Next Article in Journal
First Insight into the Seroepidemiology of Hepatitis E Virus (HEV) in Dogs, Cats, Horses, Cattle, Sheep, and Goats from Bulgaria
Previous Article in Journal
Begomovirus–Host Interactions: Viral Proteins Orchestrating Intra and Intercellular Transport of Viral DNA While Suppressing Host Defense Mechanisms
 
 
Due to scheduled maintenance work on our database systems, there may be short service disruptions on this website between 10:00 and 11:00 CEST on June 14th.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus

1
Natural Resources Institute, University of Greenwich, Central Avenue, Chatham Maritime, Kent ME4 4TB, UK
2
Council for Scientific and Industrial Research-Crops Research Institute, Fumesua, Kumasi P.O. Box 3785, Ghana
*
Author to whom correspondence should be addressed.
Viruses 2023, 15(7), 1592; https://doi.org/10.3390/v15071592
Submission received: 9 June 2023 / Revised: 14 July 2023 / Accepted: 19 July 2023 / Published: 21 July 2023
(This article belongs to the Section Viruses of Plants, Fungi and Protozoa)

Abstract

:
Yam (Dioscorea spp.) productivity is constrained significantly by the lack of a formal seed system. Vegetative propagation, through tuber setts as ‘seed’ yams, encourages the recycling of virus-infected planting materials, contributing to high virus incidence and yield losses. Efforts are ongoing to increase the production of high-quality seed yams in a formal seed system to reduce virus-induced yield losses and enhance the crop’s productivity and food security. Specific and sensitive diagnostic tests are imperative to prevent the multiplication of virus-infected materials contributing to a sustainable seed yam certification system. During routine indexing of yam accessions, discrepancies were observed between the results obtained from the reverse transcription loop-mediated isothermal amplification (RT-LAMP) test and those from reverse transcription polymerase chain reaction (RT-PCR); RT-LAMP failed to detect Yam mosaic virus (YMV) in some samples that tested positive by RT-PCR. This prompted the design of a new set of LAMP primers, YMV1-OPT primers. These primers detected as little as 0.1 fg/µL of purified RNA obtained from a YMV-infected plant, a sensitivity equivalent to that obtained with RT-PCR. RT-LAMP using YMV1-OPT primers is recommended for all future virus-indexing of seed yams for YMV, offering a rapid, sensitive, and cost-effective approach.

1. Introduction

Yam mosaic virus (YMV) is a prevalent virus of yam [1,2,3,4], an important staple food crop in many parts of the world [5]. It belongs to the genus Potyvirus and has a single-stranded, positive-sense RNA genome that is approximately 9.6 kb long and encodes a single large polyprotein, which is cleaved into smaller proteins [6,7,8,9]. YMV is widely distributed in tropical and subtropical yam-growing regions, particularly in West Africa, the West Indies, and the Caribbean [3,4,10]. It commonly infects D. rotundata, D. cayenensis-rotundata, and D. alata [3,11]. The virus is transmitted through vegetative propagation of infected yam materials or by aphid vectors in a non-persistent manner, causing various symptoms, including mosaic patterns on leaves, stunted growth, and reduced yields [3]. YMV has been reported to cause about 40% yield loss in yam fields [12,13] and hamper the exchange of valuable germplasm for the crop’s improvement.
Yam plays a vital role in food security, income generation, and nutrition for smallholder farmers, especially in West Africa, which produces over 95% of the world’s total yam production [3,5,14]. An infection with YMV in the field threatens the food security and livelihoods of West Africans. The absence of a formal seed yam certification system and farmers selecting small tubers from their harvest for planting the following season encourage the propagation of infected materials, which has been instrumental to the spread of YMV in yam-growing regions [15,16,17].
The use of virus-free planting materials is the most effective method to control the spread of viruses infecting yam [18,19]. Several methods have recently been developed to boost the production of virus-free seed yams, including single-node vine cuttings, tissue culture, hydroponics, and aeroponic systems [16,20,21]. The development of sensitive and cost-effective diagnostics is paramount to guarantee the production of virus-free seed yams for a sustainable formal seed system [22,23]. These diagnostics methods must address virus detection challenges, including false-negative results arising from reduced virus titre associated with clonally propagated crops [8]. Furthermore, the genomic variability of YMV makes the detection of all putative isolates/variants challenging [24].
Methods used for the detection of YMV include enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR), immunocapture-RT-PCR (IC-RT-PCR), and isothermal assays such as recombinase polymerase amplification (RPA) and reverse transcription loop-mediated isothermal amplification (RT-LAMP) [3,22,23,25,26,27,28]. RPA and RT-LAMP offer similar and greater sensitivities, respectively, compared to RT-PCR, with more benefits, including speed, cost-efficiency, in-field diagnosis, and ease of establishment in resource-challenged laboratories, and are considered advantageous for the routine detection of YMV [22,23,29].
Routine indexing of yam plants for YMV in our laboratories identified discrepancies between the RT-LAMP [23] and RT-PCR [25] tests. RT-LAMP gave false-negative results for some samples, which were confirmed positive for YMV by RT-PCR and Sanger sequencing. False-negative results could permit the multiplication of infected plant materials in the seed systems, discrediting the integrity of quality seeds distributed to farmers [19,28]. Further, it could pose severe challenges to plant health by spreading viruses or novel variants to new regions through the exchange of infected germplasms [28]. This prompted the development of a new set of LAMP primers which are described in this article and were found to increase not only the specificity but also the sensitivity of YMV detection compared to existing YMV LAMP primers [23].

2. Materials and Method

2.1. Plant Material, Total RNA Extraction, and Crude Sample Preparation

Yam (D. rotundata and D. alata) leaf tissues used in this study were obtained from plants grown in glasshouses at the Natural Resources Institute (NRI), United Kingdom, the Centre for Scientific and Industrial Research-Crops Research Institute (CSIR-CRI) in Ghana, and yam field surveys conducted in Benin, Cameroon, Togo, and Nigeria (Table 1). Total RNAs were extracted from leaf tissues using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, Saint Louis, MO, USA), according to the manufacturer’s recommendations. The concentration and purity of extracted yam RNAs were measured using a NanoDrop 2000 spectrometer (ThermoScientific, Waltham, MA, USA).
The detection of YMV from crude extracts was carried out using the protocol described by Silva et al. [27]. One leaf disc was immersed in 300 µL of freshly prepared PEG buffer (6% w/v polyethylene glycol (PEG)−200 in 20 mM NaOH). The tubes were vortexed briefly and incubated for 5 min at room temperature. Crude extracts were used directly as templates in RT-LAMP assays.

2.2. The Detection of YMV by RT-PCR and Phylogenetic Analysis

The detection of YMV by RT-PCR was carried out using the primer pair YMV CP 1F and YMV UTR 1R (Table 2), which amplifies a 586 bp region comprising a partial coat protein (CP) gene and the 3’ UTR region of the YMV genome [25]. The RNA quality was confirmed by amplifying the yam actin gene, as described by Silva et al. [22]. RT-PCR assays were set up as 20 µL reactions containing 0.2 µM of each primer (Sigma Aldrich), 0.25 mM of each dNTP (ThermoScientific), 1.25 U DreamTaq DNA Polymerase (ThermoScientific), 2.5 U AMV-reverse transcriptase (Promega, Madison, WI, USA), 1X DreamTaq Green Buffer containing 2 mM MgCl2 (ThermoScientific), and 2 µL RNA as template. Thermal cycling conditions were 50 °C for 10 min, followed by 95 °C for 4.5 min, and 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, and a final extension of 72 °C for 10 min. RT-PCR products were analysed by electrophoresis on agarose gels [2% (w/v) agarose in Tris-borate-EDTA (0.5 × TBE) buffer (pH 8.0)] and viewed under UV light using a gel doc system (SynGene, Cambridge, UK). PCR products were purified and Sanger-sequenced by the Source BioScience sequencing service (Cambridge, UK). The nucleotide sequences generated from the PCR products were analysed and assembled using Geneious Prime®® 2023.0.1 (Biomatters Ltd., Auckland, New Zealand). Sequences were used for similarity BLAST searches in the National Centre for Biotechnology Information (NCBI) GenBank databases.
Thirty YMV coat protein (CP) sequences, representing YMV phylogenetic groups classified by Bousalem et al. [24] and Mendoza et al. [9], were downloaded from NCBI and aligned with 36 YMV CP sequences obtained from this study (Table 3) to generate a percentage similarity matrix using Multiple Alignment using Fast Fourier Transform (MAFFT) v7.490 in Geneious Prime®® 2023.0.1. The aligned sequences were used for phylogenetic analysis using the Neighbor-Joining (NJ) method in Molecular Evolutionary Genetics Analysis across Computing Platforms (MEGA X) v10.2.6 software [30]. The reliability of the tree branches was evaluated by bootstrap test in 1000 replicates.

2.3. New LAMP Primer Design for YMV Detection

A multiple sequence alignment of 125 YMV CP sequences (downloaded from the NCBI GenBank database on 5 April 2021) was carried out using the Mafft Alignment v7.450 in Geneious Prime®® 2021.1.1 (Biomatters Ltd., Auckland, New Zealand). A consensus sequence based on the alignment was used to design new LAMP primers using the Primer Explorer V5 software (http://primerexplorer.jp/e/) and visual adjustment of the primers’ position to avoid mismatches.

2.4. Detection of YMV by RT-LAMP

The same RNAs analysed by RT-PCR were used as templates in RT-LAMP. Two sets of primers were used (Table 2). Each RT-LAMP reaction was carried out in three replicates. The RT-LAMP assays were set up as 25 µL reactions containing 1X isothermal master mix (OptiGene, Horsham, UK), 0.2 µM forward and reverse outer primers (F3 and B3), 1.6 µM forward and reverse internal primers (FIP and BIP), 0.4 µM forward and reverse loop primers (LF and LB), and 2 µL of RNA template or crude extract. The assays were run in a Genie III LAMP machine (OptiGene) at 65 °C for 45 min. The subsequent melting process from 98 °C to 80 °C was carried out with a ramp rate of −0.05 °C/s.

2.5. Sensitivity Test for the Improved YMV RT-LAMP Assay

Purified total RNA (100 ng/µL) from a YMV-infected yam plant (Nig14) was serially diluted in RNA (100 ng/µL) from a YMV-negative plant (Nig15). Ten-fold serial dilutions down to 10−9 were tested by RT-LAMP and RT-PCR in duplicate assays. The sensitivity of the improved RT-LAMP for detecting YMV from crude RNA extracts was also evaluated. Similar to the purified total RNA, crude RNA extract from Nig14 was diluted ten-fold down to 10−6 with the crude extract from Nig15 and tested by RT-LAMP.

3. Results

3.1. Indexing of YMV by RT-PCR and RT-LAMP Assays

During routine testing of yam plants for YMV detection, discrepancies were found between the standard RT-PCR test and the RT-LAMP developed by Nkere et al. [23]. Three of six samples that tested positive by RT-PCR (Figure 1A), namely Gh3, Gh5, and Nig1, and that showed mild symptoms of YMV infection (Figure 2) tested negative by RT-LAMP (Figure 1B). The PCR products from Gh5 and Nig1 were sequenced (GenBank accession OQ677014 and OQ677015) and showed 99.1% and 98.9% identity, respectively, to Yam mosaic virus isolate DrCDI1, GenBank AJ305449. In addition to the negative RT-LAMP results with samples Gh3, Gh5, and Nig1, there were also late amplification times (>30 min) obtained for samples Gh1 and Gh2 (Figure 1B).
These unsatisfactory RT-LAMP results prompted the design of new LAMP primers to increase the specificity of the assay for YMV detection. New YMV LAMP primers (YMV1-OPT, Figure 3) were designed and used to test the same samples previously tested by RT-PCR and RT-LAMP using the Nkere et al. [23] primers. The new RT-LAMP using YMV1-OPT primers, subsequently referred to as the improved RT-LAMP test, detected YMV from all six samples within 15 min (Figure 4).

3.2. Evaluation of Improved YMV RT-LAMP Assay Specificity

RNA extracts from leaves of 14 D. alata plants were tested by RT-PCR for YMV and YMMV, another potyvirus infecting yam. Of these, 9/14 tested positive for YMMV only, 1/14 positive for YMV only, and 1/14 positive for both YMV and YMMV. PCR products of the YMV-positive samples were Sanger-sequenced by the Source BioScience sequencing service (Cambridge, UK), which confirmed the presence of YMV.
The same 14 D. alata RNAs were used to test the specificity of the improved RT-LAMP test. The assay detected YMV from the two YMV-positive samples, DA Nig1 and CTRT127, detected by RT-PCR (Table 4). All other samples were negative for YMV, confirming that there was no cross-reactivity of the YMV1-OPT primers with YMMV or the host plant.

3.3. Sensitivity of Improved YMV RT-LAMP

The sensitivity of the improved RT-LAMP assay for detecting YMV was compared to RT-PCR using primers by Mumford et al. [26]. RNA obtained from a YMV-infected D. rotundata plant was serially diluted ten-fold down to 10−9 using RNA from a YMV-negative D. rotundata plant. Each dilution was indexed for YMV by RT-PCR and the improved RT-LAMP assay. YMV positive amplifications were obtained from both assays down to 10−9 (Figure 5A,C). The time required to detect YMV in the most dilute sample (10−9) was approximately 32 min (Figure 5A). Similarly, serially diluted crude RNA extracts derived from incubating one YMV-infected leaf disc in PEG buffer were also tested for YMV via the improved RT-LAMP assay. YMV was detected in the sample RNAs diluted down to 10−2 (Figure 5B).

3.4. Comparison of Conventional RT-PCR and the New RT-LAMP

Purified total RNAs from 53 leaf samples of D. rotundata and D. alata were tested for YMV using the improved RT-LAMP assay and compared with conventional RT-PCR. A total of 36 samples tested positive for YMV by both tests (Table 5). With RT-LAMP, positive amplification signals were obtained in <26 min compared to >150 min required for RT-PCR. All samples that were negative by RT-LAMP were also negative by RT-PCR. The actin housekeeping gene was targeted by RT-PCR and used as an internal control to confirm the good quality of the RNAs, and YMV-negative results were due to a lack of viral RNA rather than any inhibition of the assay (results not shown).

3.5. Sequence Identity and Phylogenetic Analysis of YMV Amplicons

The mean pairwise nucleotide identity of Sanger-sequenced PCR products from YMV-positive samples (n = 36) obtained in this study was 97.1%. Nucleotide pairwise comparison of these sequences with YMV CP sequences downloaded from NCBI GenBank (n = 30) revealed 89.2–99% nucleotide identities, higher than the proposed International Committee on Taxonomy of Viruses (ICTV) criterion of <76–77% nucleotide identity for species demarcation of potyvirus CP gene [32,33].
Phylogenetic analysis clustered the YMV sequences from this study into six phylogenetic groups (Figure 6), with a percentage identity matrix of >97–100% within groups and <97% between groups (Supplementary Table S1). Isolates Ben1, Cam4, Gh2, Gh3, Gh15, Gh17, Gh18, Gh19, Gh20, Gh23, Gh27, Gh29, Gh30, Gh32, Gh33, Gh35, Gh36, Nig3, Nig4, Nig6, and Tog2, from samples collected from Benin, Cameroon, Ghana, Nigeria, and Togo, clustered in group III, an African group as classified by Bousalem et al. [24]. The other 16 isolates formed five new groups, XI, XII, XIII, XIV, and XV. Isolates Nig2, Tog1, Cam3, and Gh21 stood out as separate groups labelled as XI, XII, XIII, and XIV, respectively, and had pairwise nucleotide identities of <97% compared to sequences in other phylogenetic groups (Figure 6). Isolates Cam2, Gh5, Gh28, Gh34, Nig1, Nig5, Nig10, Nig11, Nig12, Nig13, and Nig14 clustered together with a YMV reference genome from Nigeria, MG711313 [8] to form group XV, which also had a pairwise nucleotide identity of <97% with sequences in other phylogenetic groups (Figure 6).
Sequences of YMV isolates obtained from this study were tested for recombination using the Recombination Detection Program (RDP) v.4.101. [34]. No recombination was detected among the YMV sequences.

4. Discussion

This study aimed to strengthen virus diagnostics in the seed yam systems by improving existing diagnostic tests because virus detection is crucial for efficient disease management in clean seed propagation systems, most notably during sanitation programs (review by Diouf et al. [3]). An RT-LAMP assay improved in both its specificity and sensitivity for YMV, one of the most economically damaging yam viruses globally, has in this study been developed to assist in the identifying of virus-free yam planting materials.
The false-negative results obtained by previously reported YMV LAMP primers [23] appear to be due to them having been designed from an alignment of the then available YMV coat protein sequences not fully encompassing diversity in the primer targeted regions. Aligning these primers to 125 YMV coat protein sequences revealed mismatches at the 3′ end of the primers (Supplementary Figure S1). Studies have shown that 3′ terminal mismatches are detrimental to nucleic acid-based amplifications, resulting in a decreased amplification copy number or complete inhibition of amplification, hence providing false-negative results [35,36,37,38]. This prompted the need to develop a new YMV LAMP primer set.
The new RT-LAMP primer set, YMV1-OPT, demonstrated higher specificity than the existing RT-LAMP primer set [23], as it detected YMV from samples that tested negative with the existing primer set. This is assumed to be due to the YMV1-OPT primers having been designed to minimise the mismatches to 125 YMV sequences from the GenBank database and inserting degenerate codes at 3′ ends where mismatches could not be avoided [39,40,41].
Multiple primer combinations were evaluated during the design and selection process of the YMV1-OPT primers (results not shown). Mismatches were avoided at the 3′ ends to the greatest extent; however, where inevitable, nucleotide mismatches with <20% of the aligned sequences in one or two positions were tolerated for the outer and loop primers. Previous studies have shown that mismatches are better tolerated in the outer primers than inner primers [42,43]. This could be because the inner primers initiate the amplification process in LAMP assays, hence the need for specificity. The FIP and BIP primers are a fusion of F1C and F2, and B1C and B2 primers, respectively, with the F2 and B2 regions at the 3′ ends and F1C and B1C at the 5′ ends. Hence, mismatches at the 3′ ends of the F2 and B2 primers were replaced with degenerate codes, while those at the F1C and B1C regions were ignored.
Among the YMV isolates sequenced in this study, 21 clustered with isolates belonging to group III were reported in previous studies [9,24], while 11 clustered with a YMV reference genome, MG711313, from Nigeria [8]. According to the classification described by Bousalem et al. [24], Groups I, II, III, IV, VII, and IX comprise samples collected from the African region. An in-silico analysis of sequence alignments of the YMV1-OPT primers with representative sequences of these African groups indicates that the primers will detect YMV isolates from throughout the West African region. The remaining four YMV isolates, Gh21, Cam3, Tog1, and Nig2, formed four distinct groups, suggesting new phylogenetic groups, perhaps associated with isolates from other parts of the world. However, due to limited resources, only samples obtained from West Africa were used for this study. Further studies will be required to validate the detection of YMV from other yam-growing regions of the world using the YMV1-OPT primers.
The inability of RT-PCR to detect YMV from sample 4 (Figure 2) that tested positive by RT-LAMP could be due to PCR-inhibitory substances co-extracted with the yam RNA since the yam actin gene was also not detected in the same sample. Mumford and Seal [26] reported that yam tissues contain some PCR-inhibitory substances that could be co-extracted with the RNA. This suggests a higher tolerance of RT-LAMP to inhibitors than RT-PCR, which has also been reported in other studies [23,44,45].
Previous studies have shown that RT-LAMP is at least 100 times more sensitive than RT-PCR [23,46,47]. Nkere et al. [23] reported a sensitivity limit of 1000 fg/µL–100 fg/µL and 0.1 ng/µL–0.01 ng/µL for YMV LAMP primers, and YMV-F3x and YMV-B3x PCR primers, respectively. However, in this study, YMV1-OPT primers and YMV CP 1F and YMV UTR 1R PCR primers [25] both detected YMV from an infected sample down to the lowest dilution tested, 0.1 fg/µL (10−9). However, the differences in sensitivities could be due to variations in the YMV concentration of tested samples. YMV amplification was observed at ~32 min in the most dilute RNA sample, 0.1 fg/µL, suggesting that 40 min was sufficient to detect YMV in samples with low virus titre. The improved RT-LAMP assay also detected YMV from crude RNA extracts diluted down to 10−2, indicating that this approach can be used for rapid detection and in-field diagnosis of YMV. Overall, these imply that the YMV1-OPT primers are highly sensitive and valuable for laboratory-based and in-field detection of YMV.
Highly specific and sensitive diagnostic tests are required for the reliable diagnosis of plant viruses [22,26,28,48]. However, the development of diagnostic tests is an ongoing task. Diagnostic primers must be reviewed regularly and updated as new virus isolates are reported, as this would prevent false-negative results that might arise from potential diversity in such isolates [24,28,49], as observed in this study. The improved RT-LAMP assay will enhance the specificity of YMV detection in the production of virus-free seed yams in West Africa.

5. Conclusions

The routine detection of YMV via RT-LAMP using crude RNA extracts offers a significant cost and time-saving alternative to RT-PCR assays being used in the seed systems, which require extensive RNA extraction procedures. Furthermore, amplification products are visualised by monitoring the fluorescence generated by positive samples in real-time, thus reducing the likelihood of post-assay contaminations associated with PCR assays. This study presents an RT-LAMP assay with improved specificity and sensitivity for detecting YMV, which can be implemented at several stages of the seed multiplication process to eliminate YMV-positive samples quickly and cost-effectively. The YMV1-OPT primers designed in this study are being used to develop a ready-to-use YMV commercial kit (YMV1-OPT Isothermal kit, OptiGene). This will reduce the assay preparation time and the risk of contamination from the handling process.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v15071592/s1, Figure S1: Alignment of YMV coat protein sequences, highlighting the YMV LAMP primers by Nkere et al. [23]; Table S1: Percentage identity matrix of sequence alignment used for phylogenetic analysis.

Author Contributions

Conceptualization, R.O.F.; methodology, R.O.F., S.E.S. and G.S.; validation, R.O.F., S.E.S., R.P., M.D.Q. and G.S.; formal analysis, R.O.F., S.E.S., R.P., M.D.Q. and G.S.; investigation, R.O.F.; resources, S.E.S., R.P., M.D.Q. and G.S.; data curation, R.O.F.; writing—original draft preparation, R.O.F.; writing—review and editing, R.O.F., S.E.S., R.P., M.D.Q. and G.S.; visualization, R.O.F., S.E.S., R.P., M.D.Q. and G.S.; supervision, S.E.S. and G.S.; project administration, S.E.S., R.P., M.D.Q. and G.S.; funding acquisition, S.E.S. All authors have read and agreed to the published version of the manuscript.

Funding

Contributions from all authors were supported in part through the Royal Society [Grant Number ICA\R1\191324]. Contributions from R.O.F., G.S. and S.E.S. were also supported in part through the Bill & Melinda Gates Foundation [Grant Number OPP1149777].

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All sequences have been deposited in GenBank, accession numbers can be found in Table 3.

Acknowledgments

All authors gratefully acknowledge support through an International Collaboration grant from the Royal Society [Grant Number ICA\R1\191324]. Ruth O. Festus, Gonçalo Silva and Susan E. Seal’s contributions were also supported in part through the Bill & Melinda Gates Foundation [Grant Number OPP1149777]. Under the grant conditions of the Foundation, a Creative Commons Attribution 4.0 Generic License has already been assigned to the Author Accepted Manuscript version that might arise from this submission.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Thouvenel, J.C.; Fauquet, C. Yam mosaic, a new potyvirus infecting Dioscorea cayenensis in the Ivory Coast. Ann. Appl. Biol. 1979, 93, 279–283. [Google Scholar] [CrossRef]
  2. Bakayoko, Y.; Kouakou, A.; Kouassi, A.B.; Gomez, R.M.; Dibi, K.E.B.; Essis, B.S.; N’Zué, B.; Adebola, P.; N’Guetta, A.S.P.; Umber, M. Detection and diversity of viruses infecting African yam (Dioscorea rotundata) in a collection and F1 progenies in Côte d’Ivoire shed light to plant-to-plant viral transmission. Plant Pathol. 2021, 70, 1486–1495. [Google Scholar] [CrossRef] [PubMed]
  3. Diouf, M.B.; Festus, R.; Silva, G.; Guyader, S.; Umber, M.; Seal, S.; Teycheney, P.Y. Viruses of yams (Dioscorea spp.): Current gaps in knowledge and future research directions to improve disease management. Viruses 2022, 14, 1884. [Google Scholar] [CrossRef] [PubMed]
  4. Luo, G.F.; Podolyan, A.; Kidanemariam, D.B.; Pilotti, C.; Houliston, G.; Sukal, A.C. A review of viruses infecting yam (Dioscorea spp.). Viruses 2022, 14, 662. [Google Scholar] [CrossRef] [PubMed]
  5. Asiedu, R.; Sartie, A. Crops that feed the World 1. Yams. Food Secur. 2010, 2, 305–315. [Google Scholar] [CrossRef]
  6. Aleman-Verdaguer, M.E.; Goudou-Urbino, C.; Dubern, J.; Beachy, R.N.; Fauquet, C. Analysis of the sequence diversity of the P1, HC, P3, NIb and CP genomic regions of several yam mosaic potyvirus isolates: Implications for the intraspecies molecular diversity of potyviruses. J. Gen. Virol. 1997, 78, 1253–1264. [Google Scholar] [CrossRef]
  7. Fuji, S.; Nakamae, H. Complete nucleotide sequence of the genomic RNA of a Japanese Yam mosaic virus, a new potyvirus in Japan. Arch. Virol. 1999, 144, 231–240. [Google Scholar] [CrossRef]
  8. Bömer, M.; Rathnayake, A.I.; Visendi, P.; Sewe, S.O.; Sicat, J.P.A.; Silva, G.; Kumar, P.L.; Seal, S.E. Tissue culture and next-generation sequencing: A combined approach for detecting yam (Dioscorea spp.) viruses. Physiol. Mol. Plant Pathol. 2019, 105, 54–66. [Google Scholar] [CrossRef]
  9. Mendoza, A.R.; Margaria, P.; Nagata, T.; Winter, S.; Blawid, R. Characterization of Yam mosaic viruses from Brazil reveals a new phylogenetic group and possible incursion from the African continent. Virus Genes 2022, 58, 294–307. [Google Scholar] [CrossRef]
  10. Azeteh, I.N.; Hanna, R.; Njukeng, A.P.; Oresanya, A.O.; Sakwe, P.N.; Kumar, L.P. Distribution and diversity of viruses infecting yams (Dioscorea spp.) in Cameroon. VirusDisease 2019, 30, 526–537. [Google Scholar] [CrossRef]
  11. Eni, A.O.; Hughes, J.A.; Asiedu, R.; Rey, M.E.C. Survey of the incidence and distribution of viruses infecting yam (Dioscorea spp.) in Ghana and Togo. Ann. Appl. Biol. 2010, 156, 243–251. [Google Scholar] [CrossRef]
  12. Séka, K.; Etchian, A.O.; Assiri, P.K.; Toualy, M.N.Y.; Diallo, H.A.; Kouassi, N.K. Yield loss caused by Yam mosaic virus (YMV) and cucumber mosaic virus (CMV) on the varieties of Dioscorea spp. Int. J. Agron. Agric. Res. 2014, 5, 64–71. [Google Scholar]
  13. Adeniji, M.O.; Shoyinka, S.A.; Ikotun, T.; Asiedu, R.; Hughes, J.A.; Odu, B.O. Yield loss in Guinea yam (Dioscorea rotundata poir.) due to infection by Yam mosaic virus (YMV) genus Potyvirus. Ife J. Sci. 2012, 14, 237–244. [Google Scholar]
  14. Hahn, S.K.; Osiru, D.S.O.; Akoroda, M.O.; Otoo, J.A. Yam production and its future prospects. Outlook Agric. 1987, 16, 105–110. [Google Scholar] [CrossRef]
  15. Balogun, M.O.; Maroya, N.; Asiedu, R. Status and prospects for improving yam seed systems using temporary immersion bioreactors. Afr. J. Biotechnol. 2014, 13, 1614–1622. [Google Scholar] [CrossRef] [Green Version]
  16. Aighewi, B.A.; Asiedu, R.; Maroya, N.; Balogun, M. Improved propagation methods to raise the productivity of yam (Dioscorea rotundata Poir.). Food Secur. 2015, 7, 823–834. [Google Scholar] [CrossRef] [Green Version]
  17. Stuart, E.; Asfaw, A.; Adebola, P.; Maroya, N.; Edemodu, A.; Adeosun, T.; Asiedu, R.; Almekinders, C. Yam seed system characteristics in Nigeria: Local practices, preferences, and the implications for seed system interventions. Outlook Agric. 2021, 50, 455–467. [Google Scholar] [CrossRef]
  18. Balogun, M.; Maroya, N.; Augusto, J.; Ajayi, A.; Kumar, L.; Aighewi, B.; Asiedu, R. Relative efficiency of positive selection and tissue culture for generating pathogen-free planting materials of yam (Dioscorea spp.). Czech J. Genet. Plant Breed. 2017, 53, 9–16. [Google Scholar] [CrossRef] [Green Version]
  19. Ita, E.E.; Uyoh, E.A.; Nakamura, I.; Ntui, V.O. Efficient elimination of Yam mosaic virus (YMV) from white yam (Dioscorea rotundata Poir.) by cryotherapy of axillary buds. S. Afr. J. Bot. 2020, 130, 123–129. [Google Scholar] [CrossRef]
  20. Maroya, N.; Balogun, M.; Asiedu, R.; Aighewi, B.; Kumar, P.L.; Augusto, J. Yam propagation using ‘aeroponics’ technology. Annu. Res. Rev. Biol. 2014, 4, 3894–3903. [Google Scholar] [CrossRef]
  21. Aighewi, B.; Maroya, N.; Kumar, P.L.; Balogun, M.; Aihebhoria, D.; Mignouna, D.; Asiedu, R. Seed yam production using high-quality minitubers derived from plants established with vine cuttings. Agronomy 2021, 11, 978. [Google Scholar] [CrossRef]
  22. Silva, G.; Bömer, M.; Nkere, C.; Kumar, P.L.; Seal, S.E. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification. J. Virol. Methods 2015, 222, 138–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Nkere, C.K.; Oyekanmi, J.O.; Silva, G.; Bömer, M.; Atiri, G.I.; Onyeka, J.; Maroya, N.G.; Seal, S.E.; Kumar, P.L. Chromogenic detection of Yam mosaic virus by closed-tube reverse transcription loop-mediated isothermal amplification (CT-RT-LAMP). Arch. Virol. 2018, 163, 1057–1061. [Google Scholar] [CrossRef] [Green Version]
  24. Bousalem, M.; Dallot, S.; Guyader, S. The use of phylogenetic data to develop molecular tools for the detection and genotyping of Yam mosaic virus. Potential application in molecular epidemiology. J. Virol. Methods 2000, 90, 25–36. [Google Scholar] [CrossRef]
  25. Mumford, R.A.; Jayaratne, D.L.; Seal, S.E. The Use of the Polymerase Chain Reaction for the Characterisation and Diagnosis of Yam Potyviruses; Springer: Dordrecht, The Netherlands, 1997; pp. 157–160. [Google Scholar] [CrossRef]
  26. Mumford, R.A.; Seal, S.E. Rapid single-tube immunocapture RT-PCR for the detection of two yam potyviruses. J. Virol. Methods 1997, 69, 73–79. [Google Scholar] [CrossRef] [PubMed]
  27. Silva, G.; Oyekanmi, J.; Nkere, C.K.; Bömer, M.; Kumar, P.L.; Seal, S.E. Rapid detection of potyviruses from crude plant extracts. Anal. Biochem. 2018, 546, 17–22. [Google Scholar] [CrossRef]
  28. Umber, M.; Filloux, D.; Gélabale, S.; Gomez, R.M.; Marais, A.; Gallet, S.; Gamiette, F.; Pavis, C.; Teycheney, P.Y. Molecular viral diagnosis and sanitation of yam genetic resources: Implications for safe yam germplasm exchange. Viruses 2020, 12, 1101. [Google Scholar] [CrossRef]
  29. Fukuta, S.; Iida, T.; Mizukami, Y.; Ishida, A.; Ueda, J.; Kanbe, M.; Ishimoto, Y. Detection of Japanese Yam mosaic virus by RT-LAMP. Arch. Virol. 2003, 148, 1713–1720. [Google Scholar] [CrossRef]
  30. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  31. Aleman, M.E.; Marcos, J.F.; Brugidou, C.; Beachy, R.N.; Fauquet, C. The complete nucleotide sequence of Yam mosaic virus (Ivory Coast isolate) genomic RNA. Arch. Virol. 1996, 141, 1259–1278. [Google Scholar] [CrossRef]
  32. Adams, M.J.; Antoniw, J.F.; Fauquet, C.M. Molecular criteria for genus and species discrimination within the family Potyviridae. Arch. Virol. 2005, 150, 459–479. [Google Scholar] [CrossRef] [PubMed]
  33. Inoue-Nagata, A.K.; Jordan, R.; Kreuze, J.; Li, F.; Mäkinen, K.; Wylie, S.J. ICTV Virus Taxonomy Profile: Potyviridae 2022. J. Gen. Virol. 2022, 103, 001738. [Google Scholar] [CrossRef]
  34. Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [Green Version]
  35. Bru, D.; Martin-Laurent, F.; Philippot, L. Quantification of the detrimental effect of a single primer-template mismatch by real-time PCR using the 16S rRNA gene as an example. Appl. Environ. Microbiol. 2008, 74, 1660–1663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Stadhouders, R.; Pas, S.D.; Anber, J.; Voermans, J.; Mes, T.H.M.; Schutten, M. The effect of primer-template mismatches on the detection and quantification of nucleic acids using the 5′ nuclease assay. J. Mol. Diagn. 2010, 12, 109. [Google Scholar] [CrossRef]
  37. Daher, R.K.; Stewart, G.; Boissinot, M.; Boudreau, D.K.; Bergeron, M.G. Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology. Mol. Cell. Probes 2015, 29, 116–121. [Google Scholar] [CrossRef]
  38. Higgins, M.; Stringer, O.W.; Ward, D.; Andrews, J.M.; Forrest, M.S.; Campino, S.; Clark, T.G. Characterizing the impact of primer-template mismatches on recombinase polymerase amplification. J. Mol. Diagn. 2022, 24, 1207–1216. [Google Scholar] [CrossRef]
  39. Van Stelten, A.; Kreman, T.M.; Hall, N.; DesJardin, L.E. Optimization of a real-time RT-PCR assay reveals an increase of genogroup I norovirus in the clinical setting. J. Virol. Methods 2011, 175, 80–84. [Google Scholar] [CrossRef]
  40. Wang, M.; Li, F.; Zhou, G.; Lan, P.; Xu, D.; Li, R. Molecular detection and characterization of Chinese yam mild mosaic virus isolates. J. Phytopathol. 2015, 163, 1036–1040. [Google Scholar] [CrossRef]
  41. Mugerwa, H.; Seal, S.; Wang, H.L.; Patel, M.V.; Kabaalu, R.; Omongo, C.A.; Alicai, T.; Tairo, F.; Ndunguru, J.; Sseruwagi, P.; et al. African ancestry of New World, Bemisia tabaci-whitefly species. Sci. Rep. 2018, 8, 2734. [Google Scholar] [CrossRef] [Green Version]
  42. Wang, D. Effect of internal primer–template mismatches on loop-mediated isothermal amplification. Biotechnol. Biotechnol. Equip. 2016, 30, 314–318. [Google Scholar] [CrossRef] [Green Version]
  43. Zhou, Y.; Wan, Z.; Yang, S.; Li, Y.; Li, M.; Wang, B.; Hu, Y.; Xia, X.; Jin, X.; Yu, N.; et al. A mismatch-tolerant reverse transcription loop-mediated isothermal amplification method and its application on simultaneous detection of all four serotype of dengue viruses. Front. Microbiol. 2019, 10, 1056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Tiberini, A.; Tomlinson, J.; Micali, G.; Fontana, A.; Albanese, G.; Tomassoli, L. Development of a reverse transcription-loop- mediated isothermal amplification (LAMP) assay for the rapid detection of onion yellow dwarf virus. J. Virol. Methods 2019, 271, 113680–113687. [Google Scholar] [CrossRef] [PubMed]
  45. Ammour, M.S.; Castaldo, E.; Fedele, G.; Rossi, V. Use of LAMP for Assessing Botrytis cinerea Colonization of Bunch Trash and Latent Infection of Berries in Grapevines. Plants 2020, 9, 1538. [Google Scholar] [CrossRef]
  46. Tembo, M.; Adediji, A.O.; Bouvaine, S.; Chikoti, P.C.; Seal, S.E.; Silva, G. A quick and sensitive diagnostic tool for detection of Maize streak virus. Sci. Rep. 2020, 10, 19633. [Google Scholar] [CrossRef]
  47. Kokane, A.D.; Kokane, S.B.; Warghane, A.J.; Gubyad, M.G.; Sharma, A.K.; Reddy, M.K.; Ghosh, D.K. A rapid and sensitive reverse transcription–loop-mediated isothermal amplification (RT-LAMP) assay for the detection of indian citrus ringspot virus. Plant Dis. 2021, 105, 1346–1355. [Google Scholar] [CrossRef]
  48. Eni, A.O.; Asiedu, R.; Hughes, J.D.A.; Asiedu, R.; Rey, M.E.C. Re-evaluation of Yam mosaic virus (YMV) detection methods. Acad. J. Plant Sci. 2012, 5, 18–22. [Google Scholar]
  49. Zheng, L.; Wayper, P.J.; Gibbs, A.J.; Fourment, M.; Rodoni, B.C.; Gibbs, M.J. Accumulating variation at conserved sites in potyvirus genomes is driven by species discovery and affects degenerate primer design. PLoS ONE 2008, 3, 1586. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The detection of YMV in Dioscorea rotundata samples. (A)-The detection of YMV and actin by the reverse transcription polymerase chain reaction (RT-PCR) [22,25], M-100 bp Gene ruler DNA ladder size 100–3000 (ThermoFisher Scientific), Well 1-Gh1, 2-Gh2, 3-Gh3, 4-Gh4, 5-Gh5, 6-Nig1, + = YMV-positive control and NTC = non-template control; (B)-The detection of YMV by reverse transcription loop-mediated isothermal amplification (RT-LAMP) using primers by Nkere et al., 2018; NTC-Non-template control; +ve = YMV-positive control.
Figure 1. The detection of YMV in Dioscorea rotundata samples. (A)-The detection of YMV and actin by the reverse transcription polymerase chain reaction (RT-PCR) [22,25], M-100 bp Gene ruler DNA ladder size 100–3000 (ThermoFisher Scientific), Well 1-Gh1, 2-Gh2, 3-Gh3, 4-Gh4, 5-Gh5, 6-Nig1, + = YMV-positive control and NTC = non-template control; (B)-The detection of YMV by reverse transcription loop-mediated isothermal amplification (RT-LAMP) using primers by Nkere et al., 2018; NTC-Non-template control; +ve = YMV-positive control.
Viruses 15 01592 g001
Figure 2. Yam plant (Nig1) showing mild mottle symptoms.
Figure 2. Yam plant (Nig1) showing mild mottle symptoms.
Viruses 15 01592 g002
Figure 3. A representative figure showing a partial alignment of YMV coat protein sequences, highlighting the YMV1-OPT LAMP primers designed in this study. YMV1_OPT-F3 = Forward outer primer; YMV1_OPT-B3 = Reverse outer primer; YMV1_OPT-F1C + YMV1_OPT-F2 = Forward inner primer; YMV1_OPT-B1C + YMV1_OPT-B2 = Reverse inner primer; YMV1_OPT-LF = Forward loop primer; YMV1_OPT-LB = Reverse loop primer.
Figure 3. A representative figure showing a partial alignment of YMV coat protein sequences, highlighting the YMV1-OPT LAMP primers designed in this study. YMV1_OPT-F3 = Forward outer primer; YMV1_OPT-B3 = Reverse outer primer; YMV1_OPT-F1C + YMV1_OPT-F2 = Forward inner primer; YMV1_OPT-B1C + YMV1_OPT-B2 = Reverse inner primer; YMV1_OPT-LF = Forward loop primer; YMV1_OPT-LB = Reverse loop primer.
Viruses 15 01592 g003
Figure 4. YMV detection by RT-LAMP using YMV1-OPT primers designed in this study. Template RNAs are the same tested by RT-PCR and RT-LAMP by Nkere et al. (2018); +ve control = YMV-positive control; NTC = Non-template control.
Figure 4. YMV detection by RT-LAMP using YMV1-OPT primers designed in this study. Template RNAs are the same tested by RT-PCR and RT-LAMP by Nkere et al. (2018); +ve control = YMV-positive control; NTC = Non-template control.
Viruses 15 01592 g004
Figure 5. Sensitivity of the improved RT-LAMP and comparison with RT-PCR. (A)-YMV amplification from purified total RNA extracts by RT-LAMP using YMV1-OPT primers; Stock- Stock RNA from YMV-positive plant (100 ng/µL). The LAMP assay was conducted using the GenieIII machine (OptiGene), which allows only eight reactions in a run. (B)-YMV amplification from crude RNA extracts by RT-LAMP using YMV1-OPT primers. (C)-YMV amplification by RT-PCR from purified total RNA; M-1 kb DNA ladder, size 0.5 kb−10 kb (New England Biolabs); S-Stock RNA (100 ng/µL); - = YMV-negative control.
Figure 5. Sensitivity of the improved RT-LAMP and comparison with RT-PCR. (A)-YMV amplification from purified total RNA extracts by RT-LAMP using YMV1-OPT primers; Stock- Stock RNA from YMV-positive plant (100 ng/µL). The LAMP assay was conducted using the GenieIII machine (OptiGene), which allows only eight reactions in a run. (B)-YMV amplification from crude RNA extracts by RT-LAMP using YMV1-OPT primers. (C)-YMV amplification by RT-PCR from purified total RNA; M-1 kb DNA ladder, size 0.5 kb−10 kb (New England Biolabs); S-Stock RNA (100 ng/µL); - = YMV-negative control.
Viruses 15 01592 g005
Figure 6. A phylogenetic tree based on the partial nucleotide sequence of the coat protein region of YMV. () YMV CP sequences from D. rotundata obtained in this study; () YMV CP sequences from D. alata obtained in this study; () YMV CP sequences from D. rotundata downloaded from NCBI; () the sequence of Pepper veinal mottle virus partial CP gene used as an outgroup. The tree was generated using the neighbour-joining method in MEGA-X with 1000 bootstrap replications. Branches < 70% were collapsed. The scale bar represents the number of nucleotide substitutions per site.
Figure 6. A phylogenetic tree based on the partial nucleotide sequence of the coat protein region of YMV. () YMV CP sequences from D. rotundata obtained in this study; () YMV CP sequences from D. alata obtained in this study; () YMV CP sequences from D. rotundata downloaded from NCBI; () the sequence of Pepper veinal mottle virus partial CP gene used as an outgroup. The tree was generated using the neighbour-joining method in MEGA-X with 1000 bootstrap replications. Branches < 70% were collapsed. The scale bar represents the number of nucleotide substitutions per site.
Viruses 15 01592 g006
Table 1. Yam samples used in this study.
Table 1. Yam samples used in this study.
Sample IDCollection OriginDioscorea spp.
Ben1BeninD. rotundata
Cam1CameroonD. rotundata
Cam2CameroonD. rotundata
Cam3CameroonD. rotundata
Cam4CameroonD. rotundata
Gh1GhanaD. rotundata
Gh2GhanaD. rotundata
Gh3GhanaD. rotundata
Gh4GhanaD. rotundata
Gh5GhanaD. rotundata
Gh6GhanaD. rotundata
Gh7GhanaD. rotundata
Gh8GhanaD. rotundata
Gh9GhanaD. rotundata
Gh10GhanaD. rotundata
Gh11GhanaD. rotundata
Gh12GhanaD. rotundata
Gh13GhanaD. rotundata
Gh14GhanaD. rotundata
Gh15GhanaD. rotundata
Gh16GhanaD. rotundata
Gh17GhanaD. rotundata
Gh18GhanaD. alata
Gh19GhanaD. rotundata
Gh20GhanaD. rotundata
Gh21GhanaD. alata
Gh22GhanaD. alata
Gh23GhanaD. rotundata
Gh24GhanaD. rotundata
Gh25GhanaD. rotundata
Gh26GhanaD. rotundata
Gh27GhanaD. rotundata
Gh28GhanaD. rotundata
Gh29GhanaD. rotundata
Gh30GhanaD. rotundata
Gh31GhanaD. rotundata
Gh32GhanaD. rotundata
Gh33GhanaD. rotundata
Gh34GhanaD. rotundata
Gh35GhanaD. rotundata
Gh36GhanaD. rotundata
Gh37GhanaD. rotundata
Nig1NigeriaD. rotundata
Nig2NigeriaD. rotundata
Nig3NigeriaD. rotundata
Nig4NigeriaD. rotundata
Nig5NigeriaD. rotundata
Nig6NigeriaD. rotundata
Nig7NigeriaD. rotundata
Nig8NigeriaD. rotundata
Nig9NigeriaD. rotundata
Nig10NigeriaD. rotundata
Nig11NigeriaD. rotundata
Nig12NigeriaD. rotundata
Nig13NigeriaD. rotundata
Nig14NigeriaD. rotundata
Nig15NigeriaD. rotundata
Tog1TogoD. rotundata
Tog2TogoD. rotundata
Table 2. YMV primers used in this study.
Table 2. YMV primers used in this study.
TestPrimer NamePosition *Sequence (5’–3’)Orientation #Reference
RT-LAMPYMV1-OPT-F39120–9138ATGATGCATTTCAGTGACGFThis study
YMV1-OPT-B39307–9305TTGTTTCCAATAGCTGCTGR
YMV1-OPT-FIP (F1C + F2)F1C: 9199–9219ARTCCCTCAARTTGCGCTGAA-R
F2: 9144–9163GAAGCGTACATTGAATTGCGF
YMV1-OPT-BIP (B1C + B2)B1C: 9240–9259TTYGAYTTCTTAGARATAAC-F
B2: 9287–9304TTCATCTGATGGTGGGCYR
YMV1-OPT-LF9164–9187GGCATATACGGTTCTTTTGAGTTCR
YMV1-OPT-LB9269–9286TCCAGTTCGAGCGCGTGAF
RT-LAMPF39038–9055GACAATGATGGACGGTGCF[23]
B39228–9248GAAGTCAAACGCATATCTAGCR
FIP (F1C + F2)F1C: 9109–9134ACTGAAATGCATCATTATCTGAC
GAA-
R
F2: 9059–9076GCAAGTGGAATACCCATTF
BIP (B1C + B2)B1C: 9144–9171GAAGCATACATTGAATTGCGGAA
CTCAA-
F
B2: 9206–9244TGAGTAATCCCTCAAGTTGR
LF9079–9103GGTTTGGCATTTTCTATGATCGGTTR
LB9186–9205CCCCGATACGGTATTCAGCGF
RT-PCRYMV-CP 1F9026–9045ATCCGGGATGTGGACAATGAF[26]
YMV-UTR 1R9590–9608TGGTCCTCCGCCACATCAAAR
F3 and B3—Forward and reverse outer primers, respectively; FIP and BIP—Forward and reverse internal primer, respectively; LF and LB—Forward and reverse Loop primers, respectively. * Alignment position of primers with the reference YMV complete genome sequence (GenBank ref ID. NC_004752.1). # F and R—Forward and reverse orientation, respectively.
Table 3. YMV isolates used for phylogenetic studies.
Table 3. YMV isolates used for phylogenetic studies.
Group*IsolateSample OriginDioscorea spp.Accession NumberReference
IBFC 56Burkina FasoD. cayenensis-rotundataAJ244052[24]
C1/C3Burkina FasoD. cayenensis-rotundataAJ244053[24]
BFC 51/C11Burkina FasoD. cayenensis-rotundataAJ244050[24]
BFC 54Burkina FasoD. cayenensis-rotundataAJ244051[24]
IICKA1/C11Ivory CoastD. cayenensis-rotundataAJ244059[24]
CID3/C12Ivory CoastD. cayenensis-rotundataAJ244058[24]
POGNON/C1Guadeloupe islandD. cayenensis-rotundataAJ244064[24]
U42596Ivory CoastD. cayenensis-rotundataNC004752[31]
IIICAM1/C1BeninD. cayenensis-rotundataAJ244054[24]
B1/c1BeninD. cayenensis-rotundataAJ244048[24]
CBE6b/C3BeninD. cayenensis-rotundataAJ244056[24]
B14CameroonD. cayenensis-rotundataAJ244049[24]
Ben1BeninD. rotundataOR004217This study
Cam4BeninD. rotundataOR004218This study
Gh2GhanaD. rotundataOQ677012This study
Gh3GhanaD. rotundataOQ677013This study
Gh15GhanaD. rotundataOQ677004This study
Gh17GhanaD. rotundataOQ677006This study
Gh18GhanaD. alataOQ677007This study
Gh19GhanaD. rotundataOQ677008This study
Gh20GhanaD. rotundataOQ677009This study
Gh23GhanaD. rotundataOQ677011This study
Gh27GhanaD. rotundataOR004219This study
Gh29GhanaD. rotundataOR004229This study
Gh30GhanaD. rotundataOR004220This study
Gh32GhanaD. rotundataOR004223This study
Gh33GhanaD. rotundataOR004225This study
Gh35GhanaD. rotundataOR004222This study
Gh36GhanaD. rotundataOR004224This study
Nig3NigeriaD. rotundataOR004228This study
Nig4NigeriaD. rotundataOR004221This study
Nig6NigeriaD. rotundataOR004226This study
Tog2TogoD. rotundataOR004227This study
IVSOA Ai/C1Burkina FasoD. alataAJ244065[24]
SOA2/C2Burkina FasoD. alataAJ244066[24]
CAM2/C31CameroonD. cayenensis-rotundataAJ244055[24]
174/C1BeninD. cayenensis-rotundataAJ244046[24]
VG5/C10French GuianaD. trifidaAJ244062[24]
G13/C1French GuianaD. trifidaAJ244061[24]
GY/INRA/C11French GuianaD. trifidaAJ244045[24]
VICGU1/C18Guadeloupe islandD. cayenensis-rotundataAJ244057[24]
GR/SAVANE/C4Guadeloupe islandD. cayenensis-rotundataAJ244063[24]
VICGU2/C4Guadeloupe islandD. cayenensis-rotundataAJ244044[24]
AID 10/5Puerto RicoD. alataAJ244043[24]
VII608NigeriaD. cayenensis-rotundataAJ244047[24]
VIIIDIVINGuadeloupe IslandD. cayenensis-rotundataAJ244060[24]
IXCAM2CameroonD. cayenensis-rotundataAJ244042[24]
XYMV_DR2BrazilD. cayenensis-rotundataOK239701[9]
YMV_DR1BrazilD. cayenensis-rotundataOK239701[9]
YMV_I4BrazilD. cayenensis-rotundataOL739290[9]
XINig2NigeriaD. rotundataOR004232This study
XIITog1TogoD. rotundataOR004230This study
XIIICam3CameroonD. rotundataOR004231This study
XIVGh21GhanaD. alataOQ677010This study
Cam2CameroonD. rotundataOR004209This study
Gh5GhanaD. rotundataOQ677014This study
Gh28GhanaD. rotundataOR004210This study
Gh34GhanaD. rotundataOR004211This study
Nig1NigeriaD. rotundataOQ677015This study
Nig5NigeriaD. rotundataOR004213This study
Nig10NigeriaD. rotundataOR004212This study
Nig11NigeriaD. rotundataOR004215This study
Nig12NigeriaD. rotundataOR004216This study
Nig13NigeriaD. rotundataOR004214This study
Nig14NigeriaD. rotundataOQ677016This study
YMV-NGNigeriaD. rotundataMG711313[9]
Group*-YMV phylogenetic group following classification by Bousalem et al. [24], Mendoza et al. [9] and this study.
Table 4. The detection of YMV from Dioscorea alata samples by RT-PCR and RT-LAMP assays.
Table 4. The detection of YMV from Dioscorea alata samples by RT-PCR and RT-LAMP assays.
Sample IDRT-PCRRT-LAMP
YMMVYMVYMV
DA Nig1+++
DA Nig2+
DA Nig3
DA Tog2+
DA Tog3+
VU709+
VU711+
VU715
VU717+
VU724+
VU740
VU746+
CTRT127++
CTRT268+
YMV-positive control++
Non-template control
Table 5. The detection of YMV in leaves of Dioscorea rotundata and D. alata via reverse transcription loop-mediated isothermal amplification (RT-LAMP) and reverse transcription polymerase chain reaction (RT-PCR).
Table 5. The detection of YMV in leaves of Dioscorea rotundata and D. alata via reverse transcription loop-mediated isothermal amplification (RT-LAMP) and reverse transcription polymerase chain reaction (RT-PCR).
S/NSample IDDioscorea spp.RT-PCRImproved RT-LAMP
YMV StatusTime (min:sec)
1Gh6D. rotundata
2Gh7D. rotundata
3Gh8D. rotundata
4Gh9D. rotundata
5Gh10D. rotundata
6Gh11D. rotundata
7Gh12D. rotundata
8Gh13D. rotundata
9Gh14D. rotundata
10Gh15D. rotundata++13:56
11Gh16D. rotundata++11:05
12Gh17D. rotundata++09:53
13Gh18D. alata++18:16
14Gh19D. rotundata++11:57
15Gh20D. rotundata++10:41
16Gh21D. alata++14:14
17Gh22D. alata++11:35
18Gh23D. rotundata++25:02
19Gh24D. rotundata
20Gh25D. rotundata
21Gh26D. rotundata
22Gh27D. rotundata++08:30
23Gh28D. rotundata++10:00
24Gh29D. rotundata++11:15
25Gh30D. rotundata++09:15
26Gh31D. rotundata++20:00
27Gh32D. rotundata++08:30
28Gh33D. rotundata++09:00
29Gh34D. rotundata++10:15
30Gh35D. rotundata++09:30
31Gh36D. rotundata++10:00
32Gh37D. rotundata
33Nig2D. rotundata++08:15
34Nig3D. rotundata++10:00
35Nig4D. rotundata++ 25:45
36Nig5D. rotundata++08:00
37Nig6D. rotundata++10:45
38Nig7D. rotundata
39Nig8D. rotundata
40Nig9D. rotundata
41Nig10D. rotundata++10:00
42Nig11D. rotundata++13:00
43Nig12D. rotundata++09:45
44Nig13D. rotundata++09:30
45Nig14D. rotundata++10:05
46Nig15D. rotundata
47Ben1D. rotundata++08:00
48Tog1D. rotundata++07:15
49Tog2D. rotundata++10:45
50Cam1D. rotundata++08:00
51Cam2D. rotundata++07:30
52Cam3D. rotundata++12:30
53Cam4D. rotundata++09:45
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Festus, R.O.; Seal, S.E.; Prempeh, R.; Quain, M.D.; Silva, G. Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus. Viruses 2023, 15, 1592. https://doi.org/10.3390/v15071592

AMA Style

Festus RO, Seal SE, Prempeh R, Quain MD, Silva G. Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus. Viruses. 2023; 15(7):1592. https://doi.org/10.3390/v15071592

Chicago/Turabian Style

Festus, Ruth O., Susan E. Seal, Ruth Prempeh, Marian D. Quain, and Gonçalo Silva. 2023. "Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus" Viruses 15, no. 7: 1592. https://doi.org/10.3390/v15071592

APA Style

Festus, R. O., Seal, S. E., Prempeh, R., Quain, M. D., & Silva, G. (2023). Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus. Viruses, 15(7), 1592. https://doi.org/10.3390/v15071592

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop