Long Term Norovirus Infection in a Patient with Severe Common Variable Immunodeficiency
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Description
2.2. Blocking of Human GII.4 VLPs Binding to Pig Gastric Mucin
2.3. RNA Extraction from Stool and Reverse Transcription
2.4. Sequencing of the Shell Region (for Genotyping) and the Entire VP1 Gene
2.5. Sequencing of the RdRp Gene
2.6. Nucleotide Accession Numbers
2.7. Data Preparation, Alignment, and Phylogenetics
2.8. Analysis of the Protein Sequences of Immunodominant Epitopes and HBGA Binding Pockets of the VP1 Gene
2.9. Analysis of the Protein Sequences of the RdRp Gene
3. Results
3.1. The Patient Had Protective Blocking Titers in Serum
3.2. The VP1 and RdRp Genes Form Unique Subgroups in the GII.4 Den Haag 2006b Variant Cluster
3.3. Distinct Amino Acid Differences Were Found in Epitopes A, C, and D whereas HBGA Binding Epitopes Were Conserved
3.4. Ribavirin Treatment Failed to Clear the Norovirus Infection
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ahmed, S.M.; Hall, A.J.; Robinson, A.E.; Verhoef, L.; Premkumar, P.; Parashar, U.D.; Koopmans, M.; Lopman, B.A. Global prevalence of norovirus in cases of gastroenteritis: A systematic review and meta-analysis. Lancet Infect. Dis. 2014, 14, 725–730. [Google Scholar] [CrossRef] [Green Version]
- Chhabra, P.; de Graaf, M.; Parra, G.I.; Chan, M.C.; Green, K.; Martella, V.; Wang, Q.; White, P.A.; Katayama, K.; Vennema, H.; et al. Updated classification of norovirus genogroups and genotypes. J. Gen. Virol. 2019, 100, 1393–1406. [Google Scholar] [CrossRef]
- Huhti, L.; Szakal, E.D.; Puustinen, L.; Salminen, M.; Huhtala, H.; Valve, O.; Blazevic, V.; Vesikari, T. Norovirus GII-4 causes a more severe gastroenteritis than other noroviruses in young children. J. Infect. Dis. 2011, 203, 1442–1444. [Google Scholar] [CrossRef] [Green Version]
- Hoa Tran, T.N.; Trainor, E.; Nakagomi, T.; Cunliffe, N.A.; Nakagomi, O. Molecular epidemiology of noroviruses associated with acute sporadic gastroenteritis in children: Global distribution of genogroups, genotypes and GII.4 variants. J. Clin. Virol. 2013, 56, 185–193. [Google Scholar] [CrossRef] [Green Version]
- Bucardo, F.; Reyes, Y.; Becker-Dreps, S.; Bowman, N.; Gruber, J.F.; Vinje, J.; Espinoza, F.; Paniagua, M.; Balmaseda, A.; Svensson, L.; et al. Pediatric norovirus GII.4 infections in Nicaragua, 1999–2015. Infect. Genet. Evol. 2017, 55, 305–312. [Google Scholar] [CrossRef] [Green Version]
- Reyes, Y.; Gonzalez, F.; Gutierrez, L.; Blandon, P.; Centeno, E.; Zepeda, O.; Toval-Ruiz, C.; Lindesmith, L.C.; Baric, R.S.; Vielot, N.; et al. Secretor status strongly influences the incidence of symptomatic norovirus infection in a genotype-dependent manner in a Nicaraguan birth cohort. J. Infect. Dis. 2021, 225, 105–115. [Google Scholar] [CrossRef]
- Tohma, K.; Lepore, C.J.; Gao, Y.; Ford-Siltz, L.A.; Parra, G.I. Population Genomics of GII.4 Noroviruses Reveal Complex Diversification and New Antigenic Sites Involved in the Emergence of Pandemic Strains. mBio 2019, 10, e02202-19. [Google Scholar] [CrossRef] [Green Version]
- Mallory, M.L.; Lindesmith, L.C.; Graham, R.L.; Baric, R.S. GII.4 Human Norovirus: Surveying the Antigenic Landscape. Viruses 2019, 11, 177. [Google Scholar] [CrossRef] [Green Version]
- Parra, G.I.; Abente, E.J.; Sandoval-Jaime, C.; Sosnovtsev, S.V.; Bok, K.; Green, K.Y. Multiple antigenic sites are involved in blocking the interaction of GII.4 norovirus capsid with ABH histo-blood group antigens. J. Virol. 2012, 86, 7414–7426. [Google Scholar] [CrossRef] [Green Version]
- Lindesmith, L.C.; Beltramello, M.; Donaldson, E.F.; Corti, D.; Swanstrom, J.; Debbink, K.; Lanzavecchia, A.; Baric, R.S. Immunogenetic mechanisms driving norovirus GII.4 antigenic variation. PLoS Pathog. 2012, 8, e1002705. [Google Scholar] [CrossRef] [Green Version]
- Debbink, K.; Lindesmith, L.C.; Donaldson, E.F.; Baric, R.S. Norovirus immunity and the great escape. PLoS Pathog. 2012, 8, e1002921. [Google Scholar] [CrossRef] [Green Version]
- Lindesmith, L.C.; Mallory, M.L.; Debbink, K.; Donaldson, E.F.; Brewer-Jensen, P.D.; Swann, E.W.; Sheahan, T.P.; Graham, R.L.; Beltramello, M.; Corti, D.; et al. Conformational Occlusion of Blockade Antibody Epitopes, a Novel Mechanism of GII.4 Human Norovirus Immune Evasion. mSphere 2018, 3, e00518-17. [Google Scholar] [CrossRef] [Green Version]
- van Loben Sels, J.M.; Green, K.Y. The Antigenic Topology of Norovirus as Defined by B and T Cell Epitope Mapping: Implications for Universal Vaccines and Therapeutics. Viruses 2019, 11, 432. [Google Scholar] [CrossRef] [Green Version]
- Allen, D.J.; Gray, J.J.; Gallimore, C.I.; Xerry, J.; Iturriza-Gomara, M. Analysis of amino acid variation in the P2 domain of the GII-4 norovirus VP1 protein reveals putative variant-specific epitopes. PLoS ONE 2008, 3, e1485. [Google Scholar] [CrossRef]
- Steyer, A.; Konte, T.; Sagadin, M.; Kolenc, M.; Skoberne, A.; Germ, J.; Dovc-Drnovsek, T.; Arnol, M.; Poljsak-Prijatelj, M. Intrahost Norovirus Evolution in Chronic Infection Over 5 Years of Shedding in a Kidney Transplant Recipient. Front. Microbiol. 2018, 9, 371. [Google Scholar] [CrossRef]
- Shanker, S.; Choi, J.M.; Sankaran, B.; Atmar, R.L.; Estes, M.K.; Prasad, B.V. Structural analysis of histo-blood group antigen binding specificity in a norovirus GII.4 epidemic variant: Implications for epochal evolution. J. Virol. 2011, 85, 8635–8645. [Google Scholar] [CrossRef] [Green Version]
- Singh, B.K.; Leuthold, M.M.; Hansman, G.S. Human noroviruses’ fondness for histo-blood group antigens. J. Virol. 2015, 89, 2024–2040. [Google Scholar] [CrossRef] [Green Version]
- Nordgren, J.; Svensson, L. Genetic Susceptibility to Human Norovirus Infection: An Update. Viruses 2019, 11, 226. [Google Scholar] [CrossRef] [Green Version]
- Croci, R.; Pezzullo, M.; Tarantino, D.; Milani, M.; Tsay, S.C.; Sureshbabu, R.; Tsai, Y.J.; Mastrangelo, E.; Rohayem, J.; Bolognesi, M.; et al. Structural bases of norovirus RNA dependent RNA polymerase inhibition by novel suramin-related compounds. PLoS ONE 2014, 9, e91765. [Google Scholar] [CrossRef]
- Chang, K.O.; George, D.W. Interferons and ribavirin effectively inhibit Norwalk virus replication in replicon-bearing cells. J. Virol. 2007, 81, 12111–12118. [Google Scholar] [CrossRef] [Green Version]
- Alam, I.; Lee, J.H.; Cho, K.J.; Han, K.R.; Yang, J.M.; Chung, M.S.; Kim, K.H. Crystal structures of murine norovirus-1 RNA-dependent RNA polymerase in complex with 2-thiouridine or ribavirin. Virology 2012, 426, 143–151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woodward, J.M.; Gkrania-Klotsas, E.; Cordero-Ng, A.Y.; Aravinthan, A.; Bandoh, B.N.; Liu, H.; Davies, S.; Zhang, H.; Stevenson, P.; Curran, M.D.; et al. The role of chronic norovirus infection in the enteropathy associated with common variable immunodeficiency. Am. J. Gastroenterol. 2015, 110, 320–327. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; Malik, Y.S.; Kobayashi, N. Therapeutics and Immunoprophylaxis Against Noroviruses and Rotaviruses: The Past, Present, and Future. Curr. Drug Metab. 2018, 19, 170–191. [Google Scholar] [CrossRef] [PubMed]
- van Kampen, J.J.A.; Dalm, V.; Fraaij, P.L.A.; Oude Munnink, B.B.; Schapendonk, C.M.E.; Izquierdo-Lara, R.W.; Villabruna, N.; Ettayebi, K.; Estes, M.K.; Koopmans, M.P.G.; et al. Clinical and in-vitro evidence favoring immunoglobulin treatment of a chronic norovirus infection in a patient with common variable immunodeficiency. J. Infect. Dis. 2022. [Google Scholar] [CrossRef] [PubMed]
- Deval, J.; Jin, Z.; Chuang, Y.C.; Kao, C.C. Structure(s), function(s), and inhibition of the RNA-dependent RNA polymerase of noroviruses. Virus Res. 2017, 234, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Gustavsson, L.; Norden, R.; Westin, J.; Lindh, M.; Andersson, L.M. Slow Clearance of Norovirus following Infection with Emerging Variants of Genotype GII.4 Strains. J. Clin. Microbiol. 2017, 55, 1533–1539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woodward, J.; Gkrania-Klotsas, E.; Kumararatne, D. Chronic norovirus infection and common variable immunodeficiency. Clin. Exp. Immunol. 2017, 188, 363–370. [Google Scholar] [CrossRef] [Green Version]
- Carlsson, B.; Lindberg, A.M.; Rodriguez-Diaz, J.; Hedlund, K.O.; Persson, B.; Svensson, L. Quasispecies dynamics and molecular evolution of human norovirus capsid P region during chronic infection. J. Gen. Virol. 2009, 90 Pt 2, 432–441. [Google Scholar] [CrossRef]
- Echenique, I.A.; Stosor, V.; Gallon, L.; Kaufman, D.; Qi, C.; Zembower, T.R. Prolonged norovirus infection after pancreas transplantation: A case report and review of chronic norovirus. Transpl. Infect. Dis. 2016, 18, 98–104. [Google Scholar] [CrossRef]
- Jones, T.P.W.; Buckland, M.; Breuer, J.; Lowe, D.M. Viral infection in primary antibody deficiency syndromes. Rev. Med. Virol. 2019, 29, e2049. [Google Scholar] [CrossRef]
- Park, M.A.; Li, J.T.; Hagan, J.B.; Maddox, D.E.; Abraham, R.S. Common variable immunodeficiency: A new look at an old disease. Lancet 2008, 372, 489–502. [Google Scholar] [CrossRef]
- Malamut, G.; Verkarre, V.; Suarez, F.; Viallard, J.F.; Lascaux, A.S.; Cosnes, J.; Bouhnik, Y.; Lambotte, O.; Bechade, D.; Ziol, M.; et al. The enteropathy associated with common variable immunodeficiency: The delineated frontiers with celiac disease. Am. J. Gastroenterol. 2010, 105, 2262–2275. [Google Scholar] [CrossRef]
- Debbink, K.; Lindesmith, L.C.; Ferris, M.T.; Swanstrom, J.; Beltramello, M.; Corti, D.; Lanzavecchia, A.; Baric, R.S. Within-host evolution results in antigenically distinct GII.4 noroviruses. J. Virol. 2014, 88, 7244–7255. [Google Scholar] [CrossRef] [Green Version]
- Yu, J.M.; Liang, Z.Y.; Guo, K.; Sun, X.M.; Zhang, Q.; Dong, Y.J.; Duan, Z.J. Intra-Host Evolution of Norovirus GII.4 in a Chronic Infected Patient with Hematopoietic Stem Cell Transplantation. Front. Microbiol. 2020, 11, 375. [Google Scholar] [CrossRef] [Green Version]
- Morris, J.; Morris, C. Nitazoxanide is effective therapy for norovirus gastroenteritis after chemotherapy and hematopoietic stem cell transplantation (HSCT). Biol. Blood Marrow Transplant. 2015, 21, S255–S256. [Google Scholar] [CrossRef] [Green Version]
- Sharma, S.; Hagbom, M.; Carlsson, B.; Nederby Ohd, J.; Insulander, M.; Eriksson, R.; Simonsson, M.; Widerstrom, M.; Nordgren, J. Secretor Status is Associated with Susceptibility to Disease in a Large GII.6 Norovirus Foodborne Outbreak. Food Environ. Virol. 2019, 12, 28–34. [Google Scholar] [CrossRef] [Green Version]
- Sharma, S.; Carlsson, B.; Czako, R.; Vene, S.; Haglund, M.; Ludvigsson, J.; Larson, G.; Hammarstrom, L.; Sosnovtsev, S.V.; Atmar, R.L.; et al. Human Sera Collected between 1979 and 2010 Possess Blocking-Antibody Titers to Pandemic GII.4 Noroviruses Isolated over Three Decades. J. Virol. 2017, 91, e00567-17. [Google Scholar] [CrossRef] [Green Version]
- Atmar, R.L.; Bernstein, D.I.; Lyon, G.M.; Treanor, J.J.; Al-Ibrahim, M.S.; Graham, D.Y.; Vinje, J.; Jiang, X.; Gregoricus, N.; Frenck, R.W.; et al. Serological Correlates of Protection against a GII.4 Norovirus. Clin. Vaccine Immunol. 2015, 22, 923–929. [Google Scholar] [CrossRef] [Green Version]
- Cotten, M.; Petrova, V.; Phan, M.V.; Rabaa, M.A.; Watson, S.J.; Ong, S.H.; Kellam, P.; Baker, S. Deep sequencing of norovirus genomes defines evolutionary patterns in an urban tropical setting. J. Virol. 2014, 88, 11056–11069. [Google Scholar] [CrossRef] [Green Version]
- Nordgren, J.; Kindberg, E.; Lindgren, P.E.; Matussek, A.; Svensson, L. Norovirus gastroenteritis outbreak with a secretor-independent susceptibility pattern, Sweden. Emerg. Infect. Dis. 2010, 16, 81–87. [Google Scholar] [CrossRef]
- Brown, L.K.; Clark, I.; Brown, J.R.; Breuer, J.; Lowe, D.M. Norovirus infection in primary immune deficiency. Rev. Med. Virol. 2017, 27, e1926. [Google Scholar] [CrossRef] [Green Version]
- Karst, S.M.; Baric, R.S. What is the reservoir of emergent human norovirus strains? J. Virol. 2015, 89, 5756–5759. [Google Scholar] [CrossRef] [Green Version]
- Karst, S.M.; Tibbetts, S.A. Recent advances in understanding norovirus pathogenesis. J. Med. Virol. 2016, 88, 1837–1843. [Google Scholar] [CrossRef] [Green Version]
- Pikkarainen, S.; Martelius, T.; Ristimaki, A.; Siitonen, S.; Seppanen, M.R.J.; Farkkila, M. A High Prevalence of Gastrointestinal Manifestations in Common Variable Immunodeficiency. Am. J. Gastroenterol. 2019, 114, 648–655. [Google Scholar] [CrossRef] [Green Version]
- Rolfes, M.C.; Sriaroon, P.; Davila Saldana, B.J.; Dvorak, C.C.; Chapdelaine, H.; Ferdman, R.M.; Chen, K.; Jolles, S.; Patel, N.C.; Kim, Y.J.; et al. Chronic norovirus infection in primary immune deficiency disorders: An international case series. Diagn. Microbiol. Infect. Dis. 2019, 93, 69–73. [Google Scholar] [CrossRef]
- Brown, J.R.; Gilmour, K.; Breuer, J. Norovirus Infections Occur in B-Cell-Deficient Patients. Clin. Infect. Dis. 2016, 62, 1136–1138. [Google Scholar] [CrossRef] [Green Version]
- Schorn, R.; Hohne, M.; Meerbach, A.; Bossart, W.; Wuthrich, R.P.; Schreier, E.; Muller, N.J.; Fehr, T. Chronic norovirus infection after kidney transplantation: Molecular evidence for immune-driven viral evolution. Clin. Infect. Dis. 2010, 51, 307–314. [Google Scholar] [CrossRef] [PubMed]
- Bull, R.A.; Eden, J.S.; Luciani, F.; McElroy, K.; Rawlinson, W.D.; White, P.A. Contribution of intra- and interhost dynamics to norovirus evolution. J. Virol. 2012, 86, 3219–3229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garaicoechea, L.; Aguilar, A.; Parra, G.I.; Bok, M.; Sosnovtsev, S.V.; Canziani, G.; Green, K.Y.; Bok, K.; Parreno, V. Llama nanoantibodies with therapeutic potential against human norovirus diarrhea. PLoS ONE 2015, 10, e0133665. [Google Scholar] [CrossRef] [PubMed]
- Allen, D.J.; Noad, R.; Samuel, D.; Gray, J.J.; Roy, P.; Iturriza-Gomara, M. Characterisation of a GII-4 norovirus variant-specific surface-exposed site involved in antibody binding. Virol. J. 2009, 6, 150. [Google Scholar] [CrossRef] [Green Version]
- Debbink, K.; Donaldson, E.F.; Lindesmith, L.C.; Baric, R.S. Genetic mapping of a highly variable norovirus GII.4 blockade epitope: Potential role in escape from human herd immunity. J. Virol. 2012, 86, 1214–1226. [Google Scholar] [CrossRef] [Green Version]
- Eden, J.S.; Chisholm, R.H.; Bull, R.A.; White, P.A.; Holmes, E.C.; Tanaka, M.M. Persistent infections in immunocompromised hosts are rarely sources of new pathogen variants. Virus Evol. 2017, 3, vex018. [Google Scholar] [CrossRef] [Green Version]
- Doerflinger, S.Y.; Weichert, S.; Koromyslova, A.; Chan, M.; Schwerk, C.; Adam, R.; Jennewein, S.; Hansman, G.S.; Schroten, H. Human Norovirus Evolution in a Chronically Infected Host. mSphere 2017, 2, e00352-16. [Google Scholar] [CrossRef] [Green Version]
- Lythgoe, K.A.; Gardner, A.; Pybus, O.G.; Grove, J. Short-Sighted Virus Evolution and a Germline Hypothesis for Chronic Viral Infections. Trends Microbiol. 2017, 25, 336–348. [Google Scholar] [CrossRef] [Green Version]
- Davis, A.; Cortez, V.; Grodzki, M.; Dallas, R.; Ferrolino, J.; Freiden, P.; Maron, G.; Hakim, H.; Hayden, R.T.; Tang, L.; et al. Infectious Norovirus Is Chronically Shed by Immunocompromised Pediatric Hosts. Viruses 2020, 12, 619. [Google Scholar] [CrossRef]
- Weichert, S.; Koromyslova, A.; Singh, B.K.; Hansman, S.; Jennewein, S.; Schroten, H.; Hansman, G.S. Structural Basis for Norovirus Inhibition by Human Milk Oligosaccharides. J. Virol. 2016, 90, 4843–4848. [Google Scholar] [CrossRef] [Green Version]
Date of Sample Collection | Week Since Initiated Ribavirin Treatment | Ribavirin Concentration (ng/mL) | ID-Code of Faecal Sample | Sequenced Genes |
---|---|---|---|---|
2013/08/27 | −81 | 5 | VP1 and RdRp | |
2015/03/18 | 0 | start ribavirin | 1 | VP1 and RdRp |
2015/03/25 | 1 | 732 | NA | none |
2015/04/01 | 2 | 707 | 9 | VP1 and RdRp |
2015/04/07 | 3 | 634 | 10 | none |
2015/04/15 | 4 | 561 | 11 | none |
2015/04/22 | 5 | 756 | 12 | none |
2015/04/28 | 6 | 902 | 13 | VP1 and RdRp |
2015/05/05 | 7 | 951 | 14 | none |
2015/05/13 | 8 | 2073 | 30 | none |
2015/05/20 | 9 | no sample collected | 31 | none |
- | 10 | no sample collected | no sample collected | none |
- | 11 | no sample collected | no sample collected | none |
2015/06/10 | 12 | 1220 | 16 | none |
2015/06/17 | 13 | 756 | 18 | VP1 and RdRp |
2015/06/24 | 14 | 951 | 20 | none |
2015/07/01 | 15 | 829 | 22 | VP1 and RdRp |
2015/07/08 | 16 | 853 | 24 | none |
2015/07/15 | 17 | 683 | 25 | VP1 and RdRp |
2015/07/22 | 18 | 780 | NA | none |
2015/07/29 | 19 | 1073 | NA | none |
2015/08/05 | 20 | 1195 | 28 | none |
2015/08/12 | 21 | 1171 | 29 | none |
2015/08/19 | 22 | 976 | 15 | RdRp |
2015/08/26 | 23 | 805 | 17 | VP1 and RdRp |
2015/09/02 | 24 | 854 | no sample collected | none |
- | 25 | no sample collected | no sample collected | none |
- | 26 | no sample collected | no sample collected | none |
2015/09/23 | 27 | no sample collected | 19 | none |
- | 28 | no sample collected | no sample collected | none |
2015/10/06 | 29 | 1317 | no sample collected | none |
2015/10/15 | 30 | 878 | 21 | RdRp |
2015/10/21 | 31 | 854 | 23 | none |
2015/10/28 | 32 | 1171 | 26 | none |
2015/11/04 | 33 | End ribavirin | 27 | RdRp |
2016/03/07 | 51 | 34 | VP1 and RdRp | |
2016/04/01 | 54 | 32 | none | |
2016/05/14 | 60 | 35 | VP1 |
Primer | Used in | Sequence (5′ -> 3′) | Tm (°C) | Position | References |
---|---|---|---|---|---|
VP1_F1 | PCR 1 + Sequencing | CAAGAGCCAATGTTCAGATGG | 52 | 4982–5003 | [38] |
VP1_F2 | PCR 2a + Sequencing | GAGTGACGCCAACCCATCTAA | 60 | 5067–5088 | This study |
VP1_F3 | PCR 2b + Sequencing | CCACCCACAGTTGAGTCAAGA | 60 | 5717–5738 | This study |
VP1_R1 | PCR 1 + Sequencing | GACATCAGATGCCAATCCAG | 52 | 6726–6746 | This study |
VP1_R2 | PCR 2a + Sequencing | TGACTCAACTGTGGGTGGCA | 60 | 5755–5795 | This study |
VP1_R3 | PCR 2b + Sequencing | ATAAAGCACGTCTACGCCCC | 60 | 6710–6730 | This study |
VP1_F4 | Sequencing | CACCACTTAGGGCYAAYAATGCTGG | 52 | 5635–5659 | [39] |
VP1_F5 | Sequencing | GATGTCACCCACATTGCAGGTTCTCG | 52 | 5949–5974 | [39] |
VP1_R4 | Sequencing | CCAGCATTRTTRGCCCTAAGTGGTG | 52 | 5635–5659 | [39] |
VP1_R5 | Sequencing | CGAGAACCTGCAATGTGGGTGACATC | 52 | 5949–5974 | [39] |
Primer | Used in | Sequence (5′ -> 3′) | Tm (°C) | Position | References |
---|---|---|---|---|---|
RDRP_F1 | PCR and sequencing | TGYCCCTAYATCTACAAGAG | 52 | 3449–3468 | This study |
RDRP_F2 | PCR and sequencing | ACACAGCTGCACTYAAGGAT | 52 | 4054–4073 | This study |
RDRP_F3 | PCR and sequencing | AAGCTCAAGGAGTATGGGTTG | 52 | 4652–4672 | This study |
RDRP_F4 | PCR and sequencing | TGGCAGCTGCTCTAGAAATCATG | 52 | 4335–4357 | This study |
UNP_135 | PCR and sequencing | GACCTCTGGGACGAGGTTG | 52 | 5132–5150 | [36] |
RDRP_R2 | Sequencing | TCTGATCCAATTTTCCAAAC | 52 | 4777–4796 | This study |
RDRP_R3 | PCR and sequencing | CAGTGTGCTTTGAGTTCATC | 52 | 4181–4200 | This study |
RDRP_R4 | PCR and sequencing | GGAAGACCCTCGTTGATTG | 52 | 4449–4467 | This study |
RDRP_R5 | PCR and sequencing | GTTGGTTTCAACCCATACTC | 52 | 4661–4680 | This study |
RDRP_R6 | PCR and sequencing | CAGTTCTCCGCAGGAAAGTC | 52 | 4735–4754 | This study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ottosson, L.; Hagbom, M.; Svernlöv, R.; Nyström, S.; Carlsson, B.; Öman, M.; Ström, M.; Svensson, L.; Nilsdotter-Augustinsson, Å.; Nordgren, J. Long Term Norovirus Infection in a Patient with Severe Common Variable Immunodeficiency. Viruses 2022, 14, 1708. https://doi.org/10.3390/v14081708
Ottosson L, Hagbom M, Svernlöv R, Nyström S, Carlsson B, Öman M, Ström M, Svensson L, Nilsdotter-Augustinsson Å, Nordgren J. Long Term Norovirus Infection in a Patient with Severe Common Variable Immunodeficiency. Viruses. 2022; 14(8):1708. https://doi.org/10.3390/v14081708
Chicago/Turabian StyleOttosson, Loa, Marie Hagbom, Rikard Svernlöv, Sofia Nyström, Beatrice Carlsson, Mattias Öman, Magnus Ström, Lennart Svensson, Åsa Nilsdotter-Augustinsson, and Johan Nordgren. 2022. "Long Term Norovirus Infection in a Patient with Severe Common Variable Immunodeficiency" Viruses 14, no. 8: 1708. https://doi.org/10.3390/v14081708