Next Article in Journal
Differences in Tolerance of Alnus cordata (Loisel.) Duby and Tilia × europaea L. ‘Pallida’ to Environmental Stress in the First Year After Planting in Urban Conditions
Previous Article in Journal
Paleoclimatic Events Since 25 kyr B.P. and the Regional Differences Documented by Phytoliths in the Central Songnen Plain, NE China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Nitrogen Addition and Drought on Soil Microbial Diversity and Community Composition in a Young Tree Community

1
College of Forestry, Jiangxi Agricultural University, Nanchang 330045, China
2
Key Laboratory of Poyang Lake Watershed Agricultural Resources and Ecology of Jiangxi Province, Jiangxi Agricultural University, Nanchang 330045, China
3
College of Resources and Environment, Fujian Agriculture and Forestry University, Fuzhou 350002, China
4
Jiangxi Provincial Key Laboratory of Carbon Neutrality and Ecosystem Carbon Sink, Lushan Botanical Garden, Jiangxi Province and Chinese Academy of Sciences, Jiujiang 332900, China
*
Author to whom correspondence should be addressed.
Forests 2025, 16(2), 276; https://doi.org/10.3390/f16020276
Submission received: 18 December 2024 / Revised: 1 February 2025 / Accepted: 4 February 2025 / Published: 6 February 2025
(This article belongs to the Section Forest Soil)

Abstract

:
Soil microorganisms are well known to play a crucial role in carbon and nutrient cycling within terrestrial ecosystems. Numerous research efforts have demonstrated that nitrogen deposition can change forest soil microbial diversity and community composition; however, it is still unclear how nitrogen deposition will affect the soil microbial diversity and community composition in subtropical forests under the background of increasing drought. Consequently, over a period of 2.5 years, we carried out an experiment using two N addition regimes and three soil water treatment levels to reveal the effects of nitrogen, drought, and the influence of their interaction on the diversity and community composition of soil microorganisms. Overall, we found that both N addition and drought decreased the bacterial Shannon and Simpson indices yet had no significant effect on fungal diversity. In the well-watered treatments, nitrogen addition did not significantly reduce bacterial diversity, while in the moderate drought and severe drought treatments, N addition significantly decreased bacterial diversity, reducing the Shannon and Simpson indices by 27.05% and 0.13%, respectively, in the severe drought treatment. Drought significantly altered the community composition of bacteria regardless of N addition. N addition significantly changed the community composition of bacteria under moderate drought treatments, while both N addition and drought had less significant effects on the fungal community composition. The soil water content, fine root biomass, and soil pH were significantly correlated with bacterial community composition, which explained 53.3%, 11.1%, and 8.7% of the changes in soil bacterial community composition, respectively. These results suggest that drought may intensify the inhibitory effect of nitrogen on bacterial diversity and change the magnitude and direction of the impact of nitrogen on the composition of the bacterial community.

1. Introduction

Since the 20th century, due to a variety of activities carried out by humans, like the burning of fossil fuels, manufacturing processes, and the use of chemical nitrogen (N) fertilizers, N deposition has been increasing rapidly [1]. China has become the world’s third-largest N deposition area [2,3]. Meanwhile, extreme drought events occur frequently in China’s subtropical areas and show a trend of intensification in the future [4,5]. Microorganisms are an important part of forest soil, driving the metabolic processes and energy flows of forest soils [6,7,8]. Understanding the reaction of the diversity and community composition of soil microorganisms to N deposition and drought is conducive to studying the adaptation and evolution mechanisms of microorganisms to environmental changes and maintaining the stability of soil–ecosystem functions. Currently, much of the research on microorganisms has been focused on the individual effects of N or drought [5,9,10,11,12]. However, knowledge about whether and how the interactions between N and drought affect the diversity as well as community composition of soil microbes remains limited. Thus, a clearer explanation of the interactions of N deposition and drought on soil microbial diversity and community composition in the forest is of great significance for predicting ecosystem functions.
Soil microorganisms are an essential component of the forest soil ecosystem [6], serving as key drivers of carbon and nutrient cycling [7,8]. N deposition directly or indirectly affects microbial diversity and community composition by altering N availability, pH, soil C/N, etc. [13,14]. At present, many studies have reported that N deposition negatively impacts soil microbial diversity. Wang et al. [15] conducted a meta-analysis and found that N addition decreased the Shannon and Simpson indices of bacteria and fungi, with different N application rates having various effects. In a study of the soil microbial diversity of grassland in response to exogenous N input, Freitag et al. [16] also found that N application was not conducive to improving the soil microbial diversity. Conversely, other studies suggest that N addition may enhance microbial diversity. For example, Xu et al. [17] reported that N addition significantly increased the bacterial diversity, and the effect was enhanced with the increased rate of N application. Moreover, many studies have reported that N affects bacterial abundance by acidifying the soil or multi-element cycling genes, which in turn affects the bacterial community [18,19,20]. For example, Zeng et al. [18] found that acidobacteria were particularly sensitive to N addition. Through a meta-analysis, Xu et al. [17] revealed that after long-term N application, the relative abundance of proteobacteria and actinobacteria showed an upward trend, while that of acidobacteria exhibited a downward trend. These responses of different microbial groups to N addition vary greatly, likely because different soil microbial groups may play different roles in soil N cycling processes [21,22].
Soil moisture is another crucial factor that can alter the physical and chemical properties of soil, further altering soil microbial diversity and community composition [23,24,25]. Acosta-Martínez et al. [26] found that the Shannon index of both bacteria and fungi increased when the annual rainfall was reduced by 30% in a 9-year manipulative field experiment. This result was also supported in Yue’s cotton potted water control experiment. However, Preece et al. [27] found that drought had a negative impact on bacterial diversity, and the effect extent of drought on bacteria was greater than that on fungi. Drought can also exert an impact on the composition of soil microbial communities [28,29], and different microbial groups respond differently. For example, actinobateria and chloroflexi, which are typically bacterial phyla adapted to arid environments, showed increased relative abundance under drought conditions. Whereas glomeromycetes, a fungal class commonly regarded for its symbiotic relationships, exhibited a significant decrease in relative abundance during drought periods [30,31]. In addition, previous studies found that drought affects the N-conversion processes because water conditions regulate the substrate diffusion and plant–microbial access to available N, and maintain the hydration of soil microbial N-conversion processes [32], suggesting that drought may limit soil N-conversion processes and further impact soil microbial diversity and community composition [32,33].
To date, several studies have been conducted on N addition and drought experiments to study the drought–nitrogen (DN) interaction effect on soil microorganisms. In an experiment conducted in meadows and shrublands of California, they found that the overall biomass of microorganisms and bacterial biomass were significantly reduced under DN treatment [34]. Meanwhile, in a pine forest of Northeast China, Ji et al. [35] discovered that the DN treatment significantly influenced the bacterial and fungal communities and led to an increase in CO2 emissions. However, this increase was less pronounced compared to any single-factor treatment. This finding suggests that drought and nitrogen (N) deposition may have antagonistic effects on soil microbes when acting in combination [36,37]. Subtropical forests are globally important carbon sinks and have important ecosystem service value [38,39,40]. Under the conditions of increased N deposition and intensifying drought in the subtropics, it is necessary to understand how the interaction between N and drought will affect soil microbial diversity and community composition in subtropical forests. Thus, we conducted a 2.5-year field experiment to examine the effect of N addition, drought, and their interaction on microbial diversity and communities under two nitrogen application levels and three water regimes [3]. We hypothesized that (1) drought, in conjunction with N addition, is expected to exert an additive negative impact on both bacterial and fungal diversities, and (2) drought would intensify the effects of N addition on bacterial communities and alter the magnitude and direction of nitrogen’s impact on microbial communities.

2. Materials and Methods

2.1. Experimental Design

We conducted a study at the Fujian Agricultural and Forestry University in Fujian Province of China (119°24′ E, 26°08′ N). The region has an average annual temperature of 21 °C and an annual precipitation of 1348.8 mm, predominantly occurring between March and September. In October 2017, we constructed 18 square ponds (1 × 1 × 0.6 m) in an open-air greenhouse. To minimize water migration, tiles were attached to the interior walls of the growth ponds, and a 2 cm hole was created at the bottom of each pond to collect leachate. In November 2017, soil samples were collected from a nearby evergreen broad-leaved forest. These highly weathered soils were classified as Ultisols according to the USDA soil taxonomy system. Soil samples were obtained from two depth intervals: 0–25 cm and 25–50 cm. Following the removal of coarse roots and stones through sieving, the soils were homogenized and subsequently used to fill each square chamber to a depth of 0.5 m. After allowing approximately two months for natural soil settling, four subtropical tree species, including Pinus massoniana Lamb., Cunninghamia lanceolata (Lamb)Hook., Schima superba Gardn.Et Champ., and Ormosia pinnata (Lour.)Merr. were transplanted into each growth pond [3].
In April 2018, the experiment was designed as a completely randomized factorial arrangement with two nitrogen levels: control (0 kg N ha⁻1 y⁻1) and N addition (80 kg N ha⁻1 y⁻1). Three water gradients, namely well-watered (0.282 ± 0.013 m3 m−3), moderate drought (0.220 ± 0.017 m3 m−3), and severe drought (0.153 ± 0.010 m3 m−3), were designed under each N treatment level [3,41]. Each treatment had 3 replicates, resulting in 6 treatments and a total of 18 experimental plots (Figure 1). Soil moisture and temperature were measured every 3–5 days, and water was added as needed to restore soil moisture to the control levels. The required water volume was calculated based on soil bulk density and the soil volume of each experimental plot. Ammonium nitrate (NH4NO3) was used as the N source, and 1.905 g of NH4NO3 was regularly dissolved in 5 L of water, then sprayed into the corresponding plots every month. Additionally, 5 L of water was sprayed in the non-N addition treatment at the same time. The details of the experimental design have been described in previous studies [3,41].

2.2. Soil Sampling and Properties

Soil samples were collected in August 2020. We randomly collected soil samples from four points within each plot using a 5 cm diameter sterile soil drill at a depth of 0–10 cm. The 4 subsamples collected from each plot were mixed as an independent sample. Then, soil samples were quickly placed into plastic bags and immediately placed in a portable refrigerator with a sufficient number of ice packs to ensure that a cold environment was maintained. After being taken back to the lab, each soil sample was sieved and then stored in three parts. One part was stored at 4 °C for NH4+-N and NO3-N testing, one part was stored at −80 °C for microbial high-throughput sequencing, and one was air-dried and used for measuring the physical and chemical properties. The soil water content was determined using the gravimetric drying method, while soil pH was measured in a 1:2.5 (m/v) soil-to-water extract ratio. Soil total carbon (TC) and total N were determined with the use of an elemental analyzer (EA3000, Euro Vector, Milan, Italy). The measurement of soil ammonium N (NH4+-N) and nitrate N (NO3-N) was carried out by an intermittent flow analyzer (Smart Chem200, MS–Allianc, Milan, Italy). Total phosphorus (TP) was measured by sulfuric acid–perchloric acid cooking with molybdenum and antimony. Fine root biomass was measured by washing and sifting living roots from the soil, followed by weighing.

2.3. Microbial Diversity and Community

Soil microbial DNA was extracted using the OMEGA soil DNA extraction kit (D5625-01). Polymerase chain reaction (PCR) was performed in a 30 μL reaction system containing 15 μL of 2× Phanta Master Mix, 1 μL of each primer (forward and reverse), 10–20 ng of template genomic DNA, and nuclease-free water to adjust the final volume to 30 μL. 341F (5′-CCTACGGGNGGCWGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) were employed to amplify bacterial genes. ITS1F (5′-CTTGGTCA TTTAGAGGAAGTAA-3′) and ITS1R (5′-GCTGCG TTCTTCATCGATGC-3′) were employed to amplify fungal genes. The PCR conditions for bacteria were as follows: initial denaturation at 95 °C for 5 min, followed by 27 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 45 s, with a final extension at 72 °C for 10 min. For fungi, the PCR conditions were similar, except that 29 cycles were used. After the first round of PCR, electrophoresis was performed to verify the products, and Illumina bridge PCR-compatible primers were introduced for the second round of amplification, the 16S rRNA gene product was used as the template, and the V3-V4 region with high bacterial specificity and the ITS1 region with high fungal specificity were selected as the amplification fragments. The primers were F (AATGATACGGCGACCACCGAGATCTACACTCTATAGCCTACACTCTTTCCCTACACGACGCCTTCCGATCT) and R (CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT). The second PCR program included pre-denaturation at 95 °C for 30 s, followed by 5 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, and extension at 72 °C for 30 s, with a final elongation step at 72 °C for 5 min. Following PCR, the products were verified by agarose gel electrophoresis, using 2% agarose gels at 80 V for 40 min. PCR products were then purified using the Equalbit™ dsDNA HS Assay Kit (Vazyme, EQ111-01) and sent to a bioengineering company for sequencing.

2.4. Data Analysis

We used USEARCH to cluster sequences at a similarity threshold of 97%, and the clustered sequences were then filtered to remove chimera, resulting in operational taxonomic unit (OTU) sequences for species classification. For each representative sequence of the OTU, species annotation analysis was performed by aligning the silva rRNA database with an 80% confidence threshold. The Shannon index (A) and Simpson index (B) were used to calculate the evenness and richness of soil bacterial and fungal communities, so as to characterize the diversity of soil microbial communities. These indices are defined as follows:
A = i = 1 n P i ln P i
B = 1 i = 1 n P i 2
where i represents the i-th band in the lane, Pi is the proportion of the gray value of the i-th band in the total gray value of that lane, and n represents the number of species in the community.
Two-way ANOVA was performed to evaluate the influences of N, drought, and their combined effects on soil characteristics, microbial diversity, and the relative abundance of dominant populations at the phylum level. One-way ANOVA was used to determine the differences in soil physicochemical properties, microbial diversity, and relative abundance of microbial dominant populations among different drought treatments within the same N group, or among different N treatments under the same drought condition. Non-metric multidimensional scaling (NMDS) analysis of all OUTs was conducted in the vegan package (version 2.5-7) in R (version 4.0.3, R Foundation for Statistical Computing, Vienna, Austria), based on the weighted Unifrac distance matrix. Detrended correspondence analysis (DCA) was performed using Canoco 5.0 (Microcomputer Power, Ithaca, NY, USA) on microbial taxa with a relative abundance greater than 1%. Redundancy analysis (RDA) was conducted to explore the relationships between dominant microbial communities and environmental factors. Graphpad 8.0 (GraphPad Software, San Diego, CA, USA) was used to draw histograms.

3. Results

3.1. Soil Properties

Significant effects of drought and N addition on soil properties were observed (Table 1). Overall, N addition increased (p < 0.001) the total P and fine root biomass, while it decreased (p < 0.001) the soil pH (Table 1). Drought decreased (p < 0.05) the soil water content, soil pH, total C, total N, total P, and fine root biomass, while it increased (p < 0.05) the soil NO3-N and NH4+-N concentrations. Under well-watered conditions, N addition had a minimal impact on soil water content, soil pH, total C, total P, NO3-N, and NH4+-N concentrations, and fine root biomass. However, under moderate drought conditions, N addition increased (p < 0.001) the soil total P and fine root biomass. Under severe drought conditions, N addition decreased (p = 0.001) soil pH, while it increased (p < 0.001) soil total P concentration. In the N addition group, moderate drought increased both total P (p < 0.01) and fine root biomass (p < 0.05). Severe drought decreased (p < 0.01) soil pH, while it increased (p < 0.01) the soil total P concentration.

3.2. Soil Microbial Diversity

Significant impacts of N addition, drought, and their interaction on microbial diversity were detected. Overall, both N addition and drought significantly reduced the Shannon and Simpson indices of bacterial diversity, while no significant effects were observed on fungal diversity indices (Figure 2). N addition decreased the Shannon and Simpson indices of bacteria to varying extents across both two drought treatments. In the moderate drought conditions, N addition decreased (p < 0.05) the Shannon and Simpson indices of bacteria. In the severe drought conditions, N addition decreased (p < 0.05) the Simpson index of bacteria and reduced the Shannon index of bacteria by 27.05%. Furthermore, in both the control and N addition groups, moderate and severe drought decreased (p < 0.001) both the Shannon and Simpson indices of bacterial diversity. However, N addition, drought, and the interactions had no significant effects on fungal diversity.

3.3. Soil Microbial Communities

Non-metric multidimensional scale (NMDS) analysis of microbial communities was used to analyze the effects of N addition and drought on the composition of bacteria and fungi (Figure 3). Along the first axis, a clear separation of soil bacterial communities was observed among the three water treatments, regardless of N addition (Figure 3a), while N addition significantly separated the fungal communities under moderate drought levels (Figure 3b).
The dominant bacterial populations at the phylum level, with a relative abundance above 1%, included proteobacteria, acidobacteria, actinobacteria, chloroflexi, GAL15, planctomycetes, gemmatimonadetes, cyanobacteria, and rokubacteria (Figure 4). N addition increased (p < 0.001) the relative abundance of actinobacteria (Figure 4c). Moderate drought increased the relative abundance of actinobacteria (p < 0.001, Figure 4c) and gemmatimonadetes (p < 0.1, Figure 4e) but decreased the relative abundance of acidobacteria (p < 0.05, Figure 4b), Gal15 (p < 0.05, Figure 4g), rokubacteria (p < 0.001, Figure 4h), verrucomicrobia (p < 0.01, Figure 4i), and latescibacteria (p < 0.001, Figure 4j). Meanwhile, severe drought increased the relative abundance of actinobacteria (p < 0.001, Figure 4c) and chloroflexi (p < 0.001, Figure 4d) and decreased the relative abundance of verrucomicrobia (p < 0.01, Figure 4i) and latescibacteria (p < 0.001, Figure 4j). Moreover, in the severe drought treatments, N addition significantly decreased the relative abundance of gemmatimonadetes (p < 0.1, Figure 4e), while it increased its abundance under moderate drought levels. However, the effects of N addition on the relative abundances of rokubacteria and GAL15 (p < 0.05, Figure 4g,h) showed opposite trends under moderate and severe drought treatments. In the well-watered samples, N addition enhanced the relative abundance of latescibacteria (p < 0.001, Figure 4j), but this treatment decreased its abundance in the drought conditions. The dominant fungal communities with a relative abundance of more than 1% were ascomycota, basidiomycota, mortierellomycota, mucoromycota, and glomeromycota (Figure 5). Adding N exerted no significant influence on fungal communities.

3.4. Correlations

Our results indicated that the first two axes of redundancy analysis (RDA) for soil bacterial communities explained 56.67% and 17.60% of the variance in the relationships between the dominant soil bacterial community and environmental factors, respectively (Figure 6a). In the RDA analysis, the soil water content (p = 0.002), fine root biomass (p = 0.006), and soil pH (p = 0.012) were significantly correlated with bacterial community composition, which explained 53.3%, 11.1%, and 8.7% of the changes in soil bacterial community composition, respectively (Figure 6a). For soil fungal communities, the first two axes of RDA explained 20.82% and 17.69% of the variance in the relationships between the dominant fungal community and environmental factors, respectively (Figure 6b). Total N (p = 0.014) and fine root biomass (p = 0.014) had a significant correlation with the composition of the fungal community (Figure 6b).

4. Discussion

4.1. Effect of N Addition, Drought, and Their Interaction on Soil Microbial Diversity

Our results showed that N addition significantly decreased the Shannon and Simpson indices of bacterial diversity. Numerous previous studies showed that declining soil microbial diversity is associated with N addition [11,15], and our findings align with these conclusions. In our study, under N addition conditions, the soil pH decreased significantly. A meta-analysis of 106 studies concluded that decreased soil pH is closely related to N addition [42]; therefore, N addition is likely a direct contributor to soil acidification. The acidification effect can be largely attributed to the increased hydrogen ion (H⁺) production via nitrification, a process in which ammonium (NH₄⁺) is oxidized to nitrate (NO3), releasing H⁺ as a byproduct [43]. Moreover, the organic compounds secreted by plant roots, including low-molecular-weight organic acids and phenolic compounds, have the ability to facilitate the dissolution of soil minerals. This process leads to the release of acidic substances, thereby indirectly causing a decline in soil pH [44,45]. These factors may jointly contribute to the decrease in pH in the N addition groups. Furthermore, the soil pH change is highly likely a crucial factor influencing the alteration in bacterial diversity. Notably, Hu et al. [46] also demonstrated a significant positive correlation between soil pH and microbial diversity. Therefore, the decreased soil pH caused by N addition likely inhibits bacterial diversity. On the other hand, N addition may directly impact soil microbial diversity. Studies have shown that increased N availability can harm microbes which are less tolerant of high osmotic potential, potentially leading to a decline in microbial diversity [47].
In contrast, several studies have indicated that fungal diversity is less responsive to N addition [43], which is consistent with our study that N addition did not significantly affect the Shannon and Simpson indices of fungi. This may be due to the weaker habitat linkage of fungi compared to bacteria, as fungi are generally more resistant to external disturbances. Fungi also form more stable symbiotic networks than bacteria under such conditions [48]. For example, Man et al. [49] reported that the effect of N addition on the fungal Shannon index depended on the duration of N application. In our study, the experiment’s duration was 2.5 years, which might not have been sufficient to significantly affect the fungal diversity.
Soil moisture plays an important role in the survival of microorganisms. One meta-analysis, examining the effects of environmental changes on soil microbial diversity, reported that drought significantly negatively impacted soil microbial diversity [50]. Similar to the results presented in this meta-analysis, our findings also show that drought led to a significant decline in the Shannon and Simpson indices of bacterial diversity (Figure 2a). Drought inhibited the pathways through which bacteria access nutrients via water flow and diffusion [51], altering osmotic pressure and nutrient availability, and ultimately affecting microbial populations and diversity [52]. However, the impact of drought on fungal diversity was less significant in our study. To further understand the differential response of bacteria and fungi to drought, a relevant study on a European climate gradient provided some insights. Sara Winterfeldt et al. [53] found that bacteria were negatively correlated with drought index, while fungi did not have any variables that were significantly associated with drought index. Fungi can not only prevent self-dehydration by secreting polysaccharides but can also expand the hyphal network to enhance water and nutrient absorption under drought condition [48]. Moreover, long-term lime experiments have shown that pH is weakly correlated with fungal diversity [54]. In our study, while there was a significant decline in soil pH as a result of N addition, fungi generally exhibited a broader range of optimal growth pH compared to bacteria, which may explain their relative insensitivity to pH changes.
Drought intensified the inhibitory effect of N addition on bacterial diversity, partly validating our first hypothesis. Under well-watered conditions, N addition did not significantly affect the diversity of bacteria. However, under moderate drought and severe drought conditions, N addition significantly reduced both the Shannon and Simpson indices of bacterial diversity. The combined effect of N addition and drought on microbial diversity is likely mediated by soil acidification and soil moisture restriction [46,55]. Drought can intensify N-induced soil acidification [46]. As soil moisture declines, reduced leaching of inorganic nitrogen compounds (e.g., NH₄⁺ and NO3) leads to their accumulation, exacerbating acidification [56]. In our study, severe drought conditions resulted in significantly higher NH₄⁺ and NO3 concentrations in N addition treatments compared to well-watered conditions. The interaction between nitrogen addition and drought further intensifies rhizosphere acidification through two key mechanisms. Firstly, reduced soil moisture limits NO3 diffusion, prompting plant roots to preferentially absorb NH₄⁺, leading to H⁺ release [57]. Second, drought stress enhances the root exudation of organic acids and phenolic compounds, further contributing to acidification [45]. Thus, the combined effects of N addition and drought lead to a more pronounced decline in soil pH [56]. Numerous studies have confirmed that soil pH exhibits a significantly positive correlation with bacterial diversity [46,58]. Furthermore, N addition can also exacerbate soil moisture restriction for microbes under drought conditions [59]. N generally promotes plant growth, which increases the competition for soil water, thereby reducing microbial substrate availability and limiting microbial growth and population size [55]. This phenomenon adversely affects microbial diversity. Our previous findings demonstrated that N addition increased the fine root biomass; however, under severe drought conditions, nitrogen addition resulted in decreased fine root biomass. This suggests that drought stress may constrain the positive effects of nitrogen addition on plant growth. This indicates that drought may limit the positive effects of N addition on plant growth, further exacerbating their combined impacts on microbial diversity. While the combined effects of drought and N addition had a significant impact on bacterial diversity, their influence on fungal diversity presented a different scenario. Notably, in our study, drought did not alter the effect of N addition on the Shannon and Simpson indices of fungi. This could be attributed to the differences in habitat linkages and genomic differences between fungi and bacteria [60]. Compared with bacteria, fungi exhibit weaker habitat linkages and lower genome plasticity, making them more resistant to changes in their external environmental conditions [60,61]. These findings highlight the importance of considering the interactions among multiple environmental factors when evaluating their impacts on microbial diversity in the context of climatic change in the future.

4.2. Effect of N Addition, Drought, and Their Interactions on Soil Microbial Community Composition

Studies have shown that N deposition altered the composition of soil bacterial communities [12,15], because N input modifies the availability of microbial substrates, thereby influencing the composition of microbial communities [43]. Consistent with these findings, our results also showed that N addition had a significant effect on bacterial community composition. We observed the soil pH was significantly correlated with bacterial community composition. This is because N addition decreased soil pH and. as a result, there is a possibility that it may cause changes in the composition of the bacterial community. Liu et al. [30] also demonstrated that the impacts of environmental factors on the soil bacterial community under N addition mainly depended on the change of soil pH. Moreover, the increase in fine root biomass driven by N addition may have further influenced the bacterial community composition. A meta-analysis revealed that N impacts plant biomass allocation strategies, leading to changes in fine root biomass and associated functions, which may also regulate the composition of soil bacterial communities [31].
Different soil bacterial groups also exhibited distinct responses to N addition, likely due to the different functions of different soil microbial groups in soil carbon and N cycling processes [8]. N addition significantly increased the relative abundance of actinobacteria and chloroflexi. Wang et al. [49] showed a similar result, reporting that the relative abundance of actinobacteria and chloroflexi increased by 10.4%~34.7% and 14.3%~28.6%, respectively, under long-term N addition in a loess region. This response may be attributed to nutrient enrichment, which directly or indirectly alters species interactions, subsequently affecting bacterial community structure. In addition, this response may also be related to the pH reduction induced by N addition. According to a global meta-analysis [62], actinobacteria and chloroflexi were significantly positively correlated with pH. Conversely, the abundance of proteobacteria, rokubacteria, and verrucomicrobia exhibited a decreasing trend following N addition. This observation aligns with the theory of universal survival strategies for bacteria [63]. Similarly, Zeng et al. [18] reported a similar result. A possible reason for this is that N addition enhanced soil nutrient availability and changed the soil pH [18]. Furthermore, N addition is known to enhance plant growth, and the plant may release more root exudates, including substances, like sugars, amino acids, and short-chain carboxylic acids, which may also alter the relative abundance of these bacterial populations [45]. N addition did not have a significant effect on the composition of fungal communities. The observed differences in the responses of bacterial and fungal communities can be attributed to their differing susceptibilities to changes in the soil environment [64,65]. Studies have reported that N addition has a greater effect on bacteria [6], which confirms the conclusion that the bacterial community changed significantly. However, the fungal community may not be sensitive to exogenous N input.
Similar to previous studies, we found that drought changed the composition of bacterial community. A reduction in soil moisture can disrupt elemental cycling, thereby affecting the availability of the elements [66]. In the moderate drought treatments, the relative abundances of actinobacteria and gemmatimonadetes were significantly increased. It has been reported that actinobacteria and gemmatimonadetes are the dominant bacterial in long-term dryland soils because of their strong stress resistance, and they often show drought-resistant or opportunistic drought adaptation strategies [36]. Meanwhile, in the severe drought treatments, the relative abundance of gemmatimonadetes was significantly decreased; at the same time, the relative abundances of the phyla proteobacteria and actinobacteria also exhibited an obvious decreasing trend. Studies reported that water can limit the distribution of cyanobacteria, while drought will lead to a decrease in the abundance of cyanobacteria [67]. This reduction in cyanobacteria abundance may impair N fixation, potentially leading to negative impacts on bacterial populations. In the fungal groups, the relative abundances of Basidiomycota, Mortierellomycota, and Glomeromycota showed a decreasing trend under severe drought conditions. The possible reason for this is that, although fungi possess certain drought tolerance, their growth and metabolic processes, such as hyphal extension, spore germination, and nutrient transportation, still require a certain level of moisture. Under severe drought conditions, the diffusion of water and the transport of solutes become difficult, limiting fungi’s access to essential resources [36]. Additionally, severe drought can lead to a decrease in soil respiration rates [3] which affects the content and transformation of available N forms (such as ammonium and nitrate) that fungi can utilize, thereby influencing their relative abundance. The relative abundance of those dominant fungal phyla did not show a significant response to drought. The redundancy analysis also showed no significant correlation between soil water content and fungal communities. Previous studies have shown that soil fungal communities show four different response patterns under drought conditions: drought-tolerant, resource-limited, drought-insensitive and drought-sensitive [36]. Among these, drought-tolerant communities are the most prevalent response mode [68], suggesting that majority of the soil fungal communities are well-adapted to the arid environments.
We found that, to some extent, drought intensifies the effects of N addition on bacterial communities and changes the intensity and direction of N effects on microbial communities. This finding is consistent with our second hypothesis. In our study, drought modified the response of the relative abundances of gemmatimonadetes, planctomycetes, Gal15, and latescibacteria to N addition. For example, in the well-watered treatments, there was no significant impact of N addition on the relative abundance of gemmatimonadetes. However, in the moderate drought and severe drought treatment groups, N addition significantly increased and decreased its relative abundance, respectively. Similarly, Zeng et al. [18] observed that N addition indirectly affected soil bacterial community composition by altering soil pH in their N–water interaction study. In our study, severe drought treatments also led to significant changes in pH, which may explain the exacerbation of N effects on bacterial community composition by drought. This result is further supported by the significant correlation between soil pH and bacterial community composition. N addition is known to cause soil acidification [69]; however, in our study, severe drought exacerbated the pH reduction, potentially intensifying the effects of N on bacterial communities. Another potential explanation is that drought may counteract the promoting effect of N on fine root biomass, which in turn affects the bacterial community composition [70,71]. Furthermore, we observed that as the drought intensified, the concentrations of NO3-N and NH4+-N increased obviously. This may partly explain the effect of drought on the relative abundance of bacterial communities involved in the N cycle, such as gemmatimonadetes [72]. The dominant soil fungal communities did not respond significantly to the interaction between drought and N addition. A possible explanation is that soil fungal communities are generally more environmentally tolerant than bacterial communities. Fungi can mitigate dehydration by secreting polysaccharides and expand their hyphal networks to enhance water and nutrient absorption under drought conditions [48].

5. Conclusions

Overall, N addition and drought significantly reduced bacterial diversity, but had no significant effect on fungal diversity. In the well-watered treatments, N addition did not affect bacterial or fungal diversity. However, in the moderate drought treatments, N addition significantly decreased the bacterial Shannon and Simpson indices, and N addition significantly reduced the Simpson index of bacteria by 27.05% in the severe drought treatments. N addition, drought and their interaction significantly influenced bacterial community composition. Both moderate drought and severe drought exacerbated the magnitude and direction of nitrogen’s effects on microbial communities. N addition significantly increased the relative abundance of actinobacteria. Drought significantly increased the relative abundances of actinobacteria, chloroflexi, and gemmatimonadetes, while it decreased the relative abundance of proteobacteria and rokubacteria. Under well-watered treatments, N addition did not affect the relative abundances of gemmatimonadetes, planctomycetes, and rokubacteria. However, in the moderate drought treatments, N addition led to a significant increase in the relative abundance of gemmatimonadetes, yet simultaneously caused a decrease in the relative abundances of planctomycetes and rokubacteria. In the severe drought treatments, N addition significantly decreased the abundance of gemmatimonadetes, while it had no effect on planctomycetes and rokubacteria. Notably, both bacterial and fungal communities were closely related to fine root biomass. The results of RDA revealed that soil water content, fine root biomass, and soil pH explain 53.3%, 11.1%, and 8.7% of the variation in soil bacterial community composition, respectively. N addition, drought, and their interaction did not significantly affect the composition of fungi. These findings suggest that, to some extent, drought can modify the effects of N addition on microbial diversity and community composition.

Author Contributions

X.F., X.X., D.X. and Q.S. conceived and designed the experiment; Y.B., X.W. and Y.Z. completed the experiment; J.L., G.N. and Q.Y. analyzed the experimental data; Y.B. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded through the National Science Foundation of China (Grant Nos. 42267034 and 32360801), the Project for 1000 Talents Plan Award of Jiangxi (jxsq2023101103), and the Natural Science Foundation of Jiangxi Province (20232BAB205020).

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors also thank Jun Liu for his help with the field work.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Liu, L.; Wen, Z.; Liu, S.; Zhang, X.Y.; Liu, X.J. Decline in atmospheric nitrogen deposition in China between 2010 and 2020. Nat. Geosci. 2024, 17, 816. [Google Scholar] [CrossRef]
  2. Mo, J.M.; Brown, S.; Xue, J.H.; Fang, Y.T.; Li, Z.A. Response of litter decomposition to simulated N deposition in disturbed, rehabilitated and mature forests in subtropical China. Plant Soil 2006, 282, 135–151. [Google Scholar] [CrossRef]
  3. Zhu, Y.L.; Lin, X.P.; Huang, Y.P.; Tang, X.H.; Fang, X.; Yi, Z.G. Drought offsets the potential effects of nitrogen addition on soil respiration and organic carbon in model subtropical forests. Forests 2022, 13, 1615. [Google Scholar] [CrossRef]
  4. Zhang, Y.J.; Chen, L.; Li, Y.Q.; Ge, Z.A. Anthropogenic influence on the extreme drought in eastern China in 2022 and its future risk. Atmos. Ocean. Sci. Lett. 2024, 17, 23–29. [Google Scholar] [CrossRef]
  5. Niu, X.D.; Liu, S.R. Drought affected ecosystem water use efficiency of a natural oak forest in central China. Forests 2021, 12, 839. [Google Scholar] [CrossRef]
  6. Zu, L.; Zhou, G.H.; Long, F.Y.; Zang, L.P.; Chen, D.M.; Zhang, G.Q.; Sui, M.Z.; He, Y.J.; Liu, Q.F. Stochastic processes dominate soil microbial community assembly during the restoration of degraded karst forests. Forests 2024, 15, 594. [Google Scholar] [CrossRef]
  7. Philippot, L.; Chenu, C.; Kappler, A.; Rillig, M.C.; Fierer, N. The interplay between microbial communities and soil properties. Nat. Rev. Microbiol. 2023, 22, 226–239. [Google Scholar] [CrossRef]
  8. Wu, H.W.; Cui, H.L.; Fu, C.X.; Li, R.; Qi, F.Y.; Liu, Z.L.; Yang, G.; Xiao, K.Q.; Qiao, M. Unveiling the crucial role of soil microorganisms in carbon cycling: A review. Sci. Total Environ. 2023, 909, 168627. [Google Scholar] [CrossRef]
  9. Sun, R.B.; Wang, F.H.; Hu, C.S.; Liu, B.B. Metagenomics reveals taxon-specific responses of the nitrogen-cycling microbial community to long-term nitrogen fertilization. Soil Biol. Biochem. 2021, 156, 108214. [Google Scholar] [CrossRef]
  10. Dong, L.; Li, M.X.; Li, S.; Yue, L.X.; Mukhtiar, A.; Han, J.R.; Lian, W.H.; Hu, C.J.; Lin, Z.L.; Shi, G.Y.; et al. Aridity drives the variability of desert soil microbiomes across north-western China. Sci. Total Environ. 2023, 907, 168048. [Google Scholar] [CrossRef] [PubMed]
  11. Yang, Y.; Chen, X.L.; Liu, L.X.; Li, T.; Dou, Y.X.; Qiao, J.B.; Wang, Y.Q.; An, S.S.; Chang, S.X. Nitrogen fertilization weakens the linkage between soil carbon and microbial diversity: A global meta-analysis. Glob. Change Biol. 2022, 28, 6446–6461. [Google Scholar] [CrossRef]
  12. Renaudin, M.; Khlifa, R.; Legault, S.; Kembel, S.W.; Kneeshaw, D.; Moore, J.D.; Houle, D. Long-term simulated nitrogen deposition has moderate impacts on soil microbial communities across three bioclimatic domains of the eastern Canadian forest. Forests 2023, 14, 1124. [Google Scholar] [CrossRef]
  13. Xing, W.; Lu, X.M.; Ying, J.Y.; Lan, Z.C.; Chen, D.M.; Bai, Y.F. Disentangling the effects of nitrogen availability and soil acidification on microbial taxa and soil carbon dynamics in natural grasslands. Soil Biol. Biochem. 2022, 164, 108495. [Google Scholar] [CrossRef]
  14. Wan, B.B.; Barnes, A.D.; Potapov, A.; Yang, J.N.; Zhu, M.Y.; Chen, X.Y.; Hu, F.; Liu, M.Q. Altered litter stoichiometry drives energy dynamics of food webs through changing multiple facets of soil biodiversity. Soil Biol. Biochem. 2024, 191, 109331. [Google Scholar] [CrossRef]
  15. Wang, C.; Liu, D.W.; Bai, E. Decreasing soil microbial diversity is associated with decreasing microbial biomass under nitrogen addition. Soil Biol. Biochem. 2018, 120, 126–133. [Google Scholar] [CrossRef]
  16. Freitag, T.E.; Clegg, C.D.; James, I. Influence of inorganic nitrogen management regime on the diversity of nitrite-oxidizing bacteria in agricultural grassland soils. Appl. Environ. 2005, 71, 8323–8334. [Google Scholar] [CrossRef]
  17. Xu, Y.G.; Yu, W.T.; Ma, Q.; Zhou, H. Responses of bacterial and archaeal ammonia oxidisers of an acidic luvisols soil to different nitrogen fertilization rates after 9 years. Biol. Fertil. Soils 2012, 48, 827–837. [Google Scholar] [CrossRef]
  18. Zeng, J.; Liu, X.J.; Song, L.; Lin, X.G.; Zhang, H.Y.; Shen, C.C.; Chu, H.Y. Nitrogen fertilization directly affects soil bacterial diversity and indirectly affects bacterial community composition. Soil Biol. Biochem. 2016, 92, 41–49. [Google Scholar] [CrossRef]
  19. Liao, L.R.; Wang, J.; Dijkstra, F.A.; Lei, S.L.; Zhang, L.; Wang, X.J.; Liu, G.B.; Zhang, C. Nitrogen enrichment stimulates rhizosphere multi-element cycling genes via mediating plant biomass and root exudates. Soil Biol. Biochem. 2024, 190, 109306. [Google Scholar] [CrossRef]
  20. Tian, J.; Dungait, J.A.J.; Lu, X.K.; Yang, Y.F.; Hartley, I.P.; Zhang, W.; Mo, J.M.; Yu, G.R.; Zhou, J.Z.; Kuzyakov, Y. Long-term nitrogen addition modifies microbial composition and functions for slow carbon cycling and increased sequestration in tropical forest soil. Glob. Change Biol. 2019, 25, 3267–3281. [Google Scholar] [CrossRef] [PubMed]
  21. Ren, B.H.; Ma, X.W.; Li, D.Y.; Bai, L.; Li, J.H.; Yu, J.X.; Meng, M.; Li, H.Y. Nitrogen-cycling microbial communities respond differently to nitrogen addition under two contrasting grassland soil types. Front. Microbiol. 2024, 15, 1290248. [Google Scholar] [CrossRef]
  22. Samiran, B.; Klaus, S.; Marcel, G.A. Keystone taxa as drivers of microbiome structure and functioning. Nat. Rev. Microbiol. 2018, 16, 567–576. [Google Scholar]
  23. Li, W.J.; Wang, J.L.; Jiang, L.M.; Lv, G.H.; Hu, D.; Wu, D.Y.; Yang, X.D. Rhizosphere effect and water constraint jointly determined the roles of microorganism in soil phosphorus cycling in arid desert regions. Catena 2023, 222, 106809. [Google Scholar] [CrossRef]
  24. He, H.R.; Xu, M.Z.; Li, W.T.; Chen, L.; Chen, Y.N.; Daryl, L.M.; Albert, B.; Liu, J.; Cui, Y.X.; Zeng, Y.; et al. Linking soil depth to aridity effects on soil microbial community composition, diversity and resource limitation. Catena 2023, 232, 107393. [Google Scholar] [CrossRef]
  25. Zhang, J.L.; Liu, S.R.; Liu, C.J.; Wang, H.; Luan, J.W.; Liu, X.J.; Guo, X.W.; Niu, B.L. Soil bacterial and fungal richness and network exhibit different responses to long-term throughfall reduction in a warm-temperate oak forest. Forests 2021, 12, 165. [Google Scholar] [CrossRef]
  26. Acosta-Martinez, V.; Cotton, J.; Gardner, T.; Moore-Kucera, J.; Zak, J.; Wester, D.; Cox, S. Predominant bacterial and fungal assemblages in agricultural soils during a record drought/heat wave and linkages to enzyme activities of biogeochemical cycling. Appl. Soil Ecol. 2014, 84, 69–82. [Google Scholar] [CrossRef]
  27. Preece, C.; Verbruggen, E.; Liu, L.; Weedon, J.T.; Peñuelas, J. Effects of past and current drought on the composition and diversity of soil microbial communities. Soil Biol. Biochem. 2019, 131, 28–39. [Google Scholar] [CrossRef]
  28. Oram, N.J.; Brennan, F.; Praeg, N.; Bardgett, R.D.; Illmer, P.; Ingrisch, J.; Bahn, M. Plant community composition and traits modulate the impacts of drought intensity on soil microbial community composition and function. Soil Biol. Biochem. 2025, 200, 109644. [Google Scholar] [CrossRef]
  29. Alberto, C.; Hannes, S.; Lucia, F.; Victoria, M.; Herbold, C.W.; David, Z.; Philipp, G.; Roland, H.; Marina, J.; Michael, B.; et al. Ecological memory of recurrent drought modifies soil processes via changes in soil microbial community. Nat. Commun. 2021, 12, 5308. [Google Scholar]
  30. Liu, W.X.; Jiang, L.; Yang, S.; Wang, Z.; Tian, R.; Peng, Z.Y.; Chen, Y.L.; Zhang, X.X.; Kuang, J.L.; Ling, N.; et al. Critical transition of soil bacterial diversity and composition triggered by nitrogen enrichment. Ecology 2020, 101, 0012–9658. [Google Scholar] [CrossRef]
  31. Feng, H.L.; Guo, J.H.; Peng, C.H.; Daniel, K.; Gabrielle, R.; Pan, C.; Ma, X.; Zhou, D.; Weifeng, W.F. Nitrogen addition promotes terrestrial plants to allocate more biomass to aboveground organs: A global meta-analysis. Glob. Change Biol. 2023, 29, 3970–3989. [Google Scholar] [CrossRef] [PubMed]
  32. Hueso, S.; García, C.; Hernández, T. Severe drought conditions modify the microbial community structure, size and activity in amended and unamended soils. Soil Biol. Biochem. 2012, 50, 167–173. [Google Scholar] [CrossRef]
  33. Naylor, D.; Devin, C.D. Drought stress and root-associated bacterial communities. Front. Plant Sci. 2017, 8, 2223. [Google Scholar] [CrossRef]
  34. Khalili, B.; Ogunseitan, O.A.; Goulden, M.L. Interactive effects of precipitation manipulation and nitrogen addition on soil properties in California grassland and shrubland. Appl. Soil Ecol. 2016, 107, 144–153. [Google Scholar] [CrossRef]
  35. Ji, R.Q.; Gao, T.T.; Li, G.L.; Xu, Y.; Xing, P.J.; Zhou, J.J.; Xie, M.L.; Li, J.Q.; Li, Y. Correlation between mycorrhizal ectomycorrhizal fungal communities and environmental factors in Pinus koraiensis forest in Northeast China. Mycosystema 2020, 39, 743–754. [Google Scholar]
  36. Lavalle, J.M.; Chomel, M.; Segura, N.A.; Castro, F.D.; Goodall, T.; Magilton, M.; Rhymes, J.M.; Delgado-Baquerizo, M.; Griffiths, R.I.; Baggs, E.M.; et al. Land management shapes drought responses of dominant soil microbial taxa across grasslands. Nat. Commun. 2024, 15, 29. [Google Scholar] [CrossRef]
  37. Yu, H.G.; Li, L.; Ma, Q.H.; Liu, X.D.; Li, Y.B.; Wang, Y.H.; Zhou, G.S.; Xu, Z.Z. Soil microbial responses to large changes in precipitation with nitrogen deposition in an arid ecosystem. Ecology 2023, 104, e4020. [Google Scholar] [CrossRef]
  38. Wang, L.H.; Yu, M.X.; Ye, S.; Yan, J.H. Seasonal patterns of carbon and water flux responses to precipitation and solar radiation variability in a subtropical evergreen forest, South China. Agric. For. Meteorol. 2023, 342, 109760. [Google Scholar] [CrossRef]
  39. Lin, Q.H.; Zhu, J.X.; Wang, Q.F.; Zhang, Q.Y.; Yu, G.R. Patterns and drivers of atmospheric nitrogen deposition retention in global forests. Glob. Change Biol. 2024, 30, e17410. [Google Scholar] [CrossRef]
  40. Duan, P.P.; Fu, R.T.; Nottingham, A.T.; Yang, X.Y.; Du, H.; Wang, K.L.; Li, D.J. Tree species diversity increases soil microbial carbon use efficiency in a subtropical forest. Glob. Change Biol. 2023, 29, 7131–7144. [Google Scholar] [CrossRef] [PubMed]
  41. Li, Y.Y.; Wang, Z.C.; Liu, H.H.; Zhang, C.; Fu, S.L.; Fang, X. Responses in growth and anatomical traits of two subtropical tree species to nitrogen addition, drought, and their interactions. Front. Plant Sci. 2021, 12, 709510. [Google Scholar] [CrossRef] [PubMed]
  42. Tian, D.S.; Niu, S.L. A global analysis of soil acidification caused by nitrogen addition. Environ. Res. Lett. 2015, 10, 024019. [Google Scholar] [CrossRef]
  43. Wang, X.D.; Feng, J.G.; Ao, G.K.L.; Qin, W.K.; Han, M.G.; Shen, Y.W.; Liu, M.L.; Chen, Y.; Zhu, B. Globally nitrogen addition alters soil microbial community structure, but has minor effects on soil microbial diversity and richness. Soil Biol. Biochem. 2023, 179, 108982. [Google Scholar] [CrossRef]
  44. Clocchiatti, A.; Hannula, S.E.; Berg, M.; Hundscheid, M.P.J.; Boer, W. Evaluation of phenolic root exudates as stimulants of saptrophic fungi in the rhizosphere. Front. Microbiol. 2021, 12, 644046. [Google Scholar] [CrossRef]
  45. Wen, T.; Yu, G.H.; Hong, W.D.; Yuan, J.; Niu, G.Q.; Xie, P.H. Root exudate chemistry affects soil carbon mobilization via microbial community reassembly. Fundam. Res. 2022, 2, 697–707. [Google Scholar] [CrossRef]
  46. Hu, Z.K.; Manuel, D.B.; Nicolas, F.; Chen, X.Y.; Zhou, Y.; Du, G.Z.; Hu, F.; Jiang, L.; Hu, S.J.; Liu, M.Q. Nutrient-induced acidification modulates soil biodiversity-function relationships. Nat. Commun. 2024, 15, 2858. [Google Scholar] [CrossRef]
  47. Luo, L.; Zhao, C.Z.; Zheng, D.H.; Wang, E.T.; Liang, J.; Yin, C.Y. Nitrogen uptake preference and allocation in Populus cathayana in response to drought stress. Environ. Exp. Bot. 2023, 213, 105415. [Google Scholar] [CrossRef]
  48. Vries, F.T.; Griffiths, R.I.; Bailey, M.; Craig, H.; Girlanda, M.; Gweon, H.S.; Hallin, S.; Kaisermann, A.; Keith, A.M.; Kretzschmar, M.; et al. Soil bacterial networks are less stable under drought than fungal networks. Nat. Commun. 2018, 9, 3033. [Google Scholar] [CrossRef]
  49. Man, B.Y.; Xiang, X.; Luo, Y.; Mao, X.T.; Zhang, C.; Sun, B.H.; Wang, X. Characteristics and influencing factors of soil fungal community of typical vegetation types in Mount Huangshan, East China. Mycosystema 2021, 40, 2735–2751. [Google Scholar]
  50. Yang, Y.; Li, T.; Wang, Y.Q.; Chang, S.X.; Liang, C.; An, S.S. Negative effects of multiple global change factors on soil microbial diversity. Soil Biol. Biochem. 2021, 156, 108229. [Google Scholar] [CrossRef]
  51. de Vries, F.T.; Liiri, M.E.; Bjørnlund, L.; Setälä, H.M.; Christensen, S.; Bardgett, R.D. Legacy effects of drought on plant growth and the soil food web. Oecologia 2012, 170, 821–833. [Google Scholar] [CrossRef]
  52. Manzoni, S.; Schimel, J.P.; Porporato, A. Responses of soil microbial communities to water stress: Results from a meta-analysis. Ecology 2012, 93, 930–938. [Google Scholar] [CrossRef]
  53. Winterfeldt, S.; Paredes, C.C.; Rousk, J.; Leizeaga, A. Microbial resistance and resilience to drought across a European climate gradient. Soil Biol. Biochem. 2024, 199, 109574. [Google Scholar] [CrossRef]
  54. Rousk, J.; Baath, E.; Brookes, P.C.; Lauber, C.L.; Louzupone, C.; Caporaso, G.; Knight, R.; Fierer, N. Soil bacterial and fungal communities across a pH gradient in an arable soil. ISME J. 2010, 4, 1340–1351. [Google Scholar] [CrossRef]
  55. Yang, A.; Song, B.; Zhang, W.X.; Zhang, T.N.; Li, X.W.; Wang, H.T.; Zhu, D.; Zhao, J.; Fu, S.L. Chronic enhanced nitrogen deposition and elevated precipitation jointly benefit soil microbial community in a temperate forest. Soil Biol. Biochem. 2024, 193, 109397. [Google Scholar] [CrossRef]
  56. Yu, Y.; Liu, L.; Zhao, J.N.; Wang, S.C.; Zhou, Y.J.; Xiao, C.W. The diversity of soil bacteria and fungi under altered nitrogen and rainfall patterns in a temperate steppe. Front. Microbiol. 2022, 13, 906818. [Google Scholar] [CrossRef]
  57. Wang, R.Z.; Cavagnaro, T.R.; Jiang, Y.; Keitel, C.; Dijkstra, F.A. Carbon allocation to the rhizosphere is affected by drought and nitrogen addition. J. Ecol. 2021, 109, 3699–3709. [Google Scholar] [CrossRef]
  58. Li, J.B.; Li, J.; Shen, Z.H.; Li, C.N.; Li, C.; Kou, Y.P.; Wang, Y.S.; Tu, B.; Zhang, S.H.; Li, X.Z. Stair-step pattern of soil bacterial diversity mainly driven by pH and vegetation types along the elevational gradients of Gongga Mountain, China. Front. Microbiol. 2018, 9, 569. [Google Scholar] [CrossRef]
  59. Meng, B.; Li, J.Q.; Maurer, G.E.; Zhong, S.Z.; Yao, Y.; Yang, X.C.; Collins, S.L.; Sun, W. Nitrogen addition amplifies the nonlinear drought response of grassland productivity to extended growing-season droughts. Ecology 2021, 102, e03483. [Google Scholar] [CrossRef]
  60. Liu, W.X.; Liu, L.L.; Yang, X.; Deng, M.F.; Wang, Z.; Wang, P.D.; Yang, S.; Li, P.; Peng, Z.Y.; Yang, L.; et al. Long-term nitrogen input alters plant and soil bacterial, but not fungal beta diversity in a semiarid grassland. Glob. Change Biol. 2021, 27, 3939–3950. [Google Scholar] [CrossRef]
  61. Bahram, M.; Netherway, T.; Clémence, F.; Ferretti, P.; Coelho, L.P.; Geisen, S.; Bork, P.; Hildebrand, F. Metagenomic assessment of the global distribution of bacteria and fungi. Environ. Microbiol. 2020, 23, 316–326. [Google Scholar] [CrossRef]
  62. Dai, Z.M.; Su, W.Q.; Chen, H.H.; Barberan, A.; Zhao, H.C.; Yu, M.J.; Yu, L.; Brookes, P.C.; Schadt, C.W.; Chang, S.X.; et al. Long-term nitrogen fertilization decreases bacterial diversity and favors the growth of Actinobacteria and Proteobacteria in agro-ecosystems across the globe. Glob. Chan. Biol. 2018, 24, 3452–3461. [Google Scholar] [CrossRef]
  63. Yang, Y.; Dou, Y.X.; Wang, B.R.; Xue, Z.J.; Wang, Y.Q.; An, S.S.; Chang, S.X. Deciphering factors driving soil microbial life-history strategies in restored grasslands. iMeta 2022, 2, e66. [Google Scholar] [CrossRef]
  64. Wang, C.Q.; Kuzyakov, Y. Mechanisms and implications of bacterial-fungal competition for soil resources. ISME J. 2024, 18, 1751–7356. [Google Scholar] [CrossRef]
  65. Zhou, S.Y.D.; Lie, Z.Y.; Liu, X.J.; Zhu, Y.G.; Josep, P.; Roy, N.; Su, X.X.; Liu, Z.F.; Chu, G.W.; Meng, Z.; et al. Distinct patterns of soil bacterial and fungal community assemblages in subtropical forest ecosystems under warming. Glob. Change Biol. 2022, 29, 1501–1513. [Google Scholar] [CrossRef]
  66. Eduardo, M.J.; César, P.; Hugo, S.; Rebeca, M.; Maren, F.; Maestre, F.T. Aridity and reduced soil micronutrient availability in global drylands. Nat. Sustain. 2019, 2, 371–377. [Google Scholar]
  67. Jassy, V.E.J.; Walcker, R.; Kardol, P.; Geisen, S.; Heger, T.; Lamentowicz, M.; Harmard, S.; Lara, E. Contribution of soil algae to the global carbon cycle. New Phytol. 2022, 234, 64–76. [Google Scholar] [CrossRef]
  68. Coleine, C.; Stajich, J.E.; Selbmann, L. Fungi are key players in extreme ecosystems. Trends Ecol. Evol. 2022, 37, 517–528. [Google Scholar] [CrossRef]
  69. Chen, C.; Xiao, W.Y.; Han, Y.; Chen, H. Mapping global soil acidification under N deposition. Glob. Change Biol. 2023, 29, 4652–4661. [Google Scholar] [CrossRef]
  70. Li, W.; Wang, W.Q.; Sun, R.M.; Li, M.K.; Liu, H.W.; Shi, Y.F.; Zhu, D.D.; Li, J.Y.; Ma, L.; Fu, S.L. Influence of nitrogen addition on the functional diversity and biomass of fine roots in warm-temperate and subtropical forests. Forest Ecol. Manag. 2023, 545, 121309. [Google Scholar] [CrossRef]
  71. Pan, J.W.; Wu, H.L.; Xiang, W.H.; Ouyang, S.; Chen, L.; Zeng, Y.L.; Deng, X.W.; Zhao, Z.H.; Zeng, W.X.; Kuzyakov, Y. Soil microbial richness and community composition are primarily mediated by functional trait diversity of fine roots in subtropical forests. Plant Soil 2023, 497, 485–501. [Google Scholar] [CrossRef]
  72. Hu, X.J.; Gu, H.D.; Liu, J.J.; Wei, D.; Zhu, P.; Cui, X.A.; Zhou, B.K.; Chen, X.L.; Jin, J.; Liu, X.B.; et al. Metagenomics reveals divergent functional profiles of soil carbon and nitrogen cycling under long-term addition of chemical and organic fertilizers in the black soil region. Geoderma 2022, 418, 115846. [Google Scholar] [CrossRef]
Figure 1. Experimental plot layout illustrating the combinations of N treatments and water gradients. Two N treatments: control (0 kg N ha⁻1 y⁻1) and N addition (80 kg N ha⁻1 y⁻1). Three water gradients: (a) well-watered (0.282 ± 0.013 m3 m−3), (b) moderate drought (0.220 ± 0.017 m3 m−3), and (c) severe drought (0.153 ± 0.010 m3 m−3).
Figure 1. Experimental plot layout illustrating the combinations of N treatments and water gradients. Two N treatments: control (0 kg N ha⁻1 y⁻1) and N addition (80 kg N ha⁻1 y⁻1). Three water gradients: (a) well-watered (0.282 ± 0.013 m3 m−3), (b) moderate drought (0.220 ± 0.017 m3 m−3), and (c) severe drought (0.153 ± 0.010 m3 m−3).
Forests 16 00276 g001
Figure 2. Effects of N addition and drought on soil bacterial Shannon index (a), soil bacterial Simpson index (b), fungal Shannon index (c), and fungal Simpson index (d). The error bars indicate the arithmetic mean ± standard deviation from three replicates. Distinct superscript letters signify significant differences between N addition treatments within the same drought condition (lowercase letters) and across various drought conditions under the same N addition treatment (uppercase letters). Asterisks (*) indicate interactions.
Figure 2. Effects of N addition and drought on soil bacterial Shannon index (a), soil bacterial Simpson index (b), fungal Shannon index (c), and fungal Simpson index (d). The error bars indicate the arithmetic mean ± standard deviation from three replicates. Distinct superscript letters signify significant differences between N addition treatments within the same drought condition (lowercase letters) and across various drought conditions under the same N addition treatment (uppercase letters). Asterisks (*) indicate interactions.
Forests 16 00276 g002
Figure 3. Non-metric multidimensional scaling (NMDS) analysis was conducted for the community composition of bacteria (a) and fungi (b), with the distances calculated based on weighted Unifrac. Distinct treatments are represented by different patterns.
Figure 3. Non-metric multidimensional scaling (NMDS) analysis was conducted for the community composition of bacteria (a) and fungi (b), with the distances calculated based on weighted Unifrac. Distinct treatments are represented by different patterns.
Forests 16 00276 g003
Figure 4. Relative abundance of dominant soil bacteria in phylum level under N addition and three water conditions. Proteobacteria (a), acidobacteria (b), actinobacteria (c), chloroflexi (d), gemmatimonadetes (e), planctomycetes (f), GAL15 (g), rokubacteria (h), verrucomicrobia (i), and latescibacteria (j). The error bars depicted the arithmetic means ± standard deviation for three replicates. Varying superscripts were used to indicate significant differences. Specifically, lowercase letters were applied to show significant differences between N addition treatments under the same drought treatment, while uppercase letters were utilized to denote significant differences between different drought treatments under the same N addition treatment. An asterisk (*) was employed to represent interactions.
Figure 4. Relative abundance of dominant soil bacteria in phylum level under N addition and three water conditions. Proteobacteria (a), acidobacteria (b), actinobacteria (c), chloroflexi (d), gemmatimonadetes (e), planctomycetes (f), GAL15 (g), rokubacteria (h), verrucomicrobia (i), and latescibacteria (j). The error bars depicted the arithmetic means ± standard deviation for three replicates. Varying superscripts were used to indicate significant differences. Specifically, lowercase letters were applied to show significant differences between N addition treatments under the same drought treatment, while uppercase letters were utilized to denote significant differences between different drought treatments under the same N addition treatment. An asterisk (*) was employed to represent interactions.
Forests 16 00276 g004
Figure 5. Relative abundance of dominant soil fungi in phylum level under N addition and three water conditions. Ascomycota (a), Basidiomycota (b,c), Mortierellomycota (d), Mucoromycota (e), and Glomeromycota (f). The error bars denoted the arithmetic means ± standard deviation for three replicates. An asterisk (*) represented interactions.
Figure 5. Relative abundance of dominant soil fungi in phylum level under N addition and three water conditions. Ascomycota (a), Basidiomycota (b,c), Mortierellomycota (d), Mucoromycota (e), and Glomeromycota (f). The error bars denoted the arithmetic means ± standard deviation for three replicates. An asterisk (*) represented interactions.
Forests 16 00276 g005
Figure 6. Results of the redundancy analysis regarding the microbial community and soil environmental parameters (bacteria (a) and fungi (b)). * represents microbial communities. The red solid line represents a significant effect, while the dotted line represents a non-significant effect.
Figure 6. Results of the redundancy analysis regarding the microbial community and soil environmental parameters (bacteria (a) and fungi (b)). * represents microbial communities. The red solid line represents a significant effect, while the dotted line represents a non-significant effect.
Forests 16 00276 g006
Table 1. Effects of N addition, drought, and their interactions on soil water content (SWC), soil pH, total C, total N, total P, NO3-N, NH4+-N, and fine root biomass (FRB) of 0–10 cm layer of soil (n = 3).
Table 1. Effects of N addition, drought, and their interactions on soil water content (SWC), soil pH, total C, total N, total P, NO3-N, NH4+-N, and fine root biomass (FRB) of 0–10 cm layer of soil (n = 3).
ParametersWell-WateredModerate DroughtSevere Droughtp Value
ControlN AdditionControlN AdditionControlN AdditionNWN*W
SWC (%)29.24 ± 0.94 A27.16 ± 1.40 A20.61 ± 0.75 B19.77 ± 0.48 B15.79 ± 0.53 C15.49 ± 0.48 C<0.0010.0400.316
pH6.18 ± 0.136.02 ± 0.16 A5.98 ± 0.035.87 ± 0.18 A5.98 ± 0.11 a5.44 ± 0.03 Bb<0.0010.0010.021
Total C (g kg−1)4.14 ± 0.284.5 ± 0.35 A3.95 ± 0.194.6 ± 0.36 A4.01 ± 0.083.94 ± 0.09 B0.0740.0210.078
Total N (g kg−1)0.37 ± 0.020.39 ± 0.030.37 ± 0.010.42 ± 0.030.38 ± 0.040.41 ± 0.040.8090.0350.626
Total P (g kg−1)0.35 ± 0.00 B0.36 ± 0.01 B0.37 ± 0.01 Ab0.41 ± 0.01 Aa0.34 ± 0.00 Cb0.36 ± 0.01 Ba<0.001<0.001<0.001
NO3-N (mg kg−1)1.99 ± 0.232.55 ± 0.84 B2.56 ± 1.994.2 ± 0.4 B3.92 ± 1.42 b12.17 ± 5.27 Aa0.0030.0100.035
NH4+-N (mg kg−1)2.20 ± 0.571.74 ± 0.5 B1.9 ± 0.422.57 ± 0.43 B2.28 ± 0.863.96 ± 0.51 A0.0110.0350.022
FRB (g m−2)43.50 ± 2.16 A77.67 ± 23.90 A47.96 ± 6.69 Ab91.89 ± 15.60 Aa15.28 ± 5.20 B15.07 ± 4.04 B<0.0010.0030.061
The values of soil physical and chemical properties presented in the table represent arithmetic means ± standard deviation. Under the same N addition level, different uppercase letters denote significant differences among drought treatments (p < 0.05). Different lowercase letters indicate significant differences between N addition treatments under the same drought condition (p < 0.05). The values of N, W, and N*W in the table represent the p-values from the two-way ANOVA, corresponding to the effects of N addition, drought, and their interaction on soil physicochemical properties, respectively. A p-value < 0.05 indicates that the differences are significant. Asterisks (*) indicate interactions.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bian, Y.; Wu, X.; Zhu, Y.; Xiong, X.; Xi, D.; Yang, Q.; Liu, J.; Song, Q.; Ni, G.; Fang, X. Effects of Nitrogen Addition and Drought on Soil Microbial Diversity and Community Composition in a Young Tree Community. Forests 2025, 16, 276. https://doi.org/10.3390/f16020276

AMA Style

Bian Y, Wu X, Zhu Y, Xiong X, Xi D, Yang Q, Liu J, Song Q, Ni G, Fang X. Effects of Nitrogen Addition and Drought on Soil Microbial Diversity and Community Composition in a Young Tree Community. Forests. 2025; 16(2):276. https://doi.org/10.3390/f16020276

Chicago/Turabian Style

Bian, Yanyan, Xingli Wu, Yulin Zhu, Xin Xiong, Dan Xi, Qingpei Yang, Jun Liu, Qingni Song, Guorong Ni, and Xiong Fang. 2025. "Effects of Nitrogen Addition and Drought on Soil Microbial Diversity and Community Composition in a Young Tree Community" Forests 16, no. 2: 276. https://doi.org/10.3390/f16020276

APA Style

Bian, Y., Wu, X., Zhu, Y., Xiong, X., Xi, D., Yang, Q., Liu, J., Song, Q., Ni, G., & Fang, X. (2025). Effects of Nitrogen Addition and Drought on Soil Microbial Diversity and Community Composition in a Young Tree Community. Forests, 16(2), 276. https://doi.org/10.3390/f16020276

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop