A Reverse Transcription Recombinase-Aided Amplification Method for Rapid and Point-of-Care Detection of SARS-CoV-2, including Variants
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Equipment
2.2. Clinical Specimen Collection
2.3. RNA Extraction
2.4. Primer and Probe Design and Coverage Determination
2.5. RT-qPCR Assay
2.6. RT-RAA Assay
2.7. Specificity Evaluation of RT-RAA Assay
2.8. Clinical Specimen Identification
3. Results
3.1. Primer Screening
3.2. Evaluation of the Specificity of the RAA System
3.3. Analytical Sensitivity
3.4. Clinical Specimen Detection
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Desimmie, B.A.; Raru, Y.Y.; Awadh, H.M.; He, P.; Teka, S.; Willenburg, K.S. Insights into SARS-CoV-2 Persistence and Its Relevance. Viruses 2021, 13, 1025. [Google Scholar] [CrossRef] [PubMed]
- WHO Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 1 September 2021).
- Carter, L.J.; Garner, L.V.; Smoot, J.W.; Li, Y.; Zhou, Q.; Saveson, C.J.; Sasso, J.M.; Gregg, A.C.; Soares, D.J.; Beskid, T.R.; et al. Assay Techniques and Test Development for COVID-19 Diagnosis. ACS Cent. Sci. 2020, 6, 591–605. [Google Scholar] [CrossRef] [PubMed]
- Martin, M.A.; VanInsberghe, D.; Koelle, K. Insights from SARS-CoV-2 sequences. Science 2021, 371, 466–467. [Google Scholar] [CrossRef]
- Lazarevic, I.; Pravica, V.; Miljanovic, D.; Cupic, M. Immune Evasion of SARS-CoV-2 Emerging Variants: What Have We Learnt So Far? Viruses 2021, 13, 1192. [Google Scholar] [CrossRef]
- Edara, V.V.; Norwood, C.; Floyd, K.; Lai, L.; Davis-Gardner, M.E.; Hudson, W.H.; Mantus, G.; Nyhoff, L.E.; Adelman, M.W.; Fineman, R.; et al. Reduced binding and neutralization of infection- and vaccine-induced antibodies to the B.1.351 (South African) SARS-CoV-2 variant. BioRxiv 2021. [Google Scholar] [CrossRef]
- Wang, P.F.; Casner, R.G.; Nair, M.S.; Wang, M.; Yu, J.; Cerutti, G.; Liu, L.H.; Kwong, P.D.; Huang, Y.X.; Shapiro, L.; et al. Increased resistance of SARS-CoV-2 variant P.1 to antibody neutralization. Cell Host Microbe 2021, 29, 747–751. [Google Scholar] [CrossRef]
- Wollschlager, P.; Todt, D.; Gerlitz, N.; Pfaender, S.; Bollinger, T.; Sing, A.; Dangel, A.; Ackermann, N.; Korn, K.; Ensser, A.; et al. SARS-CoV-2 N gene dropout and N gene Ct value shift as indicator for the presence of B.1.1.7 lineage in a commercial multiplex PCR assay. Clin. Microbiol. Infect. 2021, 27, 1353.e1–1353.e5. [Google Scholar] [CrossRef]
- Liu, C.; Ginn, H.M.; Dejnirattisai, W.; Supasa, P.; Wang, B.; Tuekprakhon, A.; Nutalai, R.; Zhou, D.; Mentzer, A.J.; Zhao, Y.; et al. Reduced neutralization of SARS-CoV-2 B.1.617 by vaccine and convalescent serum. Cell 2021, 184, 4220–4236. [Google Scholar] [CrossRef]
- Cascella, M.; Rajnik, M.; Aleem, A.; Dulebohn, S.C.; Di Napoli, R. Features, Evaluation, and Treatment of Coronavirus (COVID-19). In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2021. [Google Scholar]
- Di Caro, A.; Cunha, F.; Petrosillo, N.; Beeching, N.J.; Ergonul, O.; Petersen, E.; Koopmans, M.P.G. Severe acute respiratory syndrome coronavirus 2 escape mutants and protective immunity from natural infections or immunizations. Clin. Microbiol. Infect. 2021, 27, 823–826. [Google Scholar] [CrossRef]
- Chaqroun, A.; Hartard, C.; Schvoerer, E. Anti-SARS-CoV-2 Vaccines and Monoclonal Antibodies Facing Viral Variants. Viruses 2021, 13, 1171. [Google Scholar] [CrossRef]
- Ziegler, K.; Steininger, P.; Ziegler, R.; Steinmann, J.; Korn, K.; Ensser, A. SARS-CoV-2 samples may escape detection because of a single point mutation in the N gene. Eurosurveillance 2020, 25, 5–8. [Google Scholar] [CrossRef]
- Hasan, M.R.; Sundararaju, S.; Manickam, C.; Mirza, F.; Al-Hail, H.; Lorenz, S.; Tang, P. A Novel Point Mutation in the N Gene of SARS-CoV-2 May Affect the Detection of the Virus by Reverse Transcription-Quantitative PCR. J. Clin. Microbiol. 2021, 59, e03278-20. [Google Scholar] [CrossRef] [PubMed]
- Chu, D.K.W.; Pan, Y.; Cheng, S.M.S.; Hui, K.P.Y.; Krishnan, P.; Liu, Y.; Ng, D.Y.M.; Wan, C.K.C.; Yang, P.; Wang, Q.; et al. Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia. Clin. Chem. 2020, 66, 549–555. [Google Scholar] [CrossRef] [Green Version]
- Demeke Teklemariam, A.; Samaddar, M.; Alharbi, M.G.; Al-Hindi, R.R.; Bhunia, A.K. Biosensor and molecular-based methods for the detection of human coronaviruses: A review. Mol. Cell Probes. 2020, 54, 101662. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Manzano, J.; Malpartida-Cardenas, K.; Moser, N.; Pennisi, I.; Cavuto, M.; Miglietta, L.; Moniri, A.; Penn, R.; Satta, G.; Randell, P.; et al. Handheld Point-of-Care System for Rapid Detection of SARS-CoV-2 Extracted RNA in under 20 min. ACS Cent. Sci. 2021, 7, 307–317. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.; Li, S.; Zhang, W.; Du, B.; Cui, J.; Yan, C.; Huang, L.; Chen, L.; Zhao, L.; Sun, Y.; et al. Reverse-Transcription Recombinase-Aided Amplification Assay for Rapid Detection of the 2019 Novel Coronavirus (SARS-CoV-2). Anal. Chem. 2020, 92, 9699–9705. [Google Scholar] [CrossRef]
- Wu, T.; Ge, Y.; Zhao, K.; Zhu, X.; Chen, Y.; Wu, B.; Zhu, F.; Zhu, B.; Cui, L. A reverse-transcription recombinase-aided amplification assay for the rapid detection of N gene of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2). Virology 2020, 549, 1–4. [Google Scholar] [CrossRef]
- Qi, J.; Li, X.; Zhang, Y.; Shen, X.; Song, G.; Pan, J.; Fan, T.; Wang, R.; Li, L.; Ma, X. Development of a duplex reverse transcription recombinase-aided amplification assay for respiratory syncytial virus incorporating an internal control. Arch. Virol. 2019, 164, 1843–1850. [Google Scholar] [CrossRef]
- Tu, F.; Yang, X.; Xu, S.; Chen, D.; Zhou, L.; Ge, X.; Han, J.; Zhang, Y.; Guo, X.; Yang, H. Development of a fluorescent probe-based real-time reverse transcription recombinase-aided amplification assay for the rapid detection of classical swine fever virus. Transbound. Emerg. Dis. 2020, 68, 2017–2027. [Google Scholar] [CrossRef]
- Yan, T.F.; Li, X.N.; Wang, L.; Chen, C.; Duan, S.X.; Qi, J.J.; Li, L.X.; Ma, X.J. Development of a reverse transcription recombinase-aided amplification assay for the detection of coxsackievirus A10 and coxsackievirus A6 RNA. Arch. Virol. 2018, 163, 1455–1461. [Google Scholar] [CrossRef]
- Fan, G.H.; Shen, X.X.; Li, F.; Li, X.N.; Bai, X.D.; Zhang, R.Q.; Wang, R.H.; Lei, W.W.; Wang, H.Y.; Ma, X.J.; et al. Development of an Internally Controlled Reverse Transcription Recombinase-aided Amplification Assay for the Rapid and Visual Detection of West Nile Virus. Biomed. Environ. Sci. 2019, 32, 926–929. [Google Scholar]
- Zheng, Y.Z.; Chen, J.T.; Li, J.; Wu, X.J.; Wen, J.Z.; Liu, X.Z.; Lin, L.Y.; Liang, X.Y.; Huang, H.Y.; Zha, G.C.; et al. Reverse Transcription Recombinase-Aided Amplification Assay With Lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus. Front. Cell. Infect. Microbiol. 2021, 11, 613304. [Google Scholar] [CrossRef]
- Wang, J.; Cai, K.; He, X.; Shen, X.; Wang, J.; Liu, J.; Xu, J.; Qiu, F.; Lei, W.; Cui, L.; et al. Multiple-centre clinical evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNA. Clin. Microbiol. Infect. 2020, 26, 1076–1081. [Google Scholar] [CrossRef]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.M.; Wang, W.; Song, Z.G.; Hu, Y.; Tao, Z.W.; Tian, J.H.; Pei, Y.Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [Green Version]
- Zhao, L.; Atoni, E.; Nyaruaba, R.; Du, Y.; Zhang, H.; Donde, O.; Huang, D.; Xiao, S.; Ren, N.; Ma, T.; et al. Environmental surveillance of SARS-CoV-2 RNA in wastewater systems and related environments in Wuhan: April to May of 2020. J. Environ. Sci. 2022, 112, 115–120. [Google Scholar] [CrossRef]
- Shahrajabian, M.H.; Sun, W.; Cheng, Q. Different Methods for Molecular and Rapid Detection of Human Novel Coronavirus. Curr. Pharm. Des. 2021, 27, 2893–2903. [Google Scholar] [CrossRef] [PubMed]
- Dinnes, J.; Deeks, J.J.; Berhane, S.; Taylor, M.; Adriano, A.; Davenport, C.; Dittrich, S.; Emperador, D.; Takwoingi, Y.; Cunningham, J.; et al. Rapid, point-of-care antigen and molecular-based tests for diagnosis of SARS-CoV-2 infection. Cochrane Database Syst. Rev. 2021, 3, CD013705. [Google Scholar]





| Primers/Probe | Sequences (5′-3′) |
|---|---|
| Upstream | F1: TTGAGTATTGCCCTATTTTCTTCATAACTGGTAATAC F2: TTGAGTATTGCCCTATTTTCTTCATAACTGGTAATA F3: TTGAGTATTGCCCTATTTTCTTCATAACTGGTAAT F4: TTGAGTATTGCCCTATTTTCTTCATAACTGGTAA F5: TTGAGTATTGCCCTATTTTCTTCATAACTGGTA F6: TTGAGTATTGCCCTATTTTCTTCATAACTGGT F7: TTGAGTATTGCCCTATTTTCTTCATAACTGG F8: TTGAGTATTGCCCTATTTTCTTCATAACTG F9: TTGAGTATTGCCCTATTTTCTTCATAACT F10: TTGAGTATTGCCCTATTTTCTTCATAAC F11: TTGAGTATTGCCCTATTTTCTTCATAA |
| Downstream | R1: AACTCCTGTGTAGAAACTAAGTAATCATAAACACCA R2: AACTCCTGTGTAGAAACTAAGTAATCATAAACACC R3: AACTCCTGTGTAGAAACTAAGTAATCATAAACAC R4: AACTCCTGTGTAGAAACTAAGTAATCATAAACA R5: AACTCCTGTGTAGAAACTAAGTAATCATAAAC R6: AACTCCTGTGTAGAAACTAAGTAATCATAAA R7: AACTCCTGTGTAGAAACTAAGTAATCATAA R8: AACTCCTGTGTAGAAACTAAGTAATCATA R9: AACTCCTGTGTAGAAACTAAGTAATCAT R10: AACTCCTGTGTAGAAACTAAGTAATCA |
| Probe | TTACTTTGGCCTCTTTTGTTTACTCAACCGC[FAM-dT]A[THF] [BHQ1-dT]TTAGACTGACTCTTG[spacer C3] |
| RT-qPCR (Ct) | RT-RAA | Sensitivity (%) | Specificity (%) | |
|---|---|---|---|---|
| Positive | 45 (22.1–32.8) | 44 | 98 1 | |
| 24 (33.2–36.4) | 8 | 33 1 | ||
| Negative | 11 (>37.0) | 11 | 100 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, F.; He, P.; Xiong, D.; Lou, Y.; Pu, Q.; Zhang, H.; Zhang, H.; Yu, J. A Reverse Transcription Recombinase-Aided Amplification Method for Rapid and Point-of-Care Detection of SARS-CoV-2, including Variants. Viruses 2021, 13, 1875. https://doi.org/10.3390/v13091875
Li F, He P, Xiong D, Lou Y, Pu Q, Zhang H, Zhang H, Yu J. A Reverse Transcription Recombinase-Aided Amplification Method for Rapid and Point-of-Care Detection of SARS-CoV-2, including Variants. Viruses. 2021; 13(9):1875. https://doi.org/10.3390/v13091875
Chicago/Turabian StyleLi, Fengyun, Ping He, Dongyan Xiong, Yakun Lou, Qiaosheng Pu, Haixia Zhang, Huige Zhang, and Junping Yu. 2021. "A Reverse Transcription Recombinase-Aided Amplification Method for Rapid and Point-of-Care Detection of SARS-CoV-2, including Variants" Viruses 13, no. 9: 1875. https://doi.org/10.3390/v13091875
APA StyleLi, F., He, P., Xiong, D., Lou, Y., Pu, Q., Zhang, H., Zhang, H., & Yu, J. (2021). A Reverse Transcription Recombinase-Aided Amplification Method for Rapid and Point-of-Care Detection of SARS-CoV-2, including Variants. Viruses, 13(9), 1875. https://doi.org/10.3390/v13091875

