Emergence of Bluetongue Virus Serotype 3 in Portugal (2024)
Abstract
1. Introduction
2. Materials and Methods
2.1. Case Descriptions
2.2. Nucleic Acid Extraction
2.3. Molecular Investigations
Viruses | Targeted Gene | Type of Method | PCR Kit Used | Method Reference |
---|---|---|---|---|
BTV | ns3 | RT-qPCR | One-step NZYSpeedy RT-qPCR Probe kit, Nzytech, Lisbon, Portugal | [13] |
BTV-1 | vp2 | RT-qPCR | One-step NZYSpeedy RT-qPCR Probe kit, Nzytech, Lisbon, Portugal | in-house method (see Table 2) |
BTV-3 | vp2 | RT-qPCR | One-step NZYSpeedy RT-qPCR Probe kit, Nzytech, Lisbon, Portugal | [14] |
BTV-4 | vp2 | RT-qPCR | One-step NZYSpeedy RT-qPCR Probe kit, Nzytech, Lisbon, Portugal | in-house method (see Table 2) |
BTV-8 | vp2 | RT-qPCR | One-step NZYSpeedy RT-qPCR Probe kit, Nzytech, Lisbon, Portugal | [15] (see Table 2) |
EHDV | vp6 | RT-qPCR | One-step NZYSpeedy RT-qPCR Probe kit, Nzytech, Lisbon, Portugal | [16] |
CMFV | ORF75 | PCR | NZYTaq II 2x Green Master Mix, Nzytech, Lisbon, Portugal | [17] |
ORFV | ORF045 | PCR | NZYTaq II 2x Green Master Mix, Nzytech, Lisbon, Portugal | [18] |
Primer Forward (5′-3′) | Primer Reverse (5′-3′) | Probe FAM/BHQ-1 (5′-3′) | Serotype Detected |
---|---|---|---|
GAATGCATATGACATCAAGCAG | CGTCTTTCATCGTAACCCC | TGCYAYGTGGACGAGGGCATGC | BTV-1 |
GGTTAGAATGCCTGGACATG | GAGGCCACGGTCCGTGTC | TTCGGAAACGACGAACTGATGACG | BTV-4 |
2.4. Sanger Sequencing Analysis in the EURL
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Falconi, C.; Lopez-Olvera, J.R.; Gortazar, C. BTV infection in wild ruminants, with emphasis on red deer: A review. Vet. Microbiol. 2011, 151, 209–219. [Google Scholar] [CrossRef] [PubMed]
- MacLachlan, N.J. The pathogenesis and immunology of bluetongue virus infection of ruminants. Comp. Immunol. Microbiol. Infect. Dis. 1994, 17, 197–206. [Google Scholar] [CrossRef] [PubMed]
- Alexander, K.A.; MacLachlan, N.J.; Kat, P.W.; House, C.; O’Brien, S.J.; Lerche, N.W.; Sawyer, M.; Frank, L.G.; Holekamp, K.; Smale, L.; et al. Evidence of natural bluetongue virus infection among African carnivores. Am. J. Trop. Med. Hyg. 1994, 51, 568–576. [Google Scholar] [CrossRef] [PubMed]
- Dubovi, E.J.; Hawkins, M.; Griffin, R.A., Jr.; Johnson, D.J.; Ostlund, E.N. Isolation of Bluetongue virus from canine abortions. J. Vet. Diagn. Investig. 2013, 25, 490–492. [Google Scholar] [CrossRef] [PubMed]
- Jauniaux, T.P.; De Clercq, K.E.; Cassart, D.E.; Kennedy, S.; Vandenbussche, F.E.; Vandemeulebroucke, E.L.; Vanbinst, T.M.; Verheyden, B.I.; Goris, N.E.; Coignoul, F.L. Bluetongue in Eurasian lynx. Emerg. Infect. Dis. 2008, 14, 1496–1498. [Google Scholar] [CrossRef] [PubMed]
- Ander, M.; Meiswinkel, R.; Chirico, J. Seasonal dynamics of biting midges (Diptera: Ceratopogonidae: Culicoides), the potential vectors of bluetongue virus, in Sweden. Vet. Parasitol. 2012, 184, 59–67. [Google Scholar] [CrossRef] [PubMed]
- Maheshwari, G. Current status of bluetongue disease, its vector and pathogenesis in India. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2012, 82, 463–475. [Google Scholar] [CrossRef]
- Mellor, P.S. Replication of arboviruses in insect vectors. J. Comp. Pathol. 2000, 123, 231–247. [Google Scholar] [CrossRef] [PubMed]
- Maclachlan, N.J. Bluetongue: History, global epidemiology, and pathogenesis. Prev. Vet. Med. 2011, 102, 107–111. [Google Scholar] [CrossRef] [PubMed]
- Holwerda, M. Bluetongue Found in Dutch Dog. Available online: https://www.wur.nl/en/research-results/research-institutes/bioveterinary-research/show-bvr/bluetongue-found-in-dutch-dog.htm (accessed on 1 October 2024).
- Barros, S.C.; Ramos, F.; Luís, T.M.; Vaz, A.; Duarte, M.; Henriques, M.; Cruz, B.; Fevereiro, M. Molecular epidemiology of bluetongue virus in Portugal during 2004–2006 outbreak. Vet. Microbiol. 2007, 124, 25–34. [Google Scholar] [CrossRef] [PubMed]
- Abade Dos Santos, F.A.; Carvalho, C.L.; Peleteiro, M.C.; Parra, F.; Duarte, M.D. A Versatile qPCR for Diagnosis of Leporid Gammaherpesvirus 5 Using Evagreen(®) or Taqman(®) Technologies. Viruses 2021, 13, 715. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, M.; Griot, C.; Chaignat, V.; Perler, L.; Thür, B. Bluetongue disease reaches Switzerland. Schweiz. Arch. Tierheilkd. 2008, 150, 49–56. [Google Scholar] [CrossRef] [PubMed]
- Lorusso, A.; Sghaier, S.; Di Domenico, M.; Barbria, M.E.; Zaccaria, G.; Megdich, A.; Portanti, O.; Seliman, I.B.; Spedicato, M.; Pizzurro, F. Analysis of bluetongue serotype 3 spread in Tunisia and discovery of a novel strain related to the bluetongue virus isolated from a commercial sheep pox vaccine. Infect. Genet. Evol. 2018, 59, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Ries, C.; Beer, M.; Hoffmann, B. BlueTYPE—A low density TaqMan-RT-qPCR array for the identification of all 24 classical Bluetongue virus serotypes. J. Virol. Methods 2020, 282, 113881. [Google Scholar] [CrossRef] [PubMed]
- Maan, N.; Maan, S.; Potgieter, A.; Wright, I.; Belaganahalli, M.; Mertens, P. Development of real-time RT-PCR assays for detection and typing of epizootic haemorrhagic disease virus. Transbound. Emerg. Dis. 2017, 64, 1120–1132. [Google Scholar] [CrossRef] [PubMed]
- Baxter, S.I.; Pow, I.; Bridgen, A.; Reid, H.W. PCR detection of the sheep-associated agent of malignant catarrhal fever. Arch. Virol. 1993, 132, 145–159. [Google Scholar] [CrossRef] [PubMed]
- Kottaridi, C.; Nomikou, K.; Lelli, R.; Markoulatos, P.; Mangana, O. Laboratory diagnosis of contagious ecthyma: Comparison of different PCR protocols with virus isolation in cell culture. J. Virol. Methods 2006, 134, 119–124. [Google Scholar] [CrossRef] [PubMed]
Case | Virus Investigated | Real-Time PCR Ct Value | Conventional PCR | Result |
---|---|---|---|---|
Sheep 1 | BTV (pan RT-qPCR) | 20.7 | - | Positive |
BTV-1 | N/A | - | Negative | |
BTV-3 | 20.14 | - | Positive | |
BTV-4 | N/A | - | Negative | |
BTV-8 | N/A | - | Negative | |
EHDV | N/Ao | - | Negative | |
Sheep 2 | BTV (pan RT-qPCR) | 25.32 | - | Positive |
BTV-1 | N/A | - | Negative | |
BTV-3 | 22.59 | - | Positive | |
BTV-4 | N/A | - | Negative | |
BTV-8 | N/A | - | Negative | |
CEV | - | No amplification | Negative | |
OvHV-2 | - | 283 bp | Positive |
Top Similarity Matches in BLAST Analyses (October 2024) | |||||
---|---|---|---|---|---|
PCR Product (Viral Segment) Material ID at EURL AN | Length (bp) | nt Position in BTV-3/NET2023 (OR603993.1) | % | Strain | AN |
Product 1 (partial seg-2) BTV3/3234/PT2024/blood(1) PQ609286 | 501 | 580–1080 | 100 | BTV-3/NET2023 | OR603993.1 |
100 | BTV3-BH44-23-GER | OZ119415.1 | |||
98.41 | BTV3-ZIM/2007 | AJ585179.1 | |||
98.01 | BTV3-ZAF/2017/VR33 | MG255620.1 | |||
98.01 | BTV3-ZAF/2017/VR11 | MG255540.1 | |||
97.81 | BTV3-ZAF/2016/VR22 | MT028400.1 | |||
97.21 | BTV3-TUN/2016 | KY432370.1 | |||
97.21 | BTV3-SAR/2018 | MK348538.1 | |||
Product 2 (partial seg-2) BTV3/3234/PT2024/blood(2) PQ609287 | 630 | 1846–2475 | 100 | BTV-3/NET2023 | OR603993.1 |
100 | BTV3-BH44-23-GER | OZ119415.1 | |||
98.41 | BTV3-ZIM/2007 | AJ585179.1 | |||
97.21 | BTV3-TUN/2016 | KY432370.1 | |||
97.21 | BTV3-SAR/2018 | MK348538.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barros, S.C.; Henriques, A.M.; Ramos, F.; Luís, T.; Fagulha, T.; Magalhães, A.; Caetano, I.; Abade dos Santos, F.; Correia, F.O.; Santana, C.C.; et al. Emergence of Bluetongue Virus Serotype 3 in Portugal (2024). Viruses 2024, 16, 1845. https://doi.org/10.3390/v16121845
Barros SC, Henriques AM, Ramos F, Luís T, Fagulha T, Magalhães A, Caetano I, Abade dos Santos F, Correia FO, Santana CC, et al. Emergence of Bluetongue Virus Serotype 3 in Portugal (2024). Viruses. 2024; 16(12):1845. https://doi.org/10.3390/v16121845
Chicago/Turabian StyleBarros, Sílvia C., Ana Margarida Henriques, Fernanda Ramos, Tiago Luís, Teresa Fagulha, André Magalhães, Inês Caetano, Fábio Abade dos Santos, Filipa O. Correia, Carlos C. Santana, and et al. 2024. "Emergence of Bluetongue Virus Serotype 3 in Portugal (2024)" Viruses 16, no. 12: 1845. https://doi.org/10.3390/v16121845
APA StyleBarros, S. C., Henriques, A. M., Ramos, F., Luís, T., Fagulha, T., Magalhães, A., Caetano, I., Abade dos Santos, F., Correia, F. O., Santana, C. C., Duarte, A., Villalba, R., & Duarte, M. D. (2024). Emergence of Bluetongue Virus Serotype 3 in Portugal (2024). Viruses, 16(12), 1845. https://doi.org/10.3390/v16121845