Next Article in Journal
Cottontail Rabbit Papillomavirus (CRPV) Related Animal Models for Head and Neck Cancer Research: A Comprehensive Review of the Literature
Previous Article in Journal
Increased Susceptibility of Rousettus aegyptiacus Bats to Respiratory SARS-CoV-2 Challenge Despite Its Distinct Tropism for Gut Epithelia in Bats
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative

1
National Research Centre for Epidemiology and Microbiology Named after the Honorary Academician N.F. Gamaleya, Ministry of Health of the Russian Federation, Moscow 123098, Russia
2
A. Tsyb Medical Radiological Research Center—Branch of the National Medical Research Radiological Center of the Ministry of Health of the Russian Federation, Obninsk 249036, Russia
3
Faculty of Biotechnology, Lomonosov Moscow University of Fine Chemical Technology, Moscow 119571, Russia
*
Authors to whom correspondence should be addressed.
Viruses 2024, 16(11), 1718; https://doi.org/10.3390/v16111718
Submission received: 16 September 2024 / Revised: 25 October 2024 / Accepted: 28 October 2024 / Published: 31 October 2024
(This article belongs to the Section Viral Immunology, Vaccines, and Antivirals)

Abstract

Ongoing outbreaks and often rapid spread of infections caused by coronaviruses, influenza, Nipah, Dengue, Marburg, monkeypox, and other viruses are a concern for health authorities in most countries. Therefore, the search for and study of new antiviral compounds are in great demand today. Since almost all viruses with pandemic potential have immunotoxic properties of various origins, particular attention is paid to the search and development of immunomodulatory drugs. We have synthesised a new compound related to indole-3-carboxylic acid derivatives (hereinafter referred to as the XXV) that has antiviral and interferon-inducing activity. The purpose of this work is to study the effect of the XXV on the stimulation of the expression of toll-like receptor genes, interferons, and immunoregulatory cytokines in a macrophage-like cell model. In this study, real-time PCR methods were used to obtain data on the transcriptional activity of genes in macrophage-like cells. Stimulation of the genes of toll-like receptors TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 was detected. A high-fold increase in stimulation (from 6.5 to 16,000) of the expression of the TLR3 and TLR4 genes was detected after 4 h of exposure to the XXV. Increased activity of interferon (IFNA1, IFNA2, IFNB1, IFNK, and IFNλ1) genes with simultaneous stimulation of the expression of interferon receptor (IFNAR1 and IFNAR2) genes and signalling molecule (JAK1 and ISG15) genes was detected. Increased fold stimulation of the expression of the cytokine genes IL6, TNFA, IL12A, and IL12B was also observed. Thus, it is shown that the XXV is an activator of TLR genes of innate immunity, which trigger signalling mechanisms of pathogen “recognition” and lead to stimulation of the expression of genes of proinflammatory cytokines and interferons.

1. Introduction

Ongoing outbreaks and the frequently rapid spread of infections caused by coronaviruses (SARS-CoV-2 and MERS), influenza viruses (H1N1, H1N2, and H5N1), respiratory syncytial virus, Nipah, Dengue, Marburg viruses, echovirus (type 11), monkeypox, and other viruses [1,2] are a concern for health authorities in most countries. Therefore, the search for and study of new antiviral compounds are in great demand today. At the same time, particular attention is paid to the search for and development of immunomodulatory drugs, since almost all of the above viruses have immunotoxic properties of various origins [3].
It is known that the toll-like receptor (TLR) family is involved in the recognition of viruses and initiates innate immunity mechanisms by triggering downstream signalling pathways, inducing the synthesis of interferons (IFNs), other antiviral proteins, and inflammatory cytokines [4], which ultimately leads to the initiation of an adaptive immune response [5]. At the same time, IFNs participate in the regulation of the expression of TLR genes and IFN-stimulated genes (ISGs) [6].
Ten functional TLRs (TLR1–10) found in humans are expressed by a variety of immune and non-immune cell types, including fibroblasts, epithelial cells, macrophages, lymphocytes, granulocytes, and dendritic cells [7]. TLR1, TLR2, TLR4, TLR5, TLR6, and TLR10 are mainly found on the cell surface and are responsible for identifying microbial lipids, lipoproteins, and proteins. TLR2 cooperates with TLR1, TLR4, TLR6, and TLR10 and forms homodimers or heterodimers to recognise different ligands [8]. TLR4 recognises cell surface lipopolysaccharides (LPSs), myeloid differentiation factor 2 (MD2), and a number of pathogen components that activate the production of inflammatory cytokines [9]. TLR3, TLR7, TLR8, and TLR9 are localised inside cells (e.g., macrophages and dendritic cells) in compartments such as lysosomes, endosomes, and the intracellular reticulum and can recognise nucleic acids produced by bacteria and viruses, as well as self-nucleic acids produced during cell destruction in autoimmune diseases or cancer [10]. TLR3 activation occurs in response to the recognition of RNA from destroyed cells, viral double-stranded RNA (dsRNA), and small interfering RNA, which, through the expression of NF-kB, leads to the induction of the synthesis of IFNs and proinflammatory cytokines [11]. TLR7 recognises viral single-stranded (ss) RNA and induces the production of type I IFNs and proinflammatory cytokines [12,13]. TLR8 responds to viral and bacterial RNA and triggers the synthesis of IFNs and inflammatory cytokines [14]. TLR9 identifies bacterial and viral DNA and switches on the synthesis of IFN-α [15].
Among the studied compounds, we can highlight a group of synthesised aminoalkyl esters of 5-methoxyindole-3-carboxylic acid [16]. In 2022–2023, we isolated a compound (6-bromo-1-methyl-5-methoxy-2-(1-piperidinomethyl)-3-(2-diethylaminoethoxy)carbonylindole dihydrochloride, hereinafter referred to as the “XXV”) with antiviral activity against the SARS-CoV-2 virus from this rather extensive group [17]. Since the interferon-inducing activity of this compound was demonstrated and suppression of syncytium formation induced by the spike protein (S-glycoprotein) of SARS-CoV-2 was observed [18], studies continued to investigate its action mechanisms.
The study of the molecular mechanisms of action of promising drug candidates on the innate immune system is necessary for their effective use in medicine to prevent and treat viral, autoimmune, and cancer diseases. Previously, a group of recombinant interferon (IFN) inducers and immunomodulators was studied on a sensitive cellular model of THP-1 monocytes, which turned out to be stimulators of certain genes of toll-like receptors (TLRs) and proinflammatory cytokines [19,20,21,22].
In this study, the effect of the XXV on the stimulation of the expression of genes of TLRs, interferons, some signalling molecules, and cytokines in macrophage-like cells was investigated for the first time.
The purpose of this work is to study the effect of the XXV on the stimulation of the expression of toll-like receptor genes, interferons, and immunoregulatory cytokines in a macrophage-like cell model.

2. Materials and Methods

The THP-1 cell line [23] (acute monocytic leukaemia, ATCC Catalogue No. TIB 202) was obtained from the Federal State Budgetary Institution “N.N. Blokhin National Medical Research Center of Oncology” of the Russian Ministry of Health. Cells were cultured in RPMI 1640 medium with 10% FBS, glutamine, and antibiotics.
THP-1 macrophages (THP-PMA-MPH) were obtained using phorbol 12-myristate 13-acetate (PMA; Cat. No. S-79346-0,005, Sigma-Aldrich, Jerusalem, Israel, prepared in accordance with the manufacturer’s instructions in 98% dimethyl sulfoxide (DMSO)), 50 ng/mL, according to the InvivoGen protocol [24]. Briefly, THP-1 cell suspension was inoculated in 96-well (2 × 105 cells/well) or 6-well (3.2 × 106 cells/well) plates, and PMA was added to each well at a final concentration of 50 ng/mL, incubated for 3 h at 37 °C in 5% CO2, and then, after cell attachment, the medium was removed and RPMI 1640 with 10% FBS, glutamine, and antibiotics was added. On day 4, the cells were washed with PBS solution, and nutrient medium was added. For the experiments, 96-well plates were used to determine cytotoxicity, and 6-well plates were used for gene expression.
The XXV (6-bromo-5-methoxy-1-methyl-2-(1-piperidinomethyl)-3-(2-diethylaminoethoxy)carbonylindole dihydrochloride) was synthesised at A. Tsyb MRRC using a multi-step scheme [17,18].
The obtained compound was dissolved in RPMI-1640 culture medium and studied in cell cultures at non-toxic concentrations of 12.5 (21.6 µM) and 6.25 μg/mL (10.8 µM).
A quantitative assessment of the cytotoxicity of the preparations was performed using MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) [25,26]. The culture medium was replaced by RPMI with 2% FBS (Gibco, South America); the XXV was added at an initial concentration of 5 mg/mL (8.6 mM) aqueous solution and titrated in a ratio of 1:2 in a 96-well plate with cells. The titration of the compound was carried out in four replicates to a final dilution of 1:1024. The plate with cells was incubated at 37 °C in 5% CO2 for 48 h. After removing the supernatant, 100 μL of 0.5% MTT dye solution (Sigma-Aldrich, USA) was added to each well. Then, incubation was carried out under the same conditions for 2 h (5% CO2, 37 °C). The supernatant was carefully removed from the wells, and 100 µL of DMSO was added to dissolve the formed formazan crystals. Cell viability was assessed by the colour intensity of the solution, i.e., by measuring the optical density (OD) at a wavelength of 545 nm using an Immunochem 2100 photometer (High Technology, Inc., North Attleborough, MA, USA). The viability of THP-PMA-MPH cells in the presence of the test compound for 48 h was calculated using GraphPad Prism 6.01. The 50% cytotoxic concentration (CC50) values were calculated by generally accepted methods for biological research using the Microsoft Excel 5.0 and GraphPad Prism 6.01 software packages. The working model for CC50 analysis was a 4-parameter logistic curve equation (“Nonlinear regression”—“Sigmoidal dose–response (variable slope)” menu items).

2.1. Experimental Design

The XXV was dissolved in distilled water at 5 mg/mL (8.6 mM); 10-fold solutions were prepared in RPMI nutrient medium and added to experimental wells with prepared THP-PMA-MPH at final concentrations of 12.5 μg/mL (21.6 μM) and 6.25 μg/mL (10.8 μM). The exposure time of control (free of the XXV) and experimental samples was 4 and 24 h at 37 °C and 5% CO2. After incubation, the cells were lysed using the lysis buffer from the RNA isolation kit.

2.2. RNA Isolation

Total RNA was isolated using a HiPure Total RNA Plus Kit, Magen Cat. No. R411102 (China), according to the package leaflet of the kit.

2.3. Reverse Transcription (Rt) Reaction

The Rt reaction was carried out with the universal primer random 6 on the matrices of total cellular RNA according to the package leaflets of the Reverse Transcription (Rt) Reagent Kit, Cat. No. OT-01, Syntol (Russia). The obtained cDNAs were stored at –70 °C.

2.4. Real-Time PCR

The reaction was carried out on a CFX Opus 96 amplifier with a ready-made 2-fold mixture of SSoAdvanced Universal SYBR Green Supermix Cat. No. 1725271 (Bio-Rad, USA) in 0.2 mL microtubes with optically permeable caps (SSIbio, USA). A total of 2 µL of specific (forward and reverse) primer pairs was mixed in a PCR box with 3 µL of cDNA (diluted 2–100 times) and 5 µL of 2x SSoAdvanced Universal SYBR Green Supermix. Each sample was tested in duplicate. PCR programme: 50 °C for 2 min (1 cycle), 95 °C for 10 min (1 cycle), 95 °C for 15 s (1 cycle), then 45 cycles at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. Melting programme at the end point of 65–95 °C, step 0.5° C for 10 s. The fluorescence levels of the SYBR Green dye intercalating into DNA were shown on the computer screen (in real time) in the form of DNA amplicon accumulation curves. The quantity was estimated from the threshold cycles (Cq) at the beginning of the logarithmic phase of synthesis. The negative control (cDNA-free sample) did not yield specific PCR products.
Oligonucleotide PCR primers. The structures of oligonucleotide primers used in this study were taken from PrimerBank and the published literature. Their structures are shown in Table 1. The oligonucleotides were synthesised by Evrogen (Moscow, Russia).

2.5. Gene Expression Level Calculations

The amplification data were processed automatically using CFX Maestro 2.3 (Bio-rad, Hercules, CA, USA). Standard deviations (±SDs) of Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The 18S ribosomal RNA gene was used as a stable reference normaliser of gene expression. Specificity of DNA products was determined by T melting. Changes in gene activity (2deltaCq) in experimental cell samples were determined relative to control ones, which were taken to be equal to 1.

3. Results

3.1. Determination of Cytotoxicity of the XXV Compound

Based on the data obtained in the study of the cytotoxic effect of the XXV on THP-PMA-MPH cells using the vital MTT dye, an analytical curve was constructed from which the CC50 value was determined. The concentration that reduced the optical density by 50% compared to the control was 256.94 μg/mL (445.3 μM) (Figure 1).
Further, all studies were performed at XXV concentrations of 6.25 and 12.5 μg/mL, which did not have a cytotoxic effect on the THP-PMA-MPH cells.

3.2. Effect of the XXV on TLR Gene Expression

Human cell TLRs are expressed at the plasma membrane (e.g., TLR1, TLR5, TLR6, and TLR10), in intracellular endosomes (e.g., TLR3 and TLR7–9), or in both compartments (e.g., TLR2 and TLR4) [5,8], and their localisation critically regulates TLR signalling [8]. This study is focused on TLRs, where the expression of genes is associated with the activation of antiviral immunity and the induction of IFNs and inflammatory cytokines. In a preliminary series of experiments, we analysed the expression level of the RIG-1 and MDA5 genes at XXV concentrations of 25 μg/mL, 12.5 μg/mL, 6.25 μg/mL, 3.15 μg/mL, and 1.56 μg/mL. The maximum expression level was observed at concentrations of 12.5 μg/mL and 6.25 μg/mL. This was the reason why the XXV was tested at the above concentrations of 12.5 μg/mL and 6.25 μg/mL.
The effect of the XXV compound on the expression levels of innate immune TLR genes in THP-PMA-MPH is presented in Table 2.
In differentiated THP-PMA-MPH, the XXV at concentrations of 6.25 and 12.5 μg/mL activated a number of TLR genes associated with the functioning of the IFN system, cytokines, and innate immunity. For example, stimulation of the TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 genes was detected. At the same time, attention is drawn to the fold increase in stimulation of the TLR3 gene (increase in stimulation of more than 16,000 times) and the TLR4 gene (increase in stimulation of more than 400 times) detected at 4 h of exposure to the XXV. We believe that we observe cooperation of the inclusion of gene expression of endosomal TLRs with, apparently, the leading role of TLR3. This study shows that intense stimulation of TLR genes occurs mainly at early stages of exposure (4 h) to the XXV (Figure 2), and after 24 h of treatment, we no longer observe stimulation of the expression of most TLR genes. It should be noted that the level of stimulation of TLR gene expression also depended on the concentration of the XXV and was more pronounced at a concentration of 6.25 μg/mL.

3.3. Effect of the XXV Compound on the Interferon Gene Expression

Stimulation of the expression of a number of type I IFN genes, namely IFNA1, IFNA2, IFNB1, IFNK, and IFNW1, by 2–12 times was observed (Table 3). In addition, stimulation of the expression of type III IFN genes was detected. The fold increase in the stimulation of the IFNλ1 and IFNλ3 genes was more than two times (Table 3). Here, the fold increase in the stimulation of the gene expression was less expressed compared to the stimulation of the TLR genes and was observed at different periods of exposure to the XXV. We do not consider the 1.87-fold stimulation of the IFNG gene detected 4 h after treating the cells with the XXV to be reliable, especially since cells of macrophage origin usually do not produce IFN-γ.

3.4. Effect of the XXV on the Expression of Immunoregulatory Cytokine Genes

When treating THP-PMA-MPH cells with the XXV, stimulation of the expression of genes of TNFA (increase in stimulation of more than 4 times) and IL6 proinflammatory cytokines (increase in stimulation of more than 200 times) was detected. We noted stimulation (3-300-fold, depending on the exposure time and concentration of the XXV) of the expression of IL12IL12A and IL12B immunoregulatory cytokine genes (Table 4).

3.5. Effect of the XXV on the Expression of Interferon Receptor Genes and Signalling Molecules Involved in Immune Signal Transmission

When treating THP-PMA-MPH cells with the XXV, stimulation of the expression of interferon alpha receptor (IFNAR1 and IFNAR2) genes was detected after 4 h of exposure at both concentrations tested. Stimulation (more than 10-fold) of the expression of the JAK1 gene, which plays a critical role in initiating responses for several major cytokine receptor families, was also detected. After 4 h, but not after 24 h, of exposure to the XXV, stimulation (maximum 14.39-fold at an XXV concentration of 6.25 μg/mL) of the ISG15 gene expression was detected. ISG-15 is induced by type I IFNs and has multiple functions. The exact functions are diverse and vary across species, but include potentiation of interferon gamma (type II IFN) production in lymphocytes, ubiquitin-like conjugation of newly synthesised proteins, and negative regulation of the type I IFN response. It exhibits antiviral activity against both DNA and RNA viruses, including influenza A, HIV-1, and Ebola viruses [28,29].
In addition, we studied the expression of the IRAK-3 (interleukin-1 receptor-associated kinase 3) gene, which encodes a member of the interleukin-1 receptor-associated protein kinase family. Members of this family are important components of the Toll/IL-R immune signalling pathways. This protein is mainly expressed in monocytes and macrophages and functions as a negative regulator of toll-like receptor signalling [30]. A high-fold increase in stimulation of this gene (by 47 times) was detected (Table 5).

4. Discussion

The studied TLR genes encode receptors that recognise structural components of RNA- and DNA-containing viruses, many of which cause dangerous diseases. The susceptibility, nature of development, and outcome of an infectious process largely depend on the expression levels of innate immunity receptors [4]. At the same time, the processes of induction of TLR and IFN genes, and then the action of IFNs, are interconnected, since the expression levels of TLR genes are regulated by synthesised IFNs [6]. The study of the mechanisms of induction of type I IFN is usually carried out using viruses (Sendai virus, Newcastle disease virus, Semliki Forest virus, etc.) and various IFN inducers (Poly (I:C), Poly (AÛ), dsRNA, etc.), while mitogens (PHA, conA, LPS, and PWM) necessary for the study of IFN-γ are not used. In our study on non-polarised macrophages, we investigated the effect of the XXV at non-toxic concentrations, at which immunomodulatory activity expressed by the stimulation of expression of innate immunity genes (TLR and IFN genes and proinflammatory cytokines) was observed.
After differentiation of PMA, we obtained non-polarised (non-activated) macrophages that were used to study the effect of the XXV on the level of gene expression. Apparently, this may be the reason for a wide range of values of gene expression stimulation levels. The obtained results seem to indicate that the polarisation of macrophages followed the M1 pathway—this fact is supported by the stimulation of the TNFa, IL6, and IL12 genes. In our opinion, when continuing this work, in order to differentiate THP-1 cells, it is more optimal to use low doses of PMA (10–20 ng/mL), as suggested by a number of authors [31,32]. The MPHs formed under these conditions are immature or weakly activated and can be used for polarisation in M1 and M2 phenotypes. Then, apparently, high phagocytic activity and expression of surface markers of cellular differentiation of CD14, CD35, TLR2, and CD11b/CD18 could show us the differentiation level of THP-MPH. In addition, as a continuation of this work, experiments should be carried out using THP-PMA-MPH virus-infected cells, since it is unknown how the XXV will behave in the presence of viruses and the IFN antagonists they induce. At the same time, it will be possible to study the expression of other ISGs (e.g., IFIT1, MX1, and OAS1) and genes encoding signalling molecules responsible for conducting the XXV-induced intracellular signal.
In a preliminary series of experiments (see above), we analysed the expression level of the RIG-1 and MDA5 genes in THP-PMA-MPH cells at different XXV concentrations. The maximum expression level (2.75- and 1.84-fold stimulation of expression for RIG1 and 3.94- and 3.18-fold stimulation of expression for MDA 5) was observed 4 h after treatment with the XXV at concentrations of 12.5 μg/mL and 6.25 μg/mL, respectively (unpublished results). These results showed that the XXV induces the expression of not only TLR genes but also other receptor genes involved in the antiviral response.
The tables present data on the stimulation of expression of a group of innate immunity genes by the XXV in PMA-stimulated human THP-1 monocytes, obtained as PCR threshold cycle (Cq) values presented as a fold increase in gene stimulation levels. The XXV stimulated the expression of not only TLR genes but also IFNA, IFNB, IFNK, and IFNλ genes, as well as IFN receptor genes (IFNAR1 and IFNAR2), apparently leading to the activation of downstream IFN signalling pathways through JAK-1 and activating IFN-dependent genes, such as IFN-stimulated gene 15 (ISG15). The development of an antiviral state in cells is associated with the expression of IFN genes. It should be noted that in this study we detected stimulation of the expression of the IRAK3 gene, which negatively correlated with the expression of inflammatory cytokines (IL-6 and TNF-α) [33]. This may suggest that the XXV may not only trigger the expression of innate immune genes but also activate immunoregulatory genes that control an excessive immune response. Since it is known that the TLR signalling pathway is tightly controlled and multiple negative regulators of TLR signalling are present at different levels to maintain immune homeostasis, it is necessary to further study the effect of this compound on TLR signalling pathway inhibitors (IRAK-M, SOCS-1, etc.) [5].
It should be noted that the level of stimulation of TLR gene expression also depended on the concentration of the XXV and was more pronounced at a concentration of 6.25 μg/mL. We observed this effect not only for TLR genes but also for other genes (IL6, IL12A, IFNAR1, IFNAR2, JAK1, ISG15, and IRAK3). It might be that a lower concentration of the compound is optimal and higher concentrations are inhibiting, but this suggestion needs additional study.
Previously, constitutive expression of genes of six TLR types was determined in THP-1 monocytes using quantitative real-time PCR: in TLR2 and TLR4 (present on the cell surface) and in TLR3, TLR7, TLR8, and TLR9 (localised in the endosomes). The authors found that the transcription levels of the studied TLR genes in THP-1 monocytes differed significantly. The most transcriptionally active genes in THP-1 monocytes were TLR4 and TLR8 (Cq22–26), and the least active genes were TLR2, TLR3, TLR7, and TLR9 (Cq30–40) [19,20,21,22].
The authors showed that THP-1 monocytes exposed to the Cytokine-Stimul-Best reagent differentiate into macrophage-like cells, causing a predominant increase in the transcriptional activity of the TLR3 and Stat1b genes, which are involved in the induction and action of IFNs [34].
In addition, it is known that the interaction of TLR adapters and kinases (IRAK 1–4) leads to the activation of NF-kB and MAP kinases, the main regulators of cytokine and interferon transcription [35,36]. The IRAK3 gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are important components of the Toll/IL-R immune signalling pathways. This protein is predominantly expressed in monocytes and macrophages and acts as a negative toll-like receptor signalling regulator. Therefore, the detection of stimulation of IRAK3 gene expression confirms the involvement of the XXV in the stimulation of TLR gene expression with subsequent activation of negative toll-like receptor signalling regulation. The detection of increased activity of IFN (IFNA1, IFNB1, IFNK, and IFNλ1) genes with simultaneous stimulation of genes of IFN (IFNAR1 and IFNAR2) receptors and some genes of signalling molecules that determine its action (JAK1 and ISG15), as well as a fold increase in the stimulation of the TNFA, IL6, IL-12A, and IL-12B cytokine genes, apparently, may indicate the ability of the XXV to stimulate expression of innate immunity genes in macrophage cells, which are necessary for triggering processes that lead to the successful elimination of foreign genetic information and counteraction to pathogenic microorganisms.
Thus, macrophage-like cells responded to treatment with the XXV by increasing the expression of the TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 genes. This is consistent with the pronounced inflammatory response of activated macrophages. The TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 receptors have different specific ligands, cellular localisation, associated adaptor proteins, and signalling pathways. The XXV, being essentially an IFN inducer, stimulated IFN-alpha, IFN-beta, and IFN-dependent genes, which ultimately led to the development of an antiviral state in the cells.
It should be noted that in this study we did not aim to show whether the XXV is an agonist of certain types of TLRs. Such conclusions require separate special studies.
The list of known TLR agonists continues to expand with new natural and synthetic compounds [37]. The prospect of using TLR agonists in combination with immune checkpoint inhibitors and antitumour vaccines provides new opportunities for the treatment of malignant tumours [38]. Moreover, compounds differing from canonical TLR agonists in chemical structure but also capable of direct interaction with TLRs have already been discovered among a large group of immunomodulators [39].
The XXV is an activator of TLR genes of innate immunity, which trigger signalling mechanisms of pathogen “recognition” and lead to the synthesis of proinflammatory cytokines and IFNs. The ability to activate the expression of TLR genes is an undoubted advantage of the drug. It expands the range of the drug’s use in viral and bacterial infections, and possibly in autoimmune and cancer diseases. Macrophages play a critical role in early defence responses to viral pathogens and influence dendritic cells as well as T- and B-lymphocyte functions. Stimulation of TLR gene expression in macrophages by the XXV increases their sensitivity to pathogens of various natures and, apparently, causes a stronger immune response in the body.

5. Conclusions

Stimulation of the genes of the toll-like receptors TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 was detected. A high-fold increase in stimulation (from 6.5 to 16,000) of the expression of the TLR3 and TLR4 genes was detected after 4 h of exposure to the XXV. Increased activity of IFN (IFNA1, IFNA2, IFNB1, IFNK, and IFNλ1) genes with simultaneous stimulation of the expression of IFN receptor (IFNAR1 and IFNAR2) genes and genes of signalling molecules (JAK1 and ISG15) that determine the action of IFNs was detected. The fold increase in stimulation of the cytokine genes TNFA, IL6, IL12A, and IL12B was also observed.
Thus, it has been shown that the XXV is an activator of TLR genes of innate immunity, triggering signalling mechanisms of pathogen “recognition” and leading to the synthesis of proinflammatory cytokines and IFNs. The ability to activate the expression of TLR genes is an undoubted advantage of the drug. It expands the range of the drug’s use in viral and bacterial infections. Macrophages play a critical role in early defence responses to viral pathogens and influence dendritic cells as well as T- and B-lymphocyte functions. Stimulation of TLR gene expression in macrophages by the XXV increases their sensitivity to pathogens of various natures and causes a stronger immune response in the body.

Author Contributions

Conceptualizations, A.N., F.E., A.P. and V.P.; methodology, V.P., I.S. and A.N.; software, V.P., I.F. and E.B.; validation, V.P., A.N. and A.P.; formal analysis, A.P., I.F. and V.P.; investigation, V.P., M.M., I.S., E.B., V.S. and I.V.; resources, A.N., V.P., M.F. and A.S.; data curation, A.N. and A.P.; writing—original draft preparation, A.N., V.P. and M.M.; writing—review and editing, A.N., A.P., A.S., M.F. and F.E.; visualization, V.P., I.F. and A.N.; supervision, I.Z. and A.N.; project administration, I.Z., A.N. and A.P.; funding acquisition, A.P. and A.N. All authors have read and agreed to the published version of the manuscript.

Funding

This work was conducted under the State Assignment of the Ministry of Health of the Russian Federation (Topic No. 056-00119-21-00; 2021–2023).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in this article; further enquiries can be directed to the corresponding author(s). The raw data supporting the conclusions of this article will be made available by the authors upon request.

Acknowledgments

The authors thank N.Yu. Kulikov for the excellent English translation of the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Available online: https://www.who.int/ru/emergencies/disease-outbreak-news (accessed on 28 August 2024).
  2. Available online: https://www.vedomosti.ru/society/news/2024/08/14/1055829-voz-obyavila-epidemiyu (accessed on 14 August 2024). (In Russian).
  3. Lvov, D.K. (Ed.) Handbook of Virology. Viruses and Viral Infections of Humans and Animals; Publishing House “Medical Information Agency”: Moscow, Russian, 2013; 656p, ISBN 978-5-9986-0145-3. (In Russian) [Google Scholar]
  4. Brubaker, S.W.; Bonham, K.S.; Zanoni, I.; Kagan, J.C. Innate immune pattern recognition: A cell biological perspective. Annu. Rev. Immunol. 2015, 33, 257–290. [Google Scholar] [CrossRef] [PubMed]
  5. Wang, K.; Huang, H.; Zhan, Q.; Ding, H.; Li, Y. Toll-like receptors in health and disease. MedComm 2024, 5, e549. [Google Scholar] [CrossRef] [PubMed]
  6. Khoo, J.J.; Forster, S.; Mansell, A. Toll-like receptors as interferon regulated genes and their role in disease. J. Interferon Cytokine Res. 2011, 31, 13–25. [Google Scholar] [CrossRef] [PubMed]
  7. Aluri, J.; Cooper, M.A.; Schuettpelz, L.G. Toll-Like Receptor Signaling in the Establishment and Function of the Immune System. Cells 2021, 10, 1374. [Google Scholar] [CrossRef]
  8. Fitzgerald, K.A.; Kagan, J.C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180, 1044–1066. [Google Scholar] [CrossRef]
  9. Zhang, H.; Kang, L.; Yao, H.; He, Y.; Wang, X.; Xu, W.; Song, Z.; Yin, Y.; Zhang, X. Streptococcus pneumoniae Endopeptidase O (PepO) Elicits a Strong Innate Immune Response in Mice via TLR2 and TLR4 Signaling Pathways. Front. Cell. Infect. Microbiol. 2016, 6, 23. [Google Scholar] [CrossRef]
  10. Agier, J.; Żelechowska, P.; Kozłowska, E.; Brzezińska-Błaszczyk, E. Expression of surface and intracellular Toll-like receptors by mature mast cells. Cent. Eur. J. Immunol. 2016, 41, 333–338. [Google Scholar] [CrossRef]
  11. Chen, Y.; Lin, J.; Zhao, Y.; Ma, X.; Yi, H. Toll-like receptor 3 (TLR3) regulation mechanisms and roles in antiviral innate immune responses. J. Zhejiang Univ. Sci. B 2021, 22, 609–632. [Google Scholar] [CrossRef]
  12. Zhang, Z.; Ohto, U.; Shibata, T.; Krayukhina, E.; Taoka, M.; Yamauchi, Y.; Tanji, H.; Isobe, T.; Uchiyama, S.; Miyake, K.; et al. Structural Analysis Reveals that Toll-like Receptor 7 Is a Dual Receptor for Guanosine and Single-Stranded RNA. Immunity 2016, 45, 737–748. [Google Scholar] [CrossRef]
  13. Patamawenu, A.A.; Wright, N.E.; Shofner, T.; Evans, S.; Manion, M.M.; Doria-Rose, N.; Migueles, S.A.; Mendoza, D.; Peterson, B.; Wilhelm, C.; et al. Toll-like receptor 7-adapter complex modulates interferon-α production in HIV-stimulated plasmacytoid dendritic cells. PLoS ONE 2019, 14, e0225806. [Google Scholar] [CrossRef]
  14. Greulich, W.; Wagner, M.; Gaidt, M.M.; Stafford, C.; Cheng, Y.; Linder, A.; Carell, T.; Hornung, V.; Greulich, W.; Wagner, M.; et al. TLR8 Is a Sensor of RNase T2 Degradation Products. Cell 2019, 179, 1264–1275.e13. [Google Scholar] [CrossRef] [PubMed]
  15. Hochrein, H.; Schlatter, B.; O’Keeffe, M.; Wagner, C.; Schmitz, F.; Schiemann, M.; Bauer, S.; Suter, M.; Wagner, H. Herpes simplex virus type-1 induces IFN-alpha production via Toll-like receptor 9-dependent and -independent pathways. Proc. Natl. Acad. Sci. USA 2004, 101, 11416–11421. [Google Scholar] [CrossRef] [PubMed]
  16. Filimonova, M.V.; Tsyshkova, N.G.; Narovlyansky, A.N.; Marinchenko, V.P.; Koval, L.S.; Parfenova, T.M.; Izmestieva, A.V.; Ershov, F.I. Indole-3-Carboxylic Acid Derivatives with Antiviral Activity. Patent RU 2552422 C2, 10 June 2015. (In Russian). [Google Scholar]
  17. Narovlyansky, A.N.; Filimonova, M.V.; Tsyshkova, N.G.; Pronin, A.V.; Grebennikova, T.V.; Karamov, E.V.; Larichev, V.F.; Kornilaeva, G.V.; Fedyakina, I.T.; Dolzhikova, I.V.; et al. Indole-3-Carboxylic Acid Derivative with Antiviral Activity Against SARS-CoV-2. Application No. 2022133152/04(072130), 16 December 2022. (In Russian). [Google Scholar]
  18. Narovlyansky, A.N.; Filimonova, M.V.; Tsyshkova, N.G.; Pronin, A.V.; Grebennikova, T.V.; Karamov, E.V.; Larichev, V.F.; Kornilayeva, G.V.; Fedyakina, I.T.; Dolzhikova, I.V.; et al. In Vitro Antiviral Activity of a New Indol-3-carboxylic Acid Derivative Against SARS-CoV-2. Acta Naturae 2023, 15, 83–91. [Google Scholar] [CrossRef] [PubMed]
  19. Sokolova, T.M.; Poloskov, V.V.; Burova, O.S.; Shuvalov, A.N.; Sokolova, Z.A.; Inshakov, A.N.; Shishkin, Y.V.; Ershov, F.I. The effect of interferons and interferon inducers on the expression of TLR/RLR receptor genes and differentiation of tumor cell lines THP-1 and HCT-116. Russ. J. Biother. 2016, 15, 28–33. (In Russian) [Google Scholar] [CrossRef]
  20. Sokolova, T.M.; Poloskov, V.V.; Shuvalov, A.N.; Burova, O.S.; Sokolova, Z.A. Signaling TLR/RLR mechanisms of immunomodulatory action of the drugs Ingavirin and Thymogen. Russ. J. Biother. 2019, 18, 60–66. (In Russian) [Google Scholar] [CrossRef]
  21. Sokolova, T.M.; Shuvalov, A.N.; Poloskov, V.V.; Ershov, F.I. Stimulation of signal transduction genes by Ridostin, Cycloferon and Ingavirin. Cytokines Inflamm. 2015, 14, 26–34. (In Russian) [Google Scholar]
  22. Sokolova, T.M.; Poloskov, V.V. Effect of Kagocel® on the expression of Toll-like receptor genes of the innate immune system in human THP-1 monocytes with different levels of differentiation. BIOpreparations. Prev. Diagn. Treat. 2021, 21, 116–121. (In Russian) [Google Scholar] [CrossRef]
  23. Tsuchiya, S.; Yamabe, M.; Yamaguchi, Y.; Kobayashi, Y.; Konno, T.; Tada, K. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int. J. Cancer 1980, 26, 171–176. [Google Scholar] [CrossRef]
  24. Human Monocytes with Reduced NLRP3 Activity. Available online: https://www.invivogen.com/sites/default/files/invivogen/products/files/thp1_defnlrp3_tds.pdf (accessed on 29 August 2024).
  25. Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
  26. Khabriev, R.U. (Ed.) Manual on Experimental (Preclinical) Study of New Pharmacological Substances; Meditsina: Moscow, Russia, 2005; 832p. (In Russian) [Google Scholar]
  27. Zhao, X.; Wang, J.; Yaojie, Y.; Zhang, M.; Zhao, W.; Zhang, H.; Zhao, L. Interferon-stimulated gene 15 promotes progression of endometrial carcinoma and weakens antitumor immune response. Oncol. Rep. 2022, 47, 110. [Google Scholar] [CrossRef]
  28. ISG15 Gene-ISG15 Ubiquitin Like Modifier. Gene Cards. The Human Gene Database. Updated: 6 August 2024. Available online: https://www.genecards.org/cgi-bin/carddisp.pl?gene=ISG15#summaries (accessed on 24 October 2024).
  29. Wikipedia-ISG15. Available online: https://en.wikipedia.org/wiki/ISG15 (accessed on 24 October 2024).
  30. Interleukin 1 Receptor Associated Kinase 3. Gene Cards. The Human Gene Database. Updated: 6 August 2024. Available online: https://www.genecards.org/cgi-bin/carddisp.pl?gene=IRAK3 (accessed on 24 October 2024).
  31. Maeß, M.B.; Wittig, B.; Cignarella, A.; Lorkowsk, S. Reduced PMA enhances the responsiveness of transfected THP-1 macrophages to polarizing stimuli. J. Immunol. Methods 2014, 402, 76–81. [Google Scholar] [CrossRef] [PubMed]
  32. Lund, M.E.; To, J.; O’Brien, B.A.; Donnelly, S. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J. Immunol. Methods 2016, 430, 64–70. [Google Scholar] [CrossRef] [PubMed]
  33. Nguyen, T.H.; Turek, I.; Meehan-Andrews, T.; Zacharias, A.; Irving, H. Analysis of interleukin-1 receptor associated kinase-3 (IRAK3) function in modulating expression of inflammatory markers in cell culture models: A systematic review and meta-analysis. PLoS ONE 2020, 15, e0244570. [Google Scholar] [CrossRef] [PubMed]
  34. Poloskov, V.V.; Sokolova, Z.A.; Burova, O.S.; Shuvalov, A.N.; Sokolova, T.M. The effect of mitogens on the differentiation of THP-1 cells and the expression of TLR/RLR genes. Cytokines Inflamm. 2016, 15, 161–165. (In Russian) [Google Scholar]
  35. Medzhitov, R.; Janeway, C. Innate immunity. N. Engl. J. Med. 2000, 343, 338–344. [Google Scholar] [CrossRef]
  36. Medzhitov, R.; Preston-Hurlburt, P.; Janeway, C. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997, 388, 394–397. [Google Scholar] [CrossRef]
  37. Hussein, W.M.; Liu, T.-Y.; Skwarczynski, M.; Toth, I. Toll-like receptor agonists: A patent review (2011–2013). Expert Opin. Ther. Pat. 2014, 24, 453–470. [Google Scholar] [CrossRef]
  38. Everson, R.G.; Hugo, W.; Sun, L.; Antonios, J.; Lee, A.; Ding, L.; Bu, M.; Khattab, S.; Chavez, C.; Billingslea-Yoon, E.; et al. TLR agonists polarize interferon responses in conjunction with dendritic cell vaccination in malignant glioma: A randomized phase II Trial. Nat. Commun. 2024, 15, 3882. [Google Scholar] [CrossRef]
  39. Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M.D.; Jones, B.T.; Moresco, E.M.Y.; Boger, D.L.; Beutler, B.; Zhang, H. Structural basis of TLR2/TLR1 activation by the synthetic agonist Diprovocim. J. Med. Chem. 2019, 62, 2938–2949. [Google Scholar] [CrossRef]
Figure 1. Determination of the cytotoxic effect of the XXV 48 h after addition to the THP-PMA-MPH cell culture (using the vital MTT dye). CC50 = 256.94 μg/mL (445.3 μM). The optical density (OD) was assessed at a wavelength of 545 nm using an Immunochem 2100 photometer (USA). The 50% cytotoxic concentration (CC50) was calculated using GraphPad Prism 6.01. The abscissa axis showed the dilution of the XXV (initial concentration of 5 mg/mL (8.6 mM), and the ordinate axis showed the percentage (%) of living cells.
Figure 1. Determination of the cytotoxic effect of the XXV 48 h after addition to the THP-PMA-MPH cell culture (using the vital MTT dye). CC50 = 256.94 μg/mL (445.3 μM). The optical density (OD) was assessed at a wavelength of 545 nm using an Immunochem 2100 photometer (USA). The 50% cytotoxic concentration (CC50) was calculated using GraphPad Prism 6.01. The abscissa axis showed the dilution of the XXV (initial concentration of 5 mg/mL (8.6 mM), and the ordinate axis showed the percentage (%) of living cells.
Viruses 16 01718 g001
Figure 2. Relative transcription level of the TLR3 and TLR4 genes 4 h after stimulation with the compound XXV in THP-PMA-MPH. The data obtained from the analysis in two replicates are presented. The calculations were performed relative to the control cells not treated with the XXV with normalisation to the reference gene ribRNA. The amplification data were processed automatically using CFX Maestro (Bio-rad, Hercules, CA, USA). The standard deviations (±SDs) of the Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The changes in gene activity (2deltaCq) in the experimental cell samples were determined relative to the control ones, which were taken to be equal to 1. The abscissa axis shows the expressed genes when treated with the XXV at concentrations of 6.25 μg/mL (10.8 µM) and 12.5 μg/mL (21.6 µM); the ordinate axis shows the relative expression level.
Figure 2. Relative transcription level of the TLR3 and TLR4 genes 4 h after stimulation with the compound XXV in THP-PMA-MPH. The data obtained from the analysis in two replicates are presented. The calculations were performed relative to the control cells not treated with the XXV with normalisation to the reference gene ribRNA. The amplification data were processed automatically using CFX Maestro (Bio-rad, Hercules, CA, USA). The standard deviations (±SDs) of the Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The changes in gene activity (2deltaCq) in the experimental cell samples were determined relative to the control ones, which were taken to be equal to 1. The abscissa axis shows the expressed genes when treated with the XXV at concentrations of 6.25 μg/mL (10.8 µM) and 12.5 μg/mL (21.6 µM); the ordinate axis shows the relative expression level.
Viruses 16 01718 g002
Table 1. Structure of oligonucleotide primers.
Table 1. Structure of oligonucleotide primers.
Gene NameSequenceSource
TLR2F:ATCCTCCAATCAGGCTTCTCT
R:GGACAGGTCAAGGCTTTTTACA
NM_003264.5
TLR3F:TTGCCTTGTATCTACTTTTGGGG
R:TCAACACTGTTATGTTTGTGGGT
NM_003265.3
TLR4F:AGACCTGTCCCTGAACCCTAT
R:CGATGGACTTCTAAACCAGCCA
NM_138557.3
TLR7F: TCCTTGGGGCTAGATGGTTTC
R: TCCACGATCACATGGTTCTTTG
NM_016562.4
TLR8F: ATGTTCCTTCAGTCGTCAATGC
R: TTGCTGCACTCTGCAATAACT
NM_138636.5
TLR9F: AATCCCTCATATCCCTGTCCC
R: GTTGCCGTCCATGAATAGGAAG
NM_017442.4
IFNA1F: GCCTCGCCCTTTGCTTTACT
R: CTGTGGGTCTCAGGGAGATCA
NM_024013.3
IFNA2F: GCTTGGGATGAGACCCTCCTA
R: CCCACCCCCTGTATCACAC
NM_000605.4
IFNB1F:GCTTGGATTCCTACAAAGAAGCA
R: ATAGATGGTCAATGCGGCGTC
NM_002176.4
IFNEF:GGCCTCTACCACTATCTTCTCTC
R:ACACTGCTGAATTGACAAGGTTT
NM_176891.5
IFNKF: GTGGCTTGAGATCCTTATGGGT
R: CAGATTTTGCCAGGTGACTCTT
NM_020124.3
IFNW1F:GAAGGCCCATGTCATGTCTGT
R:GAGTTGGTCTAGGAGGGTCAT
NM_002177.3
IFNGF: TCGGTAACTGACTTGAATGTCCA
R: TCGCTTCCCTGTTTTAGCTGC
NM_000619.3
IFNλ1(IL29)F:CACATTGGCAGGTTCAAATCTCT
R:CCAGCGGACTCCTTTTTGG
NM_172140.2
IFNλ3(IL29B)F: TAAGAGGGCCAAAGATGCCTT
R: CTGGTCCAAGACATCCCCC
NM_172139.4
TNF-αF:ATGATGGCTTATTACAGTGGCAA
R:GTCGGAGATTCGTAGCTGGA
NM_000576.3
IL-6F:ACTCACCTCTTCAGAACGAATTG
R:CCATCTTTGGAAGGTTCAGGTTG
NM_000600.5
IL12AF: CCTTGCACTTCTGAAGAGATTGA
R: ACAGGGCCATCATAAAAGAGGT
NM_000882.4
IL12BF: ACCCTGACCATCCAAGTCAAA
R:TTGGCCTCGCATCTTAGAAAG
NM_002187.3
IFNAR1F: ATTTACACCATTTCGCAAAGCTC
R: TCCAAAGCCCACATAACACTATC
NM_000629.3
IFNAR2F: TCATGGTGTATATCAGCCTCGT
R: AGTTGGTACAATGGAGTGGTTTT
NM_207585.3
Jak1F: CCACTACCGGATGAGGTTCTA
R: GGGTCTCGAATAGGAGCCAG
NM_002227.4
ISG15F: GCGCAGATCACCCAGAAGAT
R: GTTCGTCGCATTTGTCCACC
[27]
IRAK3F:TGCGGGATCTCCTTAGAGAA
R:GCAGAGAAATTCCGAGGGCA
NM_007199.3
18S PHKF GTAACCCGTTGAACCCCATT
R CCATCCAATCGGTAGTAGGCG
NR_003286
Table 2. Expression of TLR genes in THP-PMA-MPH cells treated with the XXV compound.
Table 2. Expression of TLR genes in THP-PMA-MPH cells treated with the XXV compound.
Gene NameFold Increase in the Stimulation of Gene Expression Levels
Drug Concentration6.25 μg/mL (10.8 µM)12.5 μg/mL (21.6 µM)
Exposure Time4 h24 h4 h24 h
TLR293.670.11.420.6
TLR316,312.25N/A205.50.3
TLR4406.020.16.591
TLR733.390.20.30.6
TLR878.170.21.440.8
TLR95.550.090.23.4
Note: The amplification data were processed automatically using CFX Maestro (Bio-rad, Hercules, CA, USA). The standard deviations (±SDs) of the Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The changes in gene activity (2deltaCq) in the experimental cell samples were determined relative to the control ones, which were taken to be equal to 1. N/A means no expression detected.
Table 3. Expression of IFN genes in THP-PMA-MPH cells treated with XXV.
Table 3. Expression of IFN genes in THP-PMA-MPH cells treated with XXV.
Gene NameFold Increase in the Stimulation of Gene Expression Levels
Drug Concentration6.25 μg/mL12.5 μg/mL
Exposure Time4 h24 h4 h24 h
IFNA12.091.2410.730.71
IFNA21.181.060.18.8
IFNB13.18N/A2.662.0
IFNEN/AN/A1N/A
IFNK0.372.5912.0311.59
IFNW12.0N/A0.161.27
IFNG1.87N/AN/AN/A
IFNλ1N/AN/A2.7N/A
IFNλ30.230.570.442.17
Note: The amplification data were processed automatically using CFX Maestro (Bio-rad, Hercules, CA, USA). The standard deviations (±SDs) of the Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The changes in gene activity (2deltaCq) in the experimental cell samples were determined relative to the control ones, which were taken to be equal to 1. N/A means no expression detected.
Table 4. Expression of immunoregulatory cytokine genes in THP-PMA-MPH cells after treatment with XXV.
Table 4. Expression of immunoregulatory cytokine genes in THP-PMA-MPH cells after treatment with XXV.
Gene NameFold Increase in the Stimulation of Gene Expression Levels
Drug Concentration6.25 μg/mL12.5 μg/mL
Exposure Time4 h24 h4 h24 h
TNFA1.8N/A4.4N/A
IL6213.85N/A28.7N/A
IL12A45.390.0719.80.08
IL12BN/A321.76N/A3.37
Note: The amplification data were processed automatically using CFX Maestro (Bio-rad, Hercules, CA, USA). The standard deviations (±SDs) of the Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The changes in gene activity (2deltaCq) in the experimental cell samples were determined relative to the control ones, which were taken to be equal to 1. N/A means no expression detected.
Table 5. Expression of genes encoding signalling molecules involved in immune signal transduction in THP-PMA-MPH cells treated with XXV.
Table 5. Expression of genes encoding signalling molecules involved in immune signal transduction in THP-PMA-MPH cells treated with XXV.
Gene NameFold Increase in the Stimulation of Gene Expression Levels
Drug Concentration6.25 μg/mL12.5 μg/mL
Exposure Time4 h24 h4 h24 h
IFNAR146.240.127.530.37
IFNAR27.0N/A2.14N/A
JAK110.730.443.930.45
ISG1514.391.183.971.46
IRAK347.930.1813.670.47
Note: The amplification data were processed automatically using CFX Maestro (Bio-rad, Hercules, CA, USA). The standard deviations (±SDs) of the Cq values of the logarithmic phase and the change in levels in the test samples (delta Cq ± SDs) were determined. The changes in gene activity (2deltaCq) in the experimental cell samples were determined relative to the control ones, which were taken to be equal to 1. N/A means no expression detected.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Narovlyansky, A.; Pronin, A.; Poloskov, V.; Sanin, A.; Mezentseva, M.; Fedyakina, I.; Suetina, I.; Zubashev, I.; Ershov, F.; Filimonova, M.; et al. Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative. Viruses 2024, 16, 1718. https://doi.org/10.3390/v16111718

AMA Style

Narovlyansky A, Pronin A, Poloskov V, Sanin A, Mezentseva M, Fedyakina I, Suetina I, Zubashev I, Ershov F, Filimonova M, et al. Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative. Viruses. 2024; 16(11):1718. https://doi.org/10.3390/v16111718

Chicago/Turabian Style

Narovlyansky, Alexander, Alexander Pronin, Vladislav Poloskov, Alexander Sanin, Marina Mezentseva, Irina Fedyakina, Irina Suetina, Igor Zubashev, Felix Ershov, Marina Filimonova, and et al. 2024. "Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative" Viruses 16, no. 11: 1718. https://doi.org/10.3390/v16111718

APA Style

Narovlyansky, A., Pronin, A., Poloskov, V., Sanin, A., Mezentseva, M., Fedyakina, I., Suetina, I., Zubashev, I., Ershov, F., Filimonova, M., Surinova, V., Volkova, I., & Bogdanov, E. (2024). Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative. Viruses, 16(11), 1718. https://doi.org/10.3390/v16111718

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop