Prevalence of Fowl Adenovirus Serotype 4 and Co-Infection by Immunosuppressive Viruses in Fowl with Hydropericardium Hepatitis Syndrome in Shandong Province, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Treatment
2.2. Detection of FAdV-4, H9N2 AIV, IBDV, and CIAV
2.3. Phylogenetic Analysis
2.4. Data Analysis
3. Results
3.1. Epidemiology of FAdV-4 in HHS
3.2. FAdV-4 Co-Infection Rate
3.3. Sequencing and Phylogenetic Analysis
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Hess, M. Detection and differentiation of avian adenoviruses: a review. Avian Pathol. 2000, 29, 195–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meulemans, G.; Couvreur, B.; Decaesstecker, M.; Boschmans, M.; van den Berg, T.P. Phylogenetic analysis of fowl adenoviruses. Avian Pathol. 2004, 33, 164–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Domanska-Blicharz, K.; Tomczyk, G.; Smietanka, K.; Kozaczynski, W.; Minta, Z. Molecular characterization of fowl adenoviruses isolated from chickens with gizzard erosions. Poult Sci. 2011, 90, 983–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grafl, B.; Prokofieva, I.; Wernsdorf, P.; Steinborn, R.; Hess, M. Infection with an apathogenic fowl adenovirus serotype-1 strain (CELO) prevents adenoviral gizzard erosion in broilers. Vet. Microbiol. 2014, 172, 177–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grafl, B.; Aigner, F.; Liebhart, D.; Marek, A.; Prokofieva, I.; Bachmeier, J.; Hess, M. Vertical transmission and clinical signs in broiler breeders and broilers experiencing adenoviral gizzard erosion. Avian Pathol. 2012, 41, 599–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schade, B.; Schmitt, F.; Böhm, B.; Alex, M.; Fux, R.; Cattoli, G.; Terregino, C.; Monne, I.; Currie, R.J.; Olias, P. Adenoviral gizzard erosion in broiler chickens in Germany. Avian Dis. 2013, 57, 159–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ono, M.; Okuda, Y.; Yazawa, S.; Imai, Y.; Shibata, I.; Sato, S.; Okada, K. Adenoviral gizzard erosion in commercial broiler chickens. Vet. Pathol. 2003, 40, 294–303. [Google Scholar] [CrossRef] [Scilit]
- Lim, T.H.; Kim, B.Y.; Kim, M.S.; Jang, J.H.; Lee, D.H.; Kwon, Y.K.; Lee, J.B.; Park, S.Y.; Choi, I.S.; Song, C.S. Outbreak of gizzard erosion associated with fowl adenovirus infection in Korea. Poult. Sci. 2012, 91, 1113–1117. [Google Scholar] [CrossRef] [Scilit]
- Thanasut, K.; Fujino, K.; Taharaguchi, M.; Taharaguchi, S.; Shimokawa, F.; Murakami, M.; Takase, K. Genome Sequence of Fowl Aviadenovirus A Strain JM1/1, Which Caused Gizzard Erosions in Japan. Genome Announc. 2017, 5, e00749-17. [Google Scholar] [CrossRef] [Scilit]
- Matczuk, A.K.; Niczyporuk, J.S.; Kuczkowski, M.; Woźniakowski, G.; Nowak, M.; Wieliczko, A. Whole genome sequencing of Fowl aviadenovirus A - a causative agent of gizzard erosion and ulceration, in adult laying hens. Infect. Genet. Evol. 2017, 48, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Kaján, G.L.; Kecskeméti, S.; Harrach, B.; Benkő, M. Molecular typing of fowl adenoviruses, isolated in Hungary recently, reveals high diversity. Vet. Microbiol. 2013, 167, 357–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schachner, A.; Marek, A.; Grafl, B.; Hess, M. Detailed molecular analyses of the hexon loop-1 and fibers of fowl aviadenoviruses reveal new insights into the antigenic relationship and confirm that specific genotypes are involved in field outbreaks of inclusion body hepatitis. Vet. Microbiol. 2016, 186, 13–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, Q.; Liu, L.; Wang, Y.; Zhang, Y.; Qi, X.; Liu, C.; Gao, Y.; Wang, X.; Cui, H. The first whole genome sequence and pathogenicity characterization of a fowl adenovirus 4 isolated from ducks associated with inclusion body hepatitis and hydropericardium syndrome. Avian Pathol. 2017, 46, 571–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marek, A.; Nolte, V.; Schachner, A.; Berger, E.; Schlötterer, C.; Hess, M. Two fiber genes of nearly equal lengths are a common and distinctive feature of Fowl adenovirus C members. Vet. Microbiol. 2012, 156, 411–417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, P.H.; Zheng, P.P.; Zhang, T.F.; Wen, G.Y.; Shao, H.B.; Luo, Q.P. Fowl adenovirus serotype 4: Epidemiology, pathogenesis, diagnostic detection, and vaccine strategies. Poult Sci. 2017, 96, 2630–2640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, T.; Jin, Q.Y.; Ding, P.Y.; Wang, Y.B.; Chai, Y.X.; Li, Y.F.; Liu, X.; Luo, J.; Zhang, G.P. Molecular epidemiology of hydropericardium syndrome outbreakassociated serotype 4 fowl adenovirus isolates in central China. Virol. J. 2016, 13, 188. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Dou, Y.; Zheng, X.; Tang, Y.; Zhang, M.; Zhang, Y.; Wang, Z.; Diao, Y.X. Hydropericardium Hepatitis Syndrome Emerged in Cherry Valley Ducks in China. Transbound. Emerg. Dis. 2017, 64, 1262–1267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.X.; Jiang, S.J.; Wu, J.Q.; Zhao, Q.; Sun, Y.N.; Kong, Y.B.; Li, X.X.; Yao, M.L.; Chai, T.J. An investigation of duck circovirus and co-infection in Cherry Valley ducks in Shandong Province, China. Vet. Microbiol. 2009, 133, 252–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, X.Y.; Wang, H.; Wei, L.; Zhang, M.; Yang, J.; Chen, H.; Tang, Y.; Diao, Y.X. Epidemiological investigation of H9 avian influenza virus, Newcastle disease virus, Tembusu virus, goose parvovirus and goose circovirus infection of geese in China. Transbound. Emerg. Dis. 2018, 65, e304–e316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hardy, M.; Goryo, M.; Sasaki, J.; Okada, K. Pathological and immunohistochemical study of chickens with co-infection of Marek’s disease virus and chicken anaemia virus. Avian Pathol. 2009, 38, 469–483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, S.L.; Cong, R.C.; Zhang, R.H.; Chen, J.H.; Xia, L.L.; Xie, Z.J.; Jiang, S.J. Circulation and in vivo distribution of duck hepatitis A virus types 1 and 3 in infected ducklings. Arch. Virol. 2016, 161, 405–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guan, R.; Tian, Y.M.; Han, X.X.; Yang, X.; Wang, H.N. Complete genome sequence and pathogenicity of fowl adenovirus serotype 4 involved in hydropericardium syndrome in Southwest China. Microb. Pathog. 2018, 117, 290–298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.M.; Wang, J.C.; Chen, P.; Zhang, S.; Sun, J.G.; Yuan, W.Z. Pathogenicity and molecular characterization of a fowl adenovirus 4 isolated from chicken associated with IBH and HPS in China. BMC Vet. Res. 2018, 14, 400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, G.L.; Wang, Y.W.; Zhang, M.M.; Lin, Y.; Tang, Y.; Diao, Y.X. Pathogenic, Phylogenetic, and Serological Analysis of Group I Fowl Adenovirus Serotype 4 SDSX Isolated From Shandong, China. Froniters Microbiol. 2018, 9, 2772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, G.K.; Wang, H.; Yan, Y.Y.; Liu, F.; Huang, M.R.; Chen, R.A. Pathogenicity of a fowl adenovirus serotype 4 isolated from chickens associated with hydropericardium-hepatitis syndrome in China. Poult. Sci. 2019, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, H.S.; Bae, Y.C.; Park, S.C.; Kwon, H.M.; Lee, H.S.; Joh, S.J. Loop-mediated isothermal amplification assay for detection of four immunosuppressive viruses in chicken. J. Virol. Methods. 2018, 256, 6–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, F.F.; Dong, G.W.; Zhang, Y.B.; Tiao, S.B.; Cui, Z.Z.; Chang, S.; Zhao, P. Co-infection of fowl adenovirus with different immunosuppressive viruses in a chicken flock. Poult. Sci. 2018, 97, 1699–1705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Kubasová, T.; Rychlik, I.; Hoerr, F.J.; Rautenschlein, S. Infectious bursal disease virus infection leads to changes in the gut associated-lymphoid tissue and the microbiota composition. PLoS ONE 2018, 13, e0192066. [Google Scholar] [CrossRef] [Scilit]
- Li, G.; Yu, G.L.; Niu, Y.J.; Cai, Y.M.; Liu, S.D. Airborne Transmission of a Serotype 4 Fowl Adenovirus in Chickens. Viruses 2019, 11, 262. [Google Scholar] [CrossRef] [Scilit]
- Marek, A.; Gunes, A.; Schulz, E.; Hess, M. Classification of fowl adenoviruses by use of phylogenetic analysis and high resolution meltingcurve analysis of the hexon L1 gene region. J. Virol. Methods. 2010, 170, 147–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sohaimi, N.M.; Bejo, M.H.; Omar, A.R.; Ideris, A.; Isa, N.M. Hexon and fiber gene changes in an attenuated fowl adenovirus isolate from Malaysia in embryonated chicken eggs and its infectivity in chickens. J. Vet. Sci. 2018, 19, 759–770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redondo, H.; Fragoso, J.S.; Tahala, M.A.; Bensassi, Y.; Gil, I.; Elbachir, E.; Rodríguez, M.J.; Abad Moreno, J.C. Characterization of strain of fowl adenoviruses circulating in Morocco. Poult. Sci. 2018, 97, 4057–4062. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Primers | Sequence (5′–3′) | Size (bp) | Purpose |
|---|---|---|---|
| Hexon | F1: TGGACATGGGGGCGACCTA | 1219 | FAdV-4 hexon gene amplification |
| R1: AAGGGATTGACGTTGTCCA | |||
| F2: AACGTCAATCCCTTCAACCACC | 1350 | ||
| R2: TTGCCTGTGGCGAAAGGCG | |||
| FAdV-4 | F: CTCTTCGACCTCGTGTCTTACA | 568 | FAdV-4 detection |
| R: TTTACACGGCGTTGCCTGT | |||
| H9N2 AIV | F: GATAGAGACTCAACCCAAAA | 315 | H9N2 AIV detection |
| R: AACATCCTTTCCCATCTTCC | |||
| IBDV | F: AGGCCCAGAGTCTACACCAT | 475 | IBDV detection |
| R: CTGTTGCCACTCTTTCGTAGG | |||
| CIAV | F: AATGAACGCTCTCCAAGAAG | 582 | CITV detection |
| R: AGCGGATAGTCATAGTAGAT |
| Fowl Species | No. of Cases | No. of FAdV-4 Positive Cases | % FAdV-4 Positives |
|---|---|---|---|
| Breeder chickens | 172 | 59 | 34.30% |
| Commercial chickens | 149 | 108 | 72.48% |
| Breeder ducks | 70 | 48 | 68.57% |
| Commercial ducks | 288 | 228 | 79.17% |
| Total | 679 | 443 | 65.24% |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, G.; Lin, Y.; Dou, Y.; Tang, Y.; Diao, Y. Prevalence of Fowl Adenovirus Serotype 4 and Co-Infection by Immunosuppressive Viruses in Fowl with Hydropericardium Hepatitis Syndrome in Shandong Province, China. Viruses 2019, 11, 517. https://doi.org/10.3390/v11060517
Yu G, Lin Y, Dou Y, Tang Y, Diao Y. Prevalence of Fowl Adenovirus Serotype 4 and Co-Infection by Immunosuppressive Viruses in Fowl with Hydropericardium Hepatitis Syndrome in Shandong Province, China. Viruses. 2019; 11(6):517. https://doi.org/10.3390/v11060517
Chicago/Turabian StyleYu, Guanliu, Yun Lin, Yanguo Dou, Yi Tang, and Youxiang Diao. 2019. "Prevalence of Fowl Adenovirus Serotype 4 and Co-Infection by Immunosuppressive Viruses in Fowl with Hydropericardium Hepatitis Syndrome in Shandong Province, China" Viruses 11, no. 6: 517. https://doi.org/10.3390/v11060517
APA StyleYu, G., Lin, Y., Dou, Y., Tang, Y., & Diao, Y. (2019). Prevalence of Fowl Adenovirus Serotype 4 and Co-Infection by Immunosuppressive Viruses in Fowl with Hydropericardium Hepatitis Syndrome in Shandong Province, China. Viruses, 11(6), 517. https://doi.org/10.3390/v11060517

