The Use of the Nematode Caenorhabditis elegans to Evaluate the Adverse Effects of Epoxiconazole Exposure on Spermatogenesis
Abstract
:1. Introduction
2. Materials and Methods
2.1. C. elegans Strains and Drug Treatments
2.2. Outcross Progeny Assay
2.3. Germline Staining Assay
2.4. Meiotic Entry Assay
2.5. Sperm Size and Morphology Assay
2.6. Sperm Activation Assay
2.7. Sperm Migration Assay
2.8. Real-Time Quantitative PCR for Relative Genes Expression Levels
2.9. Statistical Analysis
3. Results
3.1. Assessment of Reproductive Capacity in Epoxiconazole-Exposed Male him-5
3.2. Effects of Epoxiconazole Exposure on Mitotic Cells
3.3. Effects of Epoxiconazole Exposure on Meiotic Cells
3.4. Effects of Epoxiconazole Exposure on Sperm Size
3.5. Effects of Epoxiconazole Exposure on Sperm Activation and Sperm Migration
3.6. Effects of Epoxiconazole Exposure on TGF-β Pathway Gene Expression
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Berenzen, N.; Lentzen-Godding, A.; Probst, M.; Schulz, H.; Schulz, R.; Liess, M. A comparison of predicted and measured levels of runoff-related pesticide concentrations in small lowland streams on a landscape level. Chemosphere 2005, 58, 683–691. [Google Scholar] [CrossRef] [PubMed]
- Chambers, J.E.; Greim, H.; Kendall, R.J.; Segner, H.; Sharpe, R.M.; Van Der Kraak, G. Human and ecological risk assessment of a crop protection chemical: A case study with the azole fungicide epoxiconazole. Crit. Rev. Toxicol. 2014, 44, 176–210. [Google Scholar] [CrossRef] [PubMed]
- Heise, T.; Schmidt, F.; Knebel, C.; Rieke, S.; Haider, W.; Pfeil, R.; Kneuer, C.; Niemann, L.; Marx-Stoelting, P. Hepatotoxic effects of (tri) azole fungicides in a broad dose range. Arch. Toxicol. 2015, 89, 2105–2117. [Google Scholar] [CrossRef] [PubMed]
- De Castro, V.L.; Maia, A.H. Prenatal epoxiconazole exposure effects on rat postnatal development. Birth Defects Res. B Dev. Reprod. Toxicol. 2012, 95, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Zhu, B.; Liu, L.; Gong, Y.X.; Ling, F.; Wang, G.X. Triazole-induced toxicity in developing rare minnow (Gobiocypris rarus) embryos. Environ. Sci. Pollut. Res. Int. 2014, 21, 13625–13635. [Google Scholar] [CrossRef] [PubMed]
- Hass, U.; Boberg, J.; Christiansen, S.; Jacobsen, P.R.; Vinggaard, A.M.; Taxvig, C.; Poulsen, M.E.; Herrmann, S.S.; Jensen, B.H.; Petersen, A.; et al. Adverse effects on sexual development in rat offspring after low dose exposure to a mixture of endocrine disrupting pesticides. Reprod. Toxicol. 2012, 34, 261–274. [Google Scholar] [CrossRef] [PubMed]
- Taxvig, C.; Hass, U.; Axelstad, M.; Dalgaard, M.; Boberg, J.; Andeasen, H.R.; Vinggaard, A.M. Endocrine-disrupting activities in vivo of the fungicides tebuconazole and epoxiconazole. Toxicol. Sci. 2007, 100, 464–473. [Google Scholar] [CrossRef] [PubMed]
- Stinchcombe, S.; Schneider, S.; Fegert, I.; Rey Moreno, M.C.; Strauss, V.; Groters, S.; Fabian, E.; Fussell, K.C.; Pigott, G.H.; van Ravenzwaay, B. Effects of estrogen coadministration on epoxiconazole toxicity in rats. Birth Defects Res. B Dev. Reprod. Toxicol. 2013, 98, 247–259. [Google Scholar] [CrossRef] [PubMed]
- Grote, K.; Niemann, L.; Selzsam, B.; Haider, W.; Gericke, C.; Herzler, M.; Chahoud, I. Epoxiconazole causes changes in testicular histology and sperm production in the Japanese quail (Coturnix coturnix japonica). Environ. Toxicol. Chem. 2008, 27, 2368–2374. [Google Scholar] [CrossRef] [PubMed]
- Warrilow, A.G.; Hull, C.M.; Rolley, N.J.; Parker, J.E.; Nes, W.D.; Smith, S.N.; Kelly, D.E.; Kelly, S.L. Clotrimazole as a potent agent for treating the oomycete fish pathogen Saprolegnia parasitica through inhibition of sterol 14alpha-demethylase (CYP51). Appl. Environ. Microbiol. 2014, 80, 6154–6166. [Google Scholar] [CrossRef] [PubMed]
- Kjaerstad, M.B.; Taxvig, C.; Nellemann, C.; Vinggaard, A.M.; Andersen, H.R. Endocrine disrupting effects in vitro of conazole antifungals used as pesticides and pharmaceuticals. Reprod. Toxicol. 2010, 30, 573–582. [Google Scholar] [CrossRef] [PubMed]
- Keber, R.; Rozman, D.; Horvat, S. Sterols in spermatogenesis and sperm maturation. J. Lipid Res. 2013, 54, 20–33. [Google Scholar] [CrossRef] [PubMed]
- Carreau, S.; Bouraima-Lelong, H.; Delalande, C. Role of estrogens in spermatogenesis. Front. Biosci. 2012, 4, 1–11. [Google Scholar] [CrossRef]
- Chu, D.S.; Shakes, D.C. Spermatogenesis. Adv. Exp. Med. Biol. 2013, 757, 171–203. [Google Scholar] [PubMed]
- Fan, Y.S.; Hu, Y.J.; Yang, W.X. TGF-beta superfamily: How does it regulate testis development. Mol. Biol. Rep. 2012, 39, 4727–4741. [Google Scholar] [CrossRef] [PubMed]
- Escott, G.M.; da Rosa, L.A.; Loss Eda, S. Mechanisms of hormonal regulation of sertoli cell development and proliferation: A key process for spermatogenesis. Curr. Mol. Pharmacol. 2014, 7, 96–108. [Google Scholar] [CrossRef] [PubMed]
- Rouiller-Fabre, V.; Levacher, C.; Pairault, C.; Racine, C.; Moreau, E.; Olaso, R.; Livera, G.; Migrenne, S.; Delbes, G.; Habert, R. Development of the foetal and neonatal testis. Andrologia 2003, 35, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Lesch, B.J.; Page, D.C. Genetics of germ cell development. Nat. Rev. Genet. 2012, 13, 781–794. [Google Scholar] [CrossRef] [PubMed]
- Susiarjo, M.; Rubio, C.; Hunt, P. Analyzing mammalian female meiosis. Methods Mol. Biol. 2009, 558, 339–354. [Google Scholar] [PubMed]
- Ferreira, D.W.; Allard, P. Models of germ cell development and their application for toxicity studies. Environ. Mol. Mutagen. 2015, 56, 637–649. [Google Scholar] [CrossRef] [PubMed]
- Hubbard, E.J.; Korta, D.Z.; Dalfo, D. Physiological control of germline development. Adv. Exp. Med. Biol. 2013, 757, 101–131. [Google Scholar] [PubMed]
- Okuda, H.; Kiuchi, H.; Takao, T.; Miyagawa, Y.; Tsujimura, A.; Nonomura, N.; Miyata, H.; Okabe, M.; Ikawa, M.; Kawakami, Y.; et al. A novel transcriptional factor Nkapl is a germ cell-specific suppressor of Notch signaling and is indispensable for spermatogenesis. PLoS ONE 2015, 10, e0124293. [Google Scholar] [CrossRef] [PubMed]
- Brenner, S. The genetics of Caenorhabditis elegans. Genetics 1974, 77, 71–94. [Google Scholar] [PubMed]
- Zhuang, Z.; Zhao, Y.; Wu, Q.; Li, M.; Liu, H.; Sun, L.; Gao, W.; Wang, D. Adverse effects from clenbuterol and ractopamine on nematode Caenorhabditis elegans and the underlying mechanism. PLoS ONE 2014, 9, e85482. [Google Scholar] [CrossRef] [PubMed]
- Ruan, Q.L.; Ju, J.J.; Li, Y.H.; Li, X.B.; Liu, R.; Liang, G.Y.; Zhang, J.; Pu, Y.P.; Wang, D.Y.; Yin, L.H. Chlorpyrifos exposure reduces reproductive capacity owing to a damaging effect on gametogenesis in the nematode Caenorhabditis elegans. J. Appl. Toxicol. 2012, 32, 527–535. [Google Scholar] [CrossRef] [PubMed]
- Poullet, N.; Vielle, A.; Gimond, C.; Ferrari, C.; Braendle, C. Evolutionarily divergent thermal sensitivity of germline development and fertility in hermaphroditic Caenorhabditis nematodes. Evol. Dev. 2015, 17, 380–397. [Google Scholar] [CrossRef] [PubMed]
- Crittenden, S.L.; Kimble, J. Analysis of the C. elegans germline stem cell region. Methods Mol. Biol. 2008, 450, 27–44. [Google Scholar] [PubMed]
- Gartner, A.; Milstein, S.; Ahmed, S.; Hodgkin, J.; Hengartner, M.O. A conserved checkpoint pathway mediates DNA damage—Induced apoptosis and cell cycle arrest in C. elegans. Mol. Cell 2000, 5, 435–443. [Google Scholar] [CrossRef]
- Porta-de-la-Riva, M.; Fontrodona, L.; Villanueva, A.; Ceron, J. Basic Caenorhabditis elegans methods: Synchronization and observation. J. Vis. Exp. 2012, 64, e4019. [Google Scholar] [CrossRef] [PubMed]
- Austin, J.; Kimble, J. Glp-1 is required in the germ line for regulation of the decision between mitosis and meiosis in C. elegans. Cell 1987, 51, 589–599. [Google Scholar] [CrossRef]
- Bukhari, S.I.; Vasquez-Rifo, A.; Gagne, D.; Paquet, E.R.; Zetka, M.; Robert, C.; Masson, J.Y.; Simard, M.J. The microrna pathway controls germ cell proliferation and differentiation in C. elegans. Cell Res. 2012, 22, 1034–1045. [Google Scholar] [CrossRef] [PubMed]
- Murray, R.L.; Kozlowska, J.L.; Cutter, A.D. Heritable determinants of male fertilization success in the nematode Caenorhabditis elegans. BMC Evol. Biol. 2011, 11, 99. [Google Scholar] [CrossRef] [PubMed]
- Singaravelu, G.; Chatterjee, I.; Marcello, M.R.; Singson, A. Isolation and in vitro activation of Caenorhabditis elegans sperm. J. Vis. Exp. 2011, 47, e2336. [Google Scholar]
- Kubagawa, H.M.; Watts, J.L.; Corrigan, C.; Edmonds, J.W.; Sztul, E.; Browse, J.; Miller, M.A. Oocyte signals derived from polyunsaturated fatty acids control sperm recruitment in vivo. Nat. Cell Biol. 2006, 8, 1143–1148. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bailly, A.; Gartner, A. Germ cell apoptosis and DNA damage responses. Adv. Exp. Med. Biol. 2013, 757, 249–276. [Google Scholar] [PubMed]
- Holeckova, B.; Sivikova, K.; Dianovsky, J.; Galdikova, M. Effect of triazole pesticide formulation on bovine culture cells. J. Environ. Sci. Health Part B 2013, 48, 1080–1088. [Google Scholar] [CrossRef] [PubMed]
- Zarn, J.A.; Bruschweiler, B.J.; Schlatter, J.R. Azole fungicides affect mammalian steroidogenesis by inhibiting sterol 14 alpha-demethylase and aromatase. Environ. Health Perspect. 2003, 111, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Hoss, S.; Weltje, L. Endocrine disruption in nematodes: Effects and mechanisms. Ecotoxicology 2007, 16, 15–28. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zhao, Y.; Sun, W.; Shimabukuro, K.; Miao, L. Transformation: How do nematode sperm become activated and crawl? Protein Cell 2012, 3, 755–761. [Google Scholar] [CrossRef] [PubMed]
- LaMunyon, C.W.; Ward, S. Larger sperm outcompete smaller sperm in the nematode Caenorhabditis elegans. Proc. R. Soc. B Biol. Sci. 1998, 265, 1997–2002. [Google Scholar] [CrossRef] [PubMed]
- Dou, J.; Chen, L.; Hu, Y.; Miao, L. Cholesterol and the biosynthesis of glycosphingolipids are required for sperm activation in Caenorhabditis elegans. BBA Mol. Cell Biol. Lipids 2012, 1821, 934–942. [Google Scholar] [CrossRef] [PubMed]
- Singaravelu, G.; Singson, A. Calcium signaling surrounding fertilization in the nematode Caenorhabditis elegans. Cell Calcium 2013, 53, 2–9. [Google Scholar] [CrossRef] [PubMed]
- Heusinkveld, H.J.; Molendijk, J.; van den Berg, M.; Westerink, R.H. Azole fungicides disturb intracellular Ca2+ in an additive manner in dopaminergic PC12 cells. Toxicol. Sci. 2013, 134, 374–381. [Google Scholar] [CrossRef] [PubMed]
- McKnight, K.; Hoang, H.D.; Prasain, J.K.; Brown, N.; Vibbert, J.; Hollister, K.A.; Moore, R.; Ragains, J.R.; Reese, J.; Miller, M.A. Neurosensory perception of environmental cues modulates sperm motility critical for fertilization. Science 2014, 344, 754–757. [Google Scholar] [CrossRef] [PubMed]
- Dalfo, D.; Michaelson, D.; Hubbard, E.J. Sensory regulation of the C. elegans germline through TGF-beta-dependent signaling in the niche. Curr. Biol. 2012, 22, 712–719. [Google Scholar] [PubMed]
- Gumienny, T.L.; Savage-Dunn, C. TGF-Beta Signaling in C. elegans. Avaliable online: http://www.wormbook.org/chapters/www_tgfbsignal.2/TGFbetasignal.pdf (accessed on 10 July 2013).
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
act-1 | ATGTGTGACGACGAGGTT | GAAGCACTTGCGGTGAAC |
daf-7 | TTACGAGAAGAACGAGGATG | TTGGAAGTTGAATGCTGATAC |
daf-1 | GTTGCTGGACAAGAAGGC | ACCAAGAAGTGGGCGTGA |
daf-4 | GGTGATGAGTATTGGATTGTG | ATTGGCTTCTTTGGGTGT |
daf-3 | TTACAACCATCAACAGTCACC | TCCAAAACCTCACCGTCT |
daf-5 | CGAAAACCTCAACATCACA | CATCCTCCTCCAAGTCATC |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Zhang, M.; Li, S.; Lv, R.; Chen, P.; Liu, R.; Liang, G.; Yin, L. The Use of the Nematode Caenorhabditis elegans to Evaluate the Adverse Effects of Epoxiconazole Exposure on Spermatogenesis. Int. J. Environ. Res. Public Health 2016, 13, 993. https://doi.org/10.3390/ijerph13100993
Li Y, Zhang M, Li S, Lv R, Chen P, Liu R, Liang G, Yin L. The Use of the Nematode Caenorhabditis elegans to Evaluate the Adverse Effects of Epoxiconazole Exposure on Spermatogenesis. International Journal of Environmental Research and Public Health. 2016; 13(10):993. https://doi.org/10.3390/ijerph13100993
Chicago/Turabian StyleLi, Yunhui, Minhui Zhang, Shaojun Li, Rongrong Lv, Pan Chen, Ran Liu, Geyu Liang, and Lihong Yin. 2016. "The Use of the Nematode Caenorhabditis elegans to Evaluate the Adverse Effects of Epoxiconazole Exposure on Spermatogenesis" International Journal of Environmental Research and Public Health 13, no. 10: 993. https://doi.org/10.3390/ijerph13100993
APA StyleLi, Y., Zhang, M., Li, S., Lv, R., Chen, P., Liu, R., Liang, G., & Yin, L. (2016). The Use of the Nematode Caenorhabditis elegans to Evaluate the Adverse Effects of Epoxiconazole Exposure on Spermatogenesis. International Journal of Environmental Research and Public Health, 13(10), 993. https://doi.org/10.3390/ijerph13100993