Next Article in Journal
Regional Variability in Growth and Leaf Functional Traits of Mitragyna speciosa in Thailand
Previous Article in Journal
Target Selection, Homokaryotic Isolation, and Screening Methods for Gene Editing in the Destructive Global Pathogen, Phytophthora cinnamomi
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Fungal Community Dynamics in Cyperus rotundus: Implications for Rhizophora mangle in a Mangrove Ecosystem

by
Diego Portalanza
1,2,3,*,
Arianna Acosta-Mejillones
1,
Johnny Alcívar
1,
Teddy Colorado
1,
Jeancarlo Guaita
1,
Lesly Montero
1,
Liliana Villao-Uzho
4 and
Efren Santos-Ordóñez
4,5,*
1
Carrera de Ingeniería Ambiental, Facultad de Ciencias Agrarias, Universidad Agraria del Ecuador (UAE), Av. 25 de Julio, Guayaquil 090104, Ecuador
2
Climate Research Group (GPC), Department of Physics, Center of Natural and Exact Sciences, Federal University of Santa Maria, Av. Roraima, Santa Maria 1000, RS, Brazil
3
Instituto de Investigación, Escuela de Posgrado “Ing. Jacobo Bucaram Ortiz, Ph.D”, Universidad Agraria del Ecuador (UAE), Avenida 25 de Julio, Guayaquil 090104, Ecuador
4
Biotechnological Research Center of Ecuador, ESPOL Polytechnic University, Escuela Superior Politécnica del Litoral, ESPOL, Gustavo Galindo Campus, Km. 30.5 Vía Perimetral, Guayaquil 090902, Ecuador
5
Faculty of Life Sciences, ESPOL Polytechnic University, Escuela Superior Politécnica del Litoral, ESPOL, Gustavo Galindo Campus, Km. 30.5 Vía Perimetral, Guayaquil 090902, Ecuador
*
Authors to whom correspondence should be addressed.
Int. J. Plant Biol. 2025, 16(1), 23; https://doi.org/10.3390/ijpb16010023
Submission received: 14 January 2025 / Revised: 31 January 2025 / Accepted: 17 February 2025 / Published: 19 February 2025
(This article belongs to the Section Plant Ecology and Biodiversity)

Abstract

Mangrove ecosystems are globally significant for their biodiversity and ecosystem services but face persistent threats from invasive species and anthropogenic disturbances. This study investigates the interactions between Cyperus rotundus, a widespread invasive weed, and fungal communities in the mangrove-adjacent wetlands of Isla Santay, Ecuador. Using metagenomic sequencing of the ITS region, we analyzed fungal diversity in samples from an anthropogenically pressured area and a non-impacted site. Results revealed significant differences in microbial assemblages: the rhizosphere sample from the disturbed area exhibited lower fungal richness and was dominated by Magnaporthaceae (9%) and Aureobasidium melanogenum (5%), both associated with stress-tolerant traits. In contrast, the rhizosphere sample from the non-impacted site showed higher species diversity, with Cladosporium dominicanum (62%) and Talaromyces (11%) as dominant endophytic taxa. Principal Coordinates Analysis (PCoA) and co-occurrence networks highlighted distinct fungal partitioning between the two sample tissues, indicating that C. rotundus mediates microbial composition in response to environmental gradients. These findings underscore the role of microbial communities in the plant’s invasive success and suggest that leveraging beneficial fungi could enhance ecosystem resilience and support wetland restoration. By integrating molecular approaches with ecological insights, this work contributes to a deeper understanding of microbial dynamics in coastal wetlands and informs targeted management strategies to preserve mangrove habitats.

1. Introduction

Wetlands are known for their ecological importance, providing vital ecosystem services such as nutrient cycling, water purification, and habitat provision for diverse biotic communities [1]. Despite their significance, these environments are often threatened by multiple stressors, including habitat fragmentation, pollution, climate change, and invasive species [2]. Among these, biological invasions can have especially pronounced effects, often displacing native taxa and altering key ecological processes [3]. Understanding how invasive species interact with environmental variables across human disturbance gradients is crucial for effective wetland management [4].
Santay Island, located in the Guayas River estuary near Guayaquil, Ecuador, exemplifies these challenges. Although this protected area boasts a mosaic of mangrove and wetland habitats, it experiences varying levels of anthropogenic pressure, from sites strongly influenced by urbanization and tourism to zones that remain relatively undisturbed [5,6]. Within these wetlands, Cyperus rotundus (purple nutsedge) has emerged as a persistent and widespread weed, capable of outcompeting native species through rapid growth, efficient resource use, and a resilient rhizome system [7].
Although the ecological impact of C. rotundus is well documented in agricultural and disturbed landscapes, its role in tropical wetlands subject to different gradients of human activity remains poorly understood [8,9]. To address this gap, we used metagenomic analyses of rhizosphere-associated microbial communities in areas with contrasting anthropogenic pressure. Metagenomics enables a high-resolution view of microbial diversity, revealing potential shifts in community composition tied to weed establishment and spread [10]. By comparing microbial assemblages in soils dominated by C. rotundus across heavily impacted and relatively pristine sites, we aim to uncover the ecological underpinnings of invasion success and potential feedbacks on wetland function [11,12].
A key hypothesis arising from this work is that C. rotundus exploits different microbial communities to thrive under varying degrees of disturbance, potentially aligning with an opportunistic, stress-tolerant assemblage in more anthropogenically impacted areas [13,14].
In this short communication, we present preliminary results of our metagenomic analyses, focusing on differences in the structure of the microbial community associated with C. rotundus under contrasting levels of human disturbance. We also discuss the feasibility of future phyto-augmentation interventions in these wetlands. By integrating molecular approaches with ecological perspectives, we aim to offer novel insights into the mechanisms driving C. rotundus invasions and propose targeted management actions that harness microbial partnerships to sustain the ecological integrity of Santay Island’s unique wetland habitats.

2. Materials and Methods

2.1. Study Area

This study was carried out on Isla Santay, located in the Province of Guayas, Ecuador. The area lies at approximately 2 ° 13 39 S and 79 ° 52 13 W, extending over 2179 ha of land and 2505 ha of surrounding waters. The island harbors a mosaic of ecosystems, including mangrove forests, tropical dry formations, wetlands, and areas of secondary vegetation. These habitats experience a tropical climate with pronounced rainy (December–May) and dry (June–November) seasons. The island’s edges are typically dominated by Rhizophora mangle, Avicennia germinans, and Laguncularia racemosa, while the interior hosts diverse plant communities variably affected by anthropogenic disturbances. Permits for this research were obtained through local authorities in accordance with Ecuadorian regulations [15] (Figure 1).

2.2. Sample Collection

This study followed a comparative approach to assess fungal community differences between areas with contrasting levels of anthropogenic pressure. Two samples were collected: one from a site with anthropogenic pressure (near human settlements and subject to disturbances such as trampling and waste deposition) and another from a non-impacted site (a relatively pristine mangrove-adjacent wetland). Each sample consisted in the rhizosphere zone (roots and soil) of the plant Cyperus rotundus. One sample was collected in an anthropogenic area, and the other in a non-anthropogenic area. Sampling locations were selected based on environmental characteristics and previous ecological assessments of Isla Santay, aiming to establish a preliminary baseline for fungal diversity in these contrasting habitats.
Field sampling was carried out during the dry season (June–November) to reduce the potential impact of fluctuating water levels on site accessibility. Whole Cyperus rotundus plants were carefully excavated, and root systems were collected along with a portion of the surrounding rhizosphere soil. Samples were immediately placed in sterile plastic bags, transported on ice in a cooler, and delivered to the laboratory within 6 h to preserve DNA integrity. This method minimized contamination risks and ensured high-quality genetic material for downstream analysis [16,17].

2.3. DNA Extraction

Collected samples were subjected to a CTAB-based extraction protocol [18,19]. Each tissue set (approximately 100 mg) was flash-frozen in liquid nitrogen at about 196 °C and mechanically ground using the grinder MM 400 (Retsch GmbH, Haan, Germany). in 1.5 mL microcentrifuge tubes with glass beads. CTAB buffer (Table 1) was added to each pulverized tissue sample. A preheated ( 65   ° C ) CTAB buffer (Table 1) was then added to each pulverized tissue sample. Tubes were vortexed briefly and incubated in a shaking water bath for 30 min. Concentrations were determined by using NanoDrop™ 2000 (Thermo Scientific™, Wilmington, DE, USA) [19,20]. After cooling and centrifugation, the supernatant was transferred to a new tube, and an equal volume of chloroform:isoamyl alcohol (24:1) was added for phase separation. A second centrifugation step followed, and the aqueous phase was mixed with cold isopropanol for DNA precipitation. Pellets were washed with 70% ethanol, air-dried gently, and re-suspended in 50–100 μ L of nuclease-free water. DNA quality was assessed on 1% agarose gels, and concentrations were determined fluorometrically [21].
For sequencing, at least 1 g of purified DNA per sample was used to construct genomic libraries. Library preparation was performed using ITS primers (ITS86F: GTGAATCATCGAATCTTTGAA and ITS4: TCCTCCGCTTATTGATATGC), following the Fungal Metagenomic Sequencing Demonstrated Protocol (Illumina, San Diego, CA, USA). Sequencing was carried out on a MiSeq platform, generating high-quality reads for fungal community analysis, according to to Garcés-Fiallos et al. [20]. The resulting libraries were processed and analyzed using the ITS Metagenomics App, available via the Illumina Sequence Hub (www.basespace.illumina.com/dashboard accessed on 7 August 2024).

2.4. Library Preparation, Sequencing, and Metagenomic Analysis

Purified DNA from rhizosphere samples was used to investigate fungal communities. The Internal Transcribed Spacer (ITS) region, widely used for fungal identification, was amplified using universal primers (ITS1 and ITS2) in a thermal cycler optimized for high-fidelity enzymes. Amplicons were purified to remove non-specific products, and library preparation incorporated index adapters for high-throughput sequencing [22,23]. Concentrations and fragment sizes were verified via agarose gel and fluorometric measurements. Libraries were sequenced on an Illumina MiSeq platform (2 × 250 bp paired-end reads) following standard protocols.
Quality control of the raw sequencing reads was conducted using FastQC v0.12.1 to ensure high sequence integrity. The total number of sequences obtained per sample was 54,334 for S18 (anthropogenic pressure) and 45,391 for S19 (non-impacted), with sequence lengths ranging from 240 to 251 bp. GC content was 56–57% for S18 and 55% for S19. The percentage of bases with a Phred quality score of Q30 was 85%, while Q20 was 98%, confirming high read precision. No sequences were flagged as poor quality.
To ensure optimal read quality, sequences were processed using Trimmomatic v0.39 to remove adapters and filter out low-quality reads below Q30 or shorter than 200 bp. Chimeric sequences were identified and removed using DADA2 in QIIME2 v2023.5, followed by denoising and amplicon sequence variant (ASV) inference. Operational taxonomic units (OTUs) were clustered using VSEARCH at a 97% similarity threshold, and taxonomic assignments were performed against the UNITE v9.0 and NCBI fungal ITS databases [24,25]. Rarefaction curves were generated to assess sequencing depth and ensure adequate coverage for diversity analyses.
All data analyses were conducted in R (v4.2.0) to assess diversity and community composition. Specifically, we employed the vegan package [26] for calculating alpha-diversity indices, generating dissimilarity matrices (Bray–Curtis), and performing PERMANOVA, while the factoextra package [27] was used for ordination visualization and interpretation. Alpha-diversity indices, such as Shannon–Weaver and Simpson indices, were calculated to gauge richness and evenness [28]. Differences in the structure of the fungal community between leaves and roots were examined using dissimilarity metrics (Bray–Curtis), followed by Principal Coordinates Analysis (PCoA) and Non-Metric Multidimensional Scaling (NMDS). PERMANOVA tests determined the statistical significance of observed patterns.
To explore fungal interactions and community structuring, a co-occurrence network analysis was performed using Spearman correlation coefficients ( r > 0.5 , p < 0.05 ). Correlation matrices were constructed using the Hmisc package. This analysis allowed us to identify potential ecological relationships among fungal taxa and to assess how interactions varied between anthropogenically pressured and non-impacted environments. Nodes in the network represented distinct fungal taxa, while edges reflected significant co-occurrence relationships. Highly connected taxa were considered potential keystone species, playing a crucial role in structuring the fungal community [29].

2.5. Ethical and Environmental Aspects

All research activities were designed to minimize impacts on local flora, fauna, and soil structure. Investigators adhered to guidelines from Ecuadorian environmental authorities, and the local community was informed about the study’s objectives, highlighting the importance of preserving natural habitats and understanding microbial diversity in the context of invasive species. Findings were shared with park managers and community leaders to inform conservation strategies for Isla Santay’s mangrove ecosystems.

3. Results

3.1. Comparative Abundance in Rhizosphere from Non-Anthropogenic Pressure (S2) and with Anthropogenic Pressure (S1)

A general inspection of the raw data revealed that both sample sets were dominated by members of Ascomycota and Basidiomycota, consistent with typical fungal surveys of angiosperm tissues. Despite overall similarities, the relative abundance of certain taxa differed markedly. In S2 (non-anthropogenic pressure), Cladosporium dominicanum comprised over 62% of all fungal hits, whereas it represented about 44% in S1 (root sample, anthropogenic pressure). Additionally, Talaromyces (11% in S2) and Ustilago alcornii (6% in S2) were less prominent in S1, where Magnaporthaceae_sp (approximately 9%) and Psathyrella luteopallida (3.5%) were more abundant (Figure 2).
Notably, alpha-diversity metrics revealed a stark contrast: S2 exhibited a Shannon diversity index of 2.429 and identified 410 species, compared with S1’s Shannon index of 1.491 and 239 species. These findings underscore higher species richness and evenness in the non-anthropogenic sample (S2).
Certain other genera displayed subtler abundance contrasts. For instance, Aureobasidium melanogenum formed about 5% of the S1 community, yet only 2% in S2, suggesting a possible preference for root tissues or greater persistence in the belowground environment. Some Basidiomycota, such as Anthracocystis species, were moderately represented in both S1 and S2 (around 3.3% when combined), indicative of a versatility that allows colonization of multiple tissue types in C. rotundus. Unclassified fungal reads remained below 0.2% in both samples, pointing to satisfactory database coverage for the most abundant species.

3.2. Shared and Unique Taxa

A closer examination of mid- and low-abundance taxa underscored additional patterns of overlap and specialization. Many of the same families—Cladosporiaceae, Trichocomaceae, and Ustilaginaceae—were common to both S1 and S2, although their proportional presence often varied by more than twofold. For example, Talaromyces dominated 11% of hits in S2 but fell below 0.2% in S1. Conversely, Magnaporthaceae reached 9% in S1 but remained at or below 1% in S2.
Despite these differences, some low-abundance groups were shared across the rhizosphere from non-anthropogenic and with anthropogenic pressure tissues, suggesting that C. rotundus supports widespread fungal distributions across its tissues. Genera like Papiliotrema, Aureobasidium, and Anthracocystis were recovered from both samples, albeit in varying proportions. Taxa exclusive to one sample may be sporadic colonizers in the other or may require microenvironments unique to either anthropogenic pressure of the rhizosphere.
The distribution of fungal taxa across sample types reveals distinct community structuring in response to environmental conditions. Cladosporium dominicanum was consistently detected in both samples, indicating a widespread occurrence that may reflect its ability to colonize multiple substrates. While functional assays were not performed, previous studies have reported that species within the Cladosporium genus frequently associate with both living and decomposing plant material, suggesting a capacity for both endophytic and saprotrophic lifestyles.
In the non-anthropogenically pressured environment (S2), Talaromyces exhibited high relative abundance. This taxon is frequently associated with opportunistic colonization of aerial plant surfaces, and its presence may be influenced by localized microclimatic factors, such as humidity and nutrient availability. In contrast, the anthropogenically pressured root sample (S1) exhibited a higher proportion of Magnaporthaceae, a fungal group often linked to soil–root interactions and nutrient cycling in plant rhizospheres.
Certain fungal groups, including Anthracocystis and Ustilago, were identified in both sample sets. These taxa, known as smut fungi, have recognized pathogenic roles in agricultural systems, yet their intermediate frequencies in this study suggest that their ecological function within C. rotundus populations may be context-dependent. Further studies could help determine whether their presence represents latent pathogenicity, endophytic behavior, or an incidental association with the sampled environments.

3.3. Community Ordination and Co-Occurrence Patterns

Community composition was further investigated through ordination and co-occurrence analyses. A Principal Coordinates Analysis (PCoA) based on Bray–Curtis dissimilarities (Figure 3) revealed distinct clustering between the anthropogenic sample (S1) and the non-anthropogenic sample (S2). The first two axes explained 48.7% (PCoA1) and 21.4% (PCoA2) of the total variance, respectively, highlighting significant differences between fungal communities in S1 and S2 tissues. These differences were statistically significant (PERMANOVA, p < 0.001 ), supporting the hypothesis of niche-specific microbial assemblages.
Non-Metric Multidimensional Scaling (NMDS) corroborated these findings (Figure 3), with a stress value of 0.12, indicating a reliable representation of community dissimilarities. The clustering patterns observed in NMDS mirrored those from PCoA, further emphasizing the compositional divergence between samples with and without anthropogenic pressure. Samples from S1 (anthropogenic) were tightly associated with taxa dominant in root tissues, while those from S2 (non-anthropogenic) were characteristic of rhizosphere non-anthropogenic pressure-associated communities.
A co-occurrence network analysis (Figure 4) revealed positive correlations ( r > 0.5 ) among fungal taxa, uncovering ecological interactions within these communities. The primary network cluster contained 18 nodes and 45 edges, with taxa such as Magnaporthaceae_sp and Psathyrella luteopallida predominantly co-occurring in roots (S1). In contrast, Cladosporium dominicanum and Ustilago alcornii were distinct to leaves (S2). These patterns suggest niche partitioning and cooperative interactions, underscoring the ecological roles of key taxa within these environments.

4. Discussion

Our findings reveal a multilayered fungal ecology within Cyperus rotundus, highlighting possible implications for sensitive coastal systems [9]. A notable result is the consistently high abundance of Cladosporium dominicanum in both rhizosphere samples, aligning with previous reports of Cladosporium species as common colonizers of various plant substrates, ranging from healthy foliage to decomposing organic matter [30,31,32]. Their dual presence in above- and belowground tissues may reflect a flexible ecological strategy that encompasses endophytism, saprotrophy, or both, depending on local conditions [30,33].
In S2, the prevalence of Talaromyces and certain Ustilaginaceae suggests an opportunistic community well suited to rapid colonization, possibly favored by the leaf surface’s microclimatic conditions [34]. Although no clear pathogenicity was observed, some genera (e.g., Ustilago, Anthracocystis) include known crop pathogens, implying that under different stressors or environmental conditions, these fungi could transition from a commensal to a pathogenic role [35].
Similar results have been observed in studies of fungal interactions in wetland environments, where species like Talaromyces and Cladosporium dominate microbial communities in response to environmental stressors [6,7]. The presence of these taxa aligns with findings in other studies on fungal community dynamics in invasive plant species [36,37], reinforcing the idea that plant-associated fungi can mediate plant adaptability to diverse conditions [38,39].
These findings may have direct implications for developing biocontrol or phyto-augmentation strategies, wherein beneficial microbes (e.g., plant growth-promoting bacteria) could be introduced to counteract invasive species, enhance native plant resilience, and restore ecological balance [40]. Recent studies on the role of endophytic fungi in plant health suggest that leveraging microbial interactions could enhance restoration strategies in wetland and mangrove ecosystems [41].
S1 samples showed comparatively higher contributions from Magnaporthaceae and other Sordariomycetes, supporting the idea that belowground habitats offer stable niches for specialized fungal communities [42,43]. In particular, the taxa Magnaporthaceae have attracted attention in agriculture, where members can influence the acquisition of nutrients or plant health. Similar processes may be at play in this wetland context, although salinity and flooding regimes could alter fungal functionality.

4.1. Broader Implications for Mangrove Environments

These findings provide insights into fungal community dynamics associated with C. rotundus in mangrove-adjacent environments [5]. The observed differentiation between fungal assemblages of rhizosphere samples from anthropogenic (S1) and non-anthropogenic (S2) pressure highlights the potential influence of plant-mediated processes on microbial communities in coastal ecosystems [41,44]. Notably, key taxa such as Cladosporium dominicanum and Talaromyces may act as vectors for microbial dispersal into mangrove ecosystems, potentially altering soil litter interactions. Continued monitoring and analysis are essential to understand the long-term effects of these interactions on native mangrove species and their associated microbial communities [45,46].

4.2. Prospects for Bioaugmentation and Future Research

The concept of harnessing C. rotundus-associated fungi for bioaugmentation strategies in mangrove or wetland restoration is intriguing [47]. Taxa within Talaromyces or Magnaporthaceae have been linked to the breakdown of complex organic compounds and the suppression of pathogenic microbes [48].
Similar approaches have been explored in wetland restoration projects, where fungal communities have been manipulated to improve plant establishment and stress tolerance [49]. Studies on bioaugmentation in mangroves suggest that introducing specific fungal consortia could promote nutrient cycling and improve plant resilience in degraded ecosystems [47,50]. These findings align with our results, reinforcing the potential for fungal-based interventions in restoration efforts.
If further studies confirm the attributes of plant growth-promoting fungi, these taxa could be used to increase the resilience of native vegetation [51]. However, thorough risk assessments are paramount to avoid unintentionally promoting the further spread of C. rotundus or destabilizing native microbial communities [47,52,53].
Future research might integrate metatranscriptomic or metabolomic techniques to elucidate functional pathways and track potential transitions from mutualistic to pathogenic interactions [10]. Longitudinal monitoring of mangrove stands near C. rotundus-invading areas could clarify whether these fungal consortia disperse into native habitats and how they affect soil chemistry, plant performance, or ecosystem resilience.
In general, our findings align with previous research on invasive plant–microbe interactions, reinforcing the idea that fungal endophytes play a crucial role in plant adaptability and ecosystem responses [7]. While this study provides a baseline understanding of fungal diversity within C. rotundus, future research should explore the functional roles of these fungi to assess their ecological impact and potential for ecosystem restoration.

5. Conclusions

Our findings underscore the remarkable complexity and adaptability of Cyperus rotundus in these coastal wetlands. By examining the fungal communities of plants, we see how a single invasive species can harbor a suite of microbes that can potentially reshape the delicate ecological balance of mangrove systems. The results point to a reality that extends well beyond an isolated scientific discovery: they reveal the intricate interconnectedness of plants, microbes, and habitats, and ultimately highlight how our actions can reverberate through this web of life.
From the perspective of local communities and conservation efforts, these results serve both as a warning and a call to action. C. rotundus may appear inconsequential at first glance: just another ’weed’. However, its associated microbial assemblages could initiate subtle changes in nutrient cycling and species interactions. Such shifts may not be immediately apparent, but over time they could affect not only plant diversity, but also the economic and cultural well-being of people who depend on a healthy mangrove ecosystem for subsistence fishing, ecotourism, and coastal protection.
What emerges is an opportunity for proactive measures. Rather than viewing C. rotundus solely as an invasive threat to be eradicated, we can leverage the hidden world of its beneficial microbes: some of which may enhance plant growth, decompose organic matter, or mitigate pathogen loads. With careful oversight, these microbes could be recruited as allies in ecological restoration, fortifying native plant communities and boosting their resilience against future invasions.
Ultimately, wetland stewardship extends beyond protecting the flora or preventing the emergence of a single invasive species. It entails recognizing our collective responsibility to preserve a vibrant tapestry of interdependent organisms, where each strand, no matter how small, helps to sustain the larger living fabric of the ecosystem. Through cohesive partnerships among researchers, local stakeholders, and policymakers, we can translate the knowledge gained here into practical, sustainable strategies that nurture both environmental and human well-being.

Author Contributions

Conceptualization, D.P., E.S.-O. and L.V.-U.; methodology, D.P., E.S.-O. and J.A.; validation, J.A., T.C., J.G. and L.M.; formal analysis, D.P., E.S.-O. and L.V.-U.; investigation, D.P.; resources, E.S.-O.; data curation, D.P. and A.A.-M.; writing—original draft preparation, D.P.; writing—review and editing, all authors; supervision, E.S.-O.; project administration, D.P. and E.S.-O. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

Amplicon sequencing data of the ITS were submitted to the Sequence Read Archive at the National Center for Biotechnology Information under BioProject ID PRJNA1217457, with SRA Accession Numbers SRX27548720 and SRX27548719, available at https://www.ncbi.nlm.nih.gov/sra/PRJNA1217457 (accessed on 10 January 2025).

Acknowledgments

We thank the local authorities and members of the community of Isla Santay for facilitating the fieldwork and offering valuable logistic support.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

ITSInternal Transcribed Spacer
PCoAPrincipal Coordinates Analysis
NMDSNon-Metric Multidimensional Scaling

References

  1. Xu, X.; Chen, M.; Yang, G.; Jiang, B.; Zhang, J. Wetland ecosystem services research: A critical review. Glob. Ecol. Conserv. 2020, 22, e01027. [Google Scholar] [CrossRef]
  2. Synes, N.W.; Ponchon, A.; Palmer, S.; Osborne, P.; Bocedi, G.; Travis, J.; Watts, K. Prioritising conservation actions for biodiversity: Lessening the impact from habitat fragmentation and climate change. Biol. Conserv. 2020, 252, 108819. [Google Scholar] [CrossRef]
  3. Rai, P.K.; Singh, J. Invasive alien plant species: Their impact on environment, ecosystem services and human health. Ecol. Indic. 2020, 111, 106020. [Google Scholar] [CrossRef]
  4. Lino, A.; Fonseca, C.; Rojas, D.; Fischer, E.; Pereira, M.R.R. A meta-analysis of the effects of habitat loss and fragmentation on genetic diversity in mammals. Mamm. Biol. 2019, 94, 69–76. [Google Scholar] [CrossRef]
  5. Bhagarathi, L.K.; DaSilva, P.N.B. Impacts and implications of anthropogenic activities on mangrove forests: A review. Magna Sci. Adv. Res. Rev. 2024, 11, 040–059. [Google Scholar] [CrossRef]
  6. Wang, Y.; Chao, B.; Dong, P.; Zhang, D.; Yu, W.; Hu, W.; Ma, Z.; Chen, G.; Liu, Z.; Chen, B. Simulating spatial change of mangrove habitat under the impact of coastal land use: Coupling MaxEnt and Dyna-CLUE models. Sci. Total Environ. 2021, 788, 147914. [Google Scholar] [CrossRef]
  7. Wang, B.; Zheng, X.; Zhang, H.; Yu, X.; Lian, Y.; Yang, X.; Yu, H.; Hu, R.; He, Z.; Xiao, F.; et al. Metagenomic insights into the effects of submerged plants on functional potential of microbial communities in wetland sediments. Mar. Life Sci. Technol. 2021, 3, 405–415. [Google Scholar] [CrossRef]
  8. Ying, L.; Wang, Y.; Wu, W.; Zhi, D.; Ma, M.; Ping, H.; Wu, S.; Lou, Y. Plant–plant interactions vary greatly along a flooding gradient in a dam-induced riparian habitat. Front. Plant Sci. 2023, 14, 1290776. [Google Scholar] [CrossRef]
  9. Utami, N.; Susianti, S.; Bakri, S.; Kurniawan, B.; Setiawansyah, A. Cytotoxic activity of Cyperus rotundus L. rhizome collected from three ecological zones in Lampung-Indonesia against HeLa cervical cancer cell. J. Appl. Pharm. Sci. 2023, 13, 141–148. [Google Scholar] [CrossRef]
  10. Liu, Y.X.; Qin, Y.; Chen, T.; Lu, M.; Qian, X.; Guo, X.; Bai, Y. A practical guide to amplicon and metagenomic analysis of microbiome data. Protein Cell 2021, 12, 315–330. [Google Scholar] [CrossRef]
  11. Taş, N.; de Jong, A.D.; Li, Y.; Trubl, G.; Xue, Y.; Dove, N.C. Metagenomic tools in microbial ecology research. Curr. Opin. Biotechnol. 2021, 67, 184–191. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, R.; Wang, S.; Zhong, H.; Fu, X.; Li, L.; Wang, L.; Liu, Y. Microbial C and N Metabolism Alterations Based on Soil Metagenome and Different Shrub Invasion Stages in Sanjiang Plain Wetlands. Microorganisms 2024, 12, 1648. [Google Scholar] [CrossRef] [PubMed]
  13. Gao, P.; Song, B.; Xu, R.; Sun, X.; Lin, H.; Xu, F.; Li, B.; Sun, W. Structure and variation of root-associated bacterial communities of Cyperus rotundus L. in the contaminated soils around Pb/Zn mine sites. Environ. Sci. Pollut. Res. 2021, 28, 58523–58535. [Google Scholar] [CrossRef] [PubMed]
  14. Scholier, T.; Lavrinienko, A.; Brila, I.; Tukalenko, E.; Hindström, R.; Vasylenko, A.; Cayol, C.; Ecke, F.; Singh, N.J.; Forsman, J.T.; et al. Urban forest soils harbour distinct and more diverse communities of bacteria and fungi compared to less disturbed forest soils. Mol. Ecol. 2022, 32, 504–517. [Google Scholar] [CrossRef]
  15. Villegas, L.; Cabrera, M.; Capparelli, M. Assessment of Microplastic and Organophosphate Pesticides Contamination in Fiddler Crabs from a Ramsar Site in the Estuary of Guayas River, Ecuador. Bull. Environ. Contam. Toxicol. 2021, 107, 20–28. [Google Scholar] [CrossRef]
  16. Curtis, A.; Larson, E.; Davis, M.A. Field storage of water samples affects measured environmental DNA concentration and detection. Limnology 2020, 22, 1–4. [Google Scholar] [CrossRef]
  17. García, S.M.; Chun, C.L.; Dumke, J.; Hansen, G.J.A.; Quebedeaux, K.B.; Rounds, C.I.; Totsch, A.; Larson, E.R. Environmental DNA storage and extraction method affects detectability for multiple aquatic invasive species. Environ. DNA 2024, 6, e557. [Google Scholar] [CrossRef]
  18. Carey, S.; Becklund, L.; Fabre, P.P.; Schenk, J.J. Optimizing the lysis step in CTAB DNA extractions of silica-dried and herbarium leaf tissues. Appl. Plant Sci. 2023, 11, e11522. [Google Scholar] [CrossRef]
  19. Pacheco-Coello, R.; Justo, J.P.; Mendoza, A.F.; Santos-Ordóñez, E. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food. BMC Res. Notes 2017, 10, 758. [Google Scholar] [CrossRef]
  20. Garcés-Fiallos, F.R.; Alberto Saltos, L.; Corozo-Quiñonez, L.; Pacheco-Coello, R.; Santos-Ordóñez, E.; Urresta, L.F.; Garzón, B.A.; Monteros-Altamirano, Á.; Portalanza, D.; Raju, M.N. Capsicum hypocotyls mycobiome diversity is unaffected by Phytophthora capsici inoculation. Physiol. Mol. Plant Pathol. 2022, 118, 101801. [Google Scholar] [CrossRef]
  21. Dieki, R.; Emvo, E.N.; Akue, J. Comparison of six methods for Loa loa genomic DNA extraction. PLoS ONE 2022, 17, e0265582. [Google Scholar] [CrossRef] [PubMed]
  22. Li, S.; Deng, Y.; Wang, Z.; Zhang, Z.; Kong, X.; Zhou, W.; Yi, Y.; Qu, Y. Exploring the accuracy of amplicon-based internal transcribed spacer markers for a fungal community. Mol. Ecol. Resour. 2020, 20, 170–184. [Google Scholar] [CrossRef] [PubMed]
  23. Mbareche, H.; Veillette, M.; Bilodeau, G. In Silico Study Suggesting the Bias of Primers Choice in the Molecular Identification of Fungal Aerosols. J. Fungi 2021, 7, 99. [Google Scholar] [CrossRef] [PubMed]
  24. Abarenkov, K.; Nilsson, R.; Larsson, K.H.; Taylor, A.F.; May, T.W.; Frøslev, T.; Pawłowska, J.; Lindahl, B.D.; Põldmaa, K.; Truong, C.; et al. The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: Sequences, taxa and classifications reconsidered. Nucleic Acids Res. 2023, 52, D791–D797. [Google Scholar] [CrossRef]
  25. Schoch, C.; Ciufo, S.; Domrachev, M.; Hotton, C.; Kannan, S.; Khovanskaya, R.; Leipe, D.D.; McVeigh, R.; O’Neill, K.; Robbertse, B.; et al. NCBI Taxonomy: A comprehensive update on curation, resources and tools. Database J. Biol. Databases Curation 2020, 2020, baaa062. [Google Scholar] [CrossRef]
  26. Dixon, P.M. VEGAN, a package of R functions for community ecology. J. Veg. Sci. 2003, 14, 927–930. [Google Scholar] [CrossRef]
  27. Kassambara, A.; Mundt, F. factoextra: Extract and Visualize the Results of Multivariate Data Analyses, R Package Version 1.0.7; CRAN: Vienna, Austria, 2017. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 10 January 2025).
  28. Yan, H.; Li, F.; Liu, G. Diminishing influence of negative relationship between species richness and evenness on the modeling of grassland α-diversity metrics. Front. Ecol. Evol. 2023, 11, 1108739. [Google Scholar] [CrossRef]
  29. Wang, S.; Yuan, B.; Cai, T.T.; Li, H. Phylogenetic association analysis with conditional rank correlation. Biometrika 2023, 111 3, 881–902. [Google Scholar] [CrossRef]
  30. Freitas, M.L.R.; Gomes, A.A.M.; Rosado, A.; Pereira, O.L. Cladosporium species from submerged decayed leaves in Brazil, including a new species and new records. Phytotaxa 2021, 482, 223–239. [Google Scholar] [CrossRef]
  31. Iturrieta-González, I.; García, D.; Gené, J. Novel species of Cladosporium from environmental sources in Spain. MycoKeys 2021, 77, 1–25. [Google Scholar] [CrossRef]
  32. Farwell, L.H.; Deakin, G.; Harris, A.L.; Fagg, G.; Passey, T.; Verheecke-vaessen, C.; Magan, N.; Xu, X. Cladosporium Species: The Predominant Species Present on Raspberries from the U.K. and Spain and their Ability to Cause Skin and Stigmata Infections. Horticulturae 2023, 9, 128. [Google Scholar] [CrossRef]
  33. Nicoletti, R.; Russo, E.; Becchimanzi, A. Cladosporium—Insect Relationships. J. Fungi 2024, 10, 78. [Google Scholar] [CrossRef] [PubMed]
  34. Ren, X.T.; Li, S.; Ruan, Y.; Wang, L. Three new species of Talaromyces sect. Talaromyces discovered in China. PeerJ 2024, 12, e18253. [Google Scholar] [CrossRef] [PubMed]
  35. Ruiz-Herrera, J.; Pérez-Rodríguez, F.; Velez-Haro, J. The signaling mechanisms involved in the dimorphic phenomenon of the Basidiomycota fungus Ustilago maydis. Int. Microbiol. 2020, 23, 121–126. [Google Scholar] [CrossRef]
  36. Wang, M.; Tang, X.; Sun, X.; Jia, B.; Xu, H.; Jiang, S.; Siemann, E.; Lu, X. An invasive plant rapidly increased the similarity of soil fungal pathogen communities. Ann. Bot. 2020, 127, 327–336. [Google Scholar] [CrossRef]
  37. Řezáčová, V.; Řezáč, M.; Gryndler, M.; Hršelová, H.; Gryndlerová, H.; Michalová, T. Plant invasion alters community structure and decreases diversity of arbuscular mycorrhizal fungal communities. Appl. Soil Ecol. 2021, 167, 104039. [Google Scholar] [CrossRef]
  38. Rúa, M.; Rúa, M.; Antoninka, A.; Antunes, P.; Chaudhary, V.; Gehring, C.; Lamit, L.J.; Piculell, B.J.; Bever, J.; Zabinski, C.; et al. Home-field advantage? evidence of local adaptation among plants, soil, and arbuscular mycorrhizal fungi through meta-analysis. BMC Evol. Biol. 2016, 16, 122. [Google Scholar] [CrossRef]
  39. Diagne, N.; Ngom, M.; Djighaly, P.I.; Fall, D.; Hocher, V.; Svistoonoff, S. Roles of Arbuscular Mycorrhizal Fungi on Plant Growth and Performance: Importance in Biotic and Abiotic Stressed Regulation. Diversity 2020, 12, 370. [Google Scholar] [CrossRef]
  40. Rahman, S.F.S.A.; Singh, E.; Pieterse, C.; Schenk, P. Emerging microbial biocontrol strategies for plant pathogens. Plant Sci. Int. J. Exp. Plant Biol. 2018, 267, 102–111. [Google Scholar] [CrossRef]
  41. Lee, N.L.Y.; Huang, D.; Quek, Z.B.R.; Lee, J.N.; Wainwright, B.J. Distinct fungal communities associated with different organs of the mangrove Sonneratia alba in the Malay Peninsula. IMA Fungus 2020, 11, 17. [Google Scholar] [CrossRef]
  42. David, A.S.; Hernandez, D.J.; Menges, E.; Sclater, V.; Afkhami, M.E.; Searcy, C.A. Heterogeneous landscape promotes distinct microbial communities in an imperiled scrub ecosystem. Mycologia 2023, 115, 739–748. [Google Scholar] [CrossRef] [PubMed]
  43. Hofmann, B.; Dreyling, L.; Grande, F.D.; Otte, J.; Schmitt, I. Habitat and tree species identity shape aboveground and belowground fungal communities in central European forests. Front. Microbiol. 2023, 14, 1067906. [Google Scholar] [CrossRef]
  44. Ezeokoli, O.; Mashigo, S.; Maboeta, M.; Bezuidenhout, C.; Khasa, D.; Adeleke, R. Arbuscular mycorrhizal fungal community differentiation along a post-coal mining reclamation chronosequence in South Africa: A potential indicator of ecosystem recovery. Appl. Soil Ecol. 2020, 147, 103429. [Google Scholar] [CrossRef]
  45. Zhang, Z.; Pan, Y.; Liu, Y.; Li, M. High-Level Diversity of Basal Fungal Lineages and the Control of Fungal Community Assembly by Stochastic Processes in Mangrove Sediments. Appl. Environ. Microbiol. 2021, 87, e00928-21. [Google Scholar] [CrossRef] [PubMed]
  46. Lee, N.L.Y.; Huang, D.; Quek, Z.B.R.; Lee, J.N.; Wainwright, B.J. Mangrove-Associated Fungal Communities Are Differentiated by Geographic Location and Host Structure. Front. Microbiol. 2019, 10, 2456. [Google Scholar] [CrossRef]
  47. Tondera, K.; Chazarenc, F.; Chagnon, P.; Brisson, J. Bioaugmentation of treatment wetlands - A review. Sci. Total Environ. 2021, 775, 145820. [Google Scholar] [CrossRef]
  48. Andargie, Y.E.; Lee, G.; Jeong, M.N.; Tagele, S.; Shin, J.H. Deciphering key factors in pathogen-suppressive microbiome assembly in the rhizosphere. Front. Plant Sci. 2023, 14, 1301698. [Google Scholar] [CrossRef]
  49. Xia, G.; Zhu, S.; Zhao, W.; Yang, X.; Sheng, L.; Mao, H. Arbuscular mycorrhizal fungi alter rhizosphere fungal community characteristics of Acorus calamus to improve Cr resistance. PeerJ 2023, 11, e15681. [Google Scholar] [CrossRef]
  50. Booth, J.; Fusi, M.; Marasco, R.; Daffonchio, D. The microbial landscape in bioturbated mangrove sediment: A resource for promoting nature-based solutions for mangroves. Microb. Biotechnol. 2023, 16, 1584–1602. [Google Scholar] [CrossRef]
  51. de Boer, W.; Li, X.; Meisner, A.; Garbeva, P. Pathogen suppression by microbial volatile organic compounds in soils. FEMS Microbiol. Ecol. 2019, 95, fiz105. [Google Scholar] [CrossRef]
  52. Jia, S.L.; Chi, Z.; Liu, G.; Hu, Z.; Chi, Z. Fungi in mangrove ecosystems and their potential applications. Crit. Rev. Biotechnol. 2020, 40, 852–864. [Google Scholar] [CrossRef] [PubMed]
  53. Zhao, X.; Bai, S.; Li, C.; Yang, J.; Ma, F. Bioaugmentation of atrazine removal in constructed wetland: Performance, microbial dynamics, and environmental impacts. Bioresour. Technol. 2019, 289, 121618. [Google Scholar] [CrossRef]
Figure 1. Study area.
Figure 1. Study area.
Ijpb 16 00023 g001
Figure 2. Relative abundance of the top 20 fungal species in S1 (A) and S2 (B). The bars represent the proportion of reads assigned to each species, highlighting the predominant taxa in each microbial community.
Figure 2. Relative abundance of the top 20 fungal species in S1 (A) and S2 (B). The bars represent the proportion of reads assigned to each species, highlighting the predominant taxa in each microbial community.
Ijpb 16 00023 g002
Figure 3. Ordination analyses of fungal communities. (Left): Principal Coordinates Analysis (PCoA) showing clustering of samples based on Bray−Curtis dissimilarities. (Right): Non−Metric Multidimensional Scaling (NMDS) with a stress value of 0.12, corroborating compositional differences between rhizosphere samples from anthropogenic (S1) and non-anthropogenic (S2) pressure.
Figure 3. Ordination analyses of fungal communities. (Left): Principal Coordinates Analysis (PCoA) showing clustering of samples based on Bray−Curtis dissimilarities. (Right): Non−Metric Multidimensional Scaling (NMDS) with a stress value of 0.12, corroborating compositional differences between rhizosphere samples from anthropogenic (S1) and non-anthropogenic (S2) pressure.
Ijpb 16 00023 g003
Figure 4. Co−occurrence network of identified fungal species ( r > 0.5 ). Node size indicates degree centrality, and edges denote significant correlations. Note the distinct clusters corresponding to rhizosphere samples from anthropogenic (001-ITS) and non-anthropogenic (002-ITS) pressure samples.
Figure 4. Co−occurrence network of identified fungal species ( r > 0.5 ). Node size indicates degree centrality, and edges denote significant correlations. Note the distinct clusters corresponding to rhizosphere samples from anthropogenic (001-ITS) and non-anthropogenic (002-ITS) pressure samples.
Ijpb 16 00023 g004
Table 1. Composition of the CTAB buffer used for DNA extraction.
Table 1. Composition of the CTAB buffer used for DNA extraction.
ReagentInitial Conc.Final Conc.Volume per 1 mL
CTAB7%1%147 μ L
NaCl5 M1.3 M260 μ L
EDTA (pH 8)0.5 M20 mM40 μ L
Tris-HCl (pH 8)1 M100 mM100 μ L
PVP (40,000)1.5%15 mg
β -Mercaptoethanol0.7%7 μ L
ddH 2 OUp to 1 mL
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Portalanza, D.; Acosta-Mejillones, A.; Alcívar, J.; Colorado, T.; Guaita, J.; Montero, L.; Villao-Uzho, L.; Santos-Ordóñez, E. Fungal Community Dynamics in Cyperus rotundus: Implications for Rhizophora mangle in a Mangrove Ecosystem. Int. J. Plant Biol. 2025, 16, 23. https://doi.org/10.3390/ijpb16010023

AMA Style

Portalanza D, Acosta-Mejillones A, Alcívar J, Colorado T, Guaita J, Montero L, Villao-Uzho L, Santos-Ordóñez E. Fungal Community Dynamics in Cyperus rotundus: Implications for Rhizophora mangle in a Mangrove Ecosystem. International Journal of Plant Biology. 2025; 16(1):23. https://doi.org/10.3390/ijpb16010023

Chicago/Turabian Style

Portalanza, Diego, Arianna Acosta-Mejillones, Johnny Alcívar, Teddy Colorado, Jeancarlo Guaita, Lesly Montero, Liliana Villao-Uzho, and Efren Santos-Ordóñez. 2025. "Fungal Community Dynamics in Cyperus rotundus: Implications for Rhizophora mangle in a Mangrove Ecosystem" International Journal of Plant Biology 16, no. 1: 23. https://doi.org/10.3390/ijpb16010023

APA Style

Portalanza, D., Acosta-Mejillones, A., Alcívar, J., Colorado, T., Guaita, J., Montero, L., Villao-Uzho, L., & Santos-Ordóñez, E. (2025). Fungal Community Dynamics in Cyperus rotundus: Implications for Rhizophora mangle in a Mangrove Ecosystem. International Journal of Plant Biology, 16(1), 23. https://doi.org/10.3390/ijpb16010023

Article Metrics

Back to TopTop