. 2022. "Estimating the Risk of Acute Gastrointestinal Disease Attributed to E. coli O157:H7 in Irrigation Water and Agricultural Soil: A Quantitative Microbial Risk Assessment" Sustainability 14, no. 3: 1878. https://doi.org/10.3390/su14031878

APA Style

Iwu, C. D., Iwu-Jaja, C. J., Okoh, A. I., Otim, M. E., & Al Marzouqi, A. M. (2022). Estimating the Risk of Acute Gastrointestinal Disease Attributed to E. coli O157:H7 in Irrigation Water and Agricultural Soil: A Quantitative Microbial Risk Assessment. Sustainability, 14(3), 1878. https://doi.org/10.3390/su14031878

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop