Chitosan Oligosaccharide Attenuates Nonalcoholic Fatty Liver Disease Induced by High Fat Diet through Reducing Lipid Accumulation, Inflammation and Oxidative Stress in C57BL/6 Mice
Abstract
1. Introduction
2. Results
2.1. Effects of COS on Serum Biochemical Parameters
2.2. Effects of COS on Hepatic Steatosis
2.3. Effects of COS on Hepatic Inflammation Response
2.4. Effect of COS on Hepatic Oxidant Stress
2.5. Effects of COS on Hepatic Protein Expression
2.6. Correlation between the Studied Variables
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals and Experimental Design
4.3. Serum Biochemical Analyses
4.4. Hepatic Biochemical Assays
4.5. Histological Staining
4.6. Immunohistochemistry and ELISA
4.7. Quantitative Real-Time PCR
4.8. Western Blot Analysis
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Sanyal, A.J. Past, present and future perspectives in nonalcoholic fatty liver disease. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 377–386. [Google Scholar] [CrossRef] [Scilit]
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef] [Scilit]
- Marchesini, G.; Bugianesi, E.; Forlani, G.; Cerrelli, F.; Lenzi, M.; Manini, R.; Natale, S.; Vanni, E.; Villanova, N.; Melchionda, N.; et al. Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome. Hepatology 2003, 37, 917–923. [Google Scholar] [CrossRef] [Scilit]
- Younossi, Z.; Tacke, F.; Arrese, M.; Sharma, B.C.; Mostafa, I.; Bugianesi, E.; Wong, V.W.S.; Yilmaz, Y.; George, J.; Fan, J.; et al. Global perspectives on nonalcoholic fatty liver disease and nonalcoholic dteatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef] [Scilit]
- Nakamura, A.; Terauchi, Y. Lessons from Mouse Models of High-Fat Diet-Induced NAFLD. Int. J. Mol. Sci. 2013, 14, 21240–21257. [Google Scholar] [CrossRef] [Scilit]
- Van Saun, M.N.; Lee, I.K.; Washington, M.K.; Matrisian, L.; Gorden, D.L. High fat diet induced hepatic steatosis establishes a permissive microenvironment for colorectal metastases and promotes primary dysplasia in a murine model. Am. J. Pathol. 2009, 175, 355–364. [Google Scholar] [CrossRef] [Scilit]
- Lv, Y.; Gao, X.; Luo, Y.; Fan, W.; Shen, T.; Ding, C.; Yao, M.; Song, S.; Yan, L. Apigenin ameliorates HFD-induced NAFLD through regulation of the XO/NLRP3 pathways. J. Nutr. Biochem. 2019, 71, 110–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kirpich, I.A.; Gobejishvili, L.N.; Homme, M.B.; Waigel, S.; Cave, M.; Arteel, G.; Barve, S.S.; McClain, C.J.; Deaciuc, I.V. Integrated hepatic transcriptome and proteome analysis of mice with high-fat diet-induced nonalcoholic fatty liver disease. J. Nutr. Biochem. 2011, 22, 38–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.; Ho, C.T.; Long, P.; Meng, Q.; Zhang, L.; Wan, X. Preventive efficiency of green tea and its components on non-alcoholic fatty liver disease. J. Agric. Food Chem. 2019, 67, 5306–5317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lavine, J.E.; Schwimmer, J.B.; Van Natta, M.L.; Molleston, J.P.; Murray, K.F.; Rosenthal, P.; Abrams, S.H.; Scheimann, A.O.; Sanyal, A.J.; Chalasani, N.; et al. Effect of vitamin E or metformin for treatment of nonalcoholic fatty liver disease in children and adolescents: The TONIC randomized controlled trial. JAMA 2011, 305, 1659–1668. [Google Scholar] [CrossRef] [Scilit]
- Rinaudo, M. Chitin and chitosan: Properties and applications. Prog. Polym. Sci. 2006, 31, 603–632. [Google Scholar] [CrossRef] [Scilit]
- Zou, P.; Yang, X.; Wang, J.; Li, Y.; Yu, H.; Zhang, Y.; Liu, G. Advances in characterisation and biological activities of chitosan and chitosan oligosaccharides. Food Chem. 2016, 190, 1174–1181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muanprasat, C.; Chatsudthipong, V. Chitosan oligosaccharide: Biological activities and potential therapeutic applications. Pharmacol. Therapeut. 2017, 170, 80–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naveed, M.; Phil, L.; Sohail, M.; Hasnat, M.; Baig, M.M.F.A.; Ihsan, A.U.; Shumzaid, M.; Kakar, M.U.; Khan, T.M.; Akabar, M.D.; et al. Chitosan oligosaccharide (COS): An overview. Int. J. Biol. Macromol. 2019, 129, 827–843. [Google Scholar] [CrossRef] [Scilit]
- Choi, E.H.; Yang, H.P.; Chun, H.S. Chitooligosaccharide ameliorates diet-induced obesity in mice and affects adipose gene expression involved in adipogenesis and inflammation. Nutr. Res. 2012, 32, 218–228. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.; Yuan, X.; Cheng, G.; Jiao, S.; Feng, C.; Zhao, X.; Yin, H.; Du, Y.; Liu, H. Chitosan oligosaccharides improve the disturbance in glucose metabolism and reverse the dysbiosis of gut microbiota in diabetic mice. Carbohyd. Polym. 2018, 190, 77–86. [Google Scholar] [CrossRef] [Scilit]
- Bai, Y.; Zheng, J.; Yuan, X.; Jiao, S.; Feng, C.; Du, Y.; Liu, H.; Zheng, L. Chitosan Oligosaccharides Improve Glucolipid Metabolism Disorder in Liver by Suppression of Obesity-Related Inflammation and Restoration of Peroxisome Proliferator-Activated Receptor Gamma (PPARγ). Mar. Drugs 2018, 16, 455. [Google Scholar] [CrossRef] [Scilit]
- Musso, G.; Cassader, M.; Gambino, R. Non-alcoholic steatohepatitis: Emerging molecular targets and therapeutic strategies. Nat. Rev. Drug Discov. 2016, 15, 249–274. [Google Scholar] [CrossRef] [Scilit]
- Fan, J.G.; Cao, H.X. Role of diet and nutritional management in non-alcoholic fatty liver disease. J. Gastroenterol. Hepatol. 2013, 28, 81–87. [Google Scholar] [CrossRef] [Scilit]
- Pan, M.H.; Lai, C.S.; Tsai, M.L.; Ho, C.T. Chemoprevention of nonalcoholic fatty liver disease by dietary natural compounds. Mol. Nutr. Food Res. 2014, 58, 147–171. [Google Scholar] [CrossRef] [Scilit]
- Nair, A.B.; Jacob, S.A. Simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buettner, R.; Scholmerich, J.; Bollheimer, L.C. High-fat diets: Modeling the metabolic disorders of human obesity in rodents. Obesity 2007, 15, 798–808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donnelly, K.L.; Smith, C.I.; Schwarzenberg, S.J.; Jessurun, J.; Boldt, M.D.; Parks, E.J. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J. Clin. Investg. 2005, 115, 1343. [Google Scholar] [CrossRef] [PubMed]
- Sumiyoshi, M.; Kimura, Y. Low molecular weight chitosan inhibits obesity induced by feeding a high-fat diet long-term in mice. J. Pharm. Pharmacol. 2010, 58, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.T.; Yang, Q.Y.; Huang, G.D.; Ding, C.; Cao, P.Q.; Huang, L.L.; Xiao, T.C.; Guo, J.; Su, Z.Q. Hypolipidemic effects of chitosan and its derivatives in hyperlipidemic rats induced by a high-fat diet. Food Nutr. Res. 2016, 60, 31137. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.C.; Huang, C.N.; Yeh, D.M.; Wang, S.J.; Peng, C.H.; Wang, C.J. Oat prevents obesity and abdominal fat distribution, and improves liver function in humans. Plant Foods Hum. Nutr. 2013, 68, 18–23. [Google Scholar] [CrossRef] [Scilit]
- Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Investig. 2002, 109, 1125–1131. [Google Scholar] [CrossRef]
- Ferré, P.; Foufelle, F. SREBP-1c Transcription Factor and Lipid Homeostasis: Clinical Perspective. Horm. Res. Paediat. 2007, 68, 72–82. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez, F.J.; Shah, Y.M. PPARalpha: Mechanism of species differences and hepatocarcinogenesis of peroxisome proliferators. Toxicology 2008, 246, 2–8. [Google Scholar] [CrossRef] [Scilit]
- Abdelmegeed, M.A.; Yoo, S.H.; Henderson, L.E.; Gonzalez, F.J.; Song, B.J. PPARα expression protects male mice from high fat-induced nonalcoholic fatty liver. J. Nutr. 2011, 141, 603–610. [Google Scholar] [CrossRef] [Scilit]
- Pawlak, M.; Lefebvre, P.; Staels, B. Molecular mechanism of PPARα action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 2015, 62, 720–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kazankov, K.; Jørgensen, S.M.D.; Thomsen, K.L.; Møller, H.J.; Vilstrup, H.; George, J.; Schuppan, D.; Grønbæk, H. The role of macrophages in nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 145–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carter-Kent, C.; Zein, N.N.; Feldstein, A.E. Cytokines in the pathogenesis of fatty liver and disease progression to steatohepatitis: Implications for treatment. Am. J. Gastroenterol. 2008, 103, 1036–1042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Yang, S.; Lin, H.; Huang, J.; Watkins, P.A.; Moser, A.B.; Desimone, C.; Song, X.Y.; Diehl, A.M. Probiotics and antibodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty liver disease. Hepatology 2003, 37, 343–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krenkel, O.; Tacke, F. Liver macrophages in tissue homeostasis and disease. Nat. Rev. Immunol. 2017, 17, 306–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tacke, F.; Zimmermann, H.W. Macrophage heterogeneity in liver injury and fibrosis. J. Hepatol. 2014, 60, 1090–1096. [Google Scholar] [CrossRef] [Scilit]
- Matsuzawa, N.; Takamura, T.; Kurita, S.; Misu, H.; Ota, T.; Ando, H.; Yokoyama, M.; Honda, M.; Zen, Y.; Nakanuma, Y.; et al. Lipid-induced oxidative stress causes steatohepatitis in mice fed an atherogenic diet. Hepatology 2007, 46, 1392–1403. [Google Scholar] [CrossRef] [Scilit]
- Allard, J.P.; Aghdassi, E.; Mohammed, S.; Raman, M.; Avand, G.; Arendt, B.M.; Jalali, P.; Kandasamy, T.; Prayitno, N.; Sherman, M.; et al. Nutritional assessment and hepatic fatty acid composition in nonalcoholic fatty liver disease (NAFLD): A cross-sectional study. J. Hepatol. 2008, 48, 300–307. [Google Scholar] [CrossRef] [Scilit]
- Salomone, F.; Godos, J.; Zelber–Sagi, S. Natural antioxidants for non–alcoholic fatty liver disease: Molecular targets and clinical perspectives. Liver Int. 2016, 36, 5–20. [Google Scholar] [CrossRef] [Scilit]
- Tkachev, V.; Menshchikova, E.; Zenkov, N. Mechanism of the Nrf2/Keap1/ARE signaling system. Biochemistry (Moscow) 2011, 76, 407–422. [Google Scholar] [CrossRef] [Scilit]
- Xu, Q.S.; Liu, M.S.; Liu, Q.S.; Wang, W.X.; Du, Y.G.; Yin, H. The inhibition of LPS-induced inflammation in RAW264.7 macrophages via the PI3K/Akt pathway by highly N-acetylated chitooligosaccharide. Carbohydr. Polym. 2017, 174, 1138–1143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.; Cha, Y.N.; Surh, Y.J. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders. Mutat. Res. Fund. Mol. Mech. Mutagen. 2010, 690, 12–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeon, S.M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viollet, B.; Foretz, M.; Guigas, B.; Horman, S.; Dentin, R.; Bertrand, L.; Hue, L.; Andreelli, F. Activation of AMP-activated protein kinase in the liver: A new strategy for the management of metabolic hepatic disorders. J. Physiol. 2006, 574, 41–53. [Google Scholar] [CrossRef] [Scilit]
- Muanprasat, C.; Wongkrasant, P.; Satitsri, S.; Moonwiriyakit, A.; Pongkorpsakol, P.; Mattaveewong, T.; Pichyangkura, R.; Chatsudthipong, V. Activation of AMPK by chitosan oligosaccharide in intestinal epithelial cells: Mechanism of action and potential applications in intestinal disorders. Biochem. Pharmacol. 2015, 96, 225–236. [Google Scholar] [CrossRef] [Scilit]
- Naveira, L.N.; Mercado, N.; Ito, K. AMPK signalling regulates Nrf2 localization and activity via sirtuins in a monocytic cell line. Eur. Respir. J. 2011, 38 Suppl 55. [Google Scholar]
- Zimmermann, K.; Baldinger, J.; Mayerhofer, B.; Atanasov, A.G.; Dirsch, V.M.; Heiss, E.H. Activated AMPK boosts the Nrf2/HO-1 signaling axis—A role for the unfolded protein response. Free Radic. Biol. Med. 2015, 88, 417–426. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.; Fu, C.; Huang, L.; Jiang, Y.; Deng, X.; Guo, J.; Su, Z. Anti-obesity effect of chitosan oligosaccharide capsules (COSCs) in obese rats by ameliorating leptin resistance and adipogenesis. Mar. Drugs 2018, 16, 198. [Google Scholar] [CrossRef] [Scilit]







| NCD | HFD | HFDLC | HFDHC | |
|---|---|---|---|---|
| TC (mmol/L) | 3.03 ± 0.068 c | 5.88 ± 0.295 a | 5.54 ± 0.307 a | 4.82 ± 0.151 b |
| TG (mmol/L) | 0.44 ± 0.020 | 0.48 ± 0.026 | 0.45 ± 0.018 | 0.44 ± 0.025 |
| HDL (mmol/L) | 3.48 ± 0.234 b | 6.01 ± 0.250 a | 6.48 ± 0.188 a | 6.43 ± 0.294 a |
| LDL (mmol/L) | 0.53 ± 0.032 c | 1.28 ± 0.142 a | 1.01 ± 0.112 a,b | 0.98 ± 0.044 b |
| LDL/HDL | 0.154 ± 0.010 b | 0.216 ± 0.027 a | 0.155 ± 0.015 b | 0.154 ± 0.007 b |
| AST (U/L) | 14.06 ± 1.234 b | 21.36 ± 2.668 a | 17.61 ± 1.095 a,b | 14.89 ± 0.810 b |
| ALT (U/L) | 7.55 ± 0.688 b | 9.98 ± 0.438 a | 8.41 ± 0.559 a,b | 7.81 ± 0.555 b |
| Gene | Forward primer (5’−3’) | Reverse primer (5’−3’) |
|---|---|---|
| SREBP-1c | GCCATCGACTACATCCGCTTCTTG | TGCCTCCTCCACTGCCACAAG |
| FAS | GGAGGTGGTGATAGCCGGTAT | TGGGTAATCCATAGAGCCCAG |
| PPARα | CAGGAGAGCAGGGATTTGCA | CCTACGCTCAGCCCTCTTCAT |
| CPT-1 | ATGGCAGAGGCTCACCAAGC | GATGAACTTCCAGGAGTGC |
| F4/80 | TGGCAAGCATCATGGCATACCTG | TGACGGTTGAGCAGACAGTGAATG |
| CD11c | AGACGTGCCAGTCAGCATCAAC | GCAGTCAGCGATGGAGCAGTC |
| NQO1 | AGGCTGCTGTAGAGGCTCTGAAG | GCTCAGGCGTCCTTCCTTATATGC |
| HO-1 | GAGCAGAACCAGCCTGAACTA | GGTACAAGGAAGCCATCACCA |
| GSTA1 | TGCCCAATCATTTCAGTCAG | CCAGAGCCATTCTCAACTA |
| β-actin | CGTTGACATCCGTAAAGACC | AACAGTCCGCCTAGAAGCAC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tao, W.; Sun, W.; Liu, L.; Wang, G.; Xiao, Z.; Pei, X.; Wang, M. Chitosan Oligosaccharide Attenuates Nonalcoholic Fatty Liver Disease Induced by High Fat Diet through Reducing Lipid Accumulation, Inflammation and Oxidative Stress in C57BL/6 Mice. Mar. Drugs 2019, 17, 645. https://doi.org/10.3390/md17110645
Tao W, Sun W, Liu L, Wang G, Xiao Z, Pei X, Wang M. Chitosan Oligosaccharide Attenuates Nonalcoholic Fatty Liver Disease Induced by High Fat Diet through Reducing Lipid Accumulation, Inflammation and Oxidative Stress in C57BL/6 Mice. Marine Drugs. 2019; 17(11):645. https://doi.org/10.3390/md17110645
Chicago/Turabian StyleTao, Wenjing, Wanjing Sun, Lujie Liu, Geng Wang, Zhiping Xiao, Xun Pei, and Minqi Wang. 2019. "Chitosan Oligosaccharide Attenuates Nonalcoholic Fatty Liver Disease Induced by High Fat Diet through Reducing Lipid Accumulation, Inflammation and Oxidative Stress in C57BL/6 Mice" Marine Drugs 17, no. 11: 645. https://doi.org/10.3390/md17110645
APA StyleTao, W., Sun, W., Liu, L., Wang, G., Xiao, Z., Pei, X., & Wang, M. (2019). Chitosan Oligosaccharide Attenuates Nonalcoholic Fatty Liver Disease Induced by High Fat Diet through Reducing Lipid Accumulation, Inflammation and Oxidative Stress in C57BL/6 Mice. Marine Drugs, 17(11), 645. https://doi.org/10.3390/md17110645
