Inhibiting MiR-33a-3p Expression Fails to Enhance ApoAI-Mediated Cholesterol Efflux in Pro-Inflammatory Endothelial Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. LPS Challenge in iMAECs
2.3. Plasmid DNA Transfection Within LPS-Challenged iMAECs
2.4. End-Point RT-PCR for Small RNA
2.5. RT-qPCR (Small RNA and mRNA)
2.6. Plasmid Transfection Efficiency Within iMAECs
2.7. Western Blotting
2.8. Cholesterol Efflux
2.9. Statistical Analyses
3. Results
3.1. Pro-Inflammatory Endothelial Cells Demonstrate Increased MiR-33a-3p Expression
3.2. LPS-Challenged iMAECs Exhibit Robust Plasmid DNA Transfection Efficiency
3.3. Transfecting Pro-Inflammatory iMAECs with pA3p Upregulates NPC1 Expression
3.4. Transfecting Pro-Inflammatory iMAECs with pA3p Fails to Enhance ABCA1-Dependent Cholesterol Efflux
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hetherington, I.; Totary-Jain, H. Anti-atherosclerotic therapies: Milestones, challenges, and emerging innovations. Mol. Ther. 2022, 30, 3106–3117. [Google Scholar] [CrossRef]
- Mathers, C.D.; Loncar, D. Projections of global mortality and burden of disease from 2002 to 2030. PLoS Med. 2006, 3, e442. [Google Scholar] [CrossRef]
- Cockerill, G.; Xu, Q. Atherosclerosis. In Mechanisms of Vascular Disease: A Reference Book for Vascular Specialists; Fitridge, R., Thompson, M., Eds.; Cambridge University Press: Cambridge, UK, 2011. [Google Scholar]
- Bjorkegren, J.L.M.; Lusis, A.J. Atherosclerosis: Recent developments. Cell 2022, 185, 1630–1645. [Google Scholar] [CrossRef] [PubMed]
- Taleb, S. Inflammation in atherosclerosis. Arch. Cardiovasc. Dis. 2016, 109, 708–715. [Google Scholar] [CrossRef]
- Mani, A.M.; Chattopadhyay, R.; Singh, N.K.; Rao, G.N. Cholesterol crystals increase vascular permeability by inactivating SHP2 and disrupting adherens junctions. Free Radic. Biol. Med. 2018, 123, 72–84. [Google Scholar] [CrossRef] [PubMed]
- Gimbrone, M.A., Jr.; Garcia-Cardena, G. Endothelial Cell Dysfunction and the Pathobiology of Atherosclerosis. Circ. Res. 2016, 118, 620–636. [Google Scholar] [CrossRef] [PubMed]
- Higashi, Y. Endothelial Function in Dyslipidemia: Roles of LDL-Cholesterol, HDL-Cholesterol and Triglycerides. Cells 2023, 12, 1293. [Google Scholar] [CrossRef]
- Mundi, S.; Massaro, M.; Scoditti, E.; Carluccio, M.A.; van Hinsbergh, V.W.M.; Iruela-Arispe, M.L.; De Caterina, R. Endothelial permeability, LDL deposition, and cardiovascular risk factors-a review. Cardiovasc. Res. 2018, 114, 35–52. [Google Scholar] [CrossRef]
- Medina-Leyte, D.J.; Zepeda-Garcia, O.; Dominguez-Perez, M.; Gonzalez-Garrido, A.; Villarreal-Molina, T.; Jacobo-Albavera, L. Endothelial Dysfunction, Inflammation and Coronary Artery Disease: Potential Biomarkers and Promising Therapeutical Approaches. Int. J. Mol. Sci. 2021, 22, 3850. [Google Scholar] [CrossRef] [PubMed]
- Medrano-Bosch, M.; Simon-Codina, B.; Jimenez, W.; Edelman, E.R.; Melgar-Lesmes, P. Monocyte-endothelial cell interactions in vascular and tissue remodeling. Front. Immunol. 2023, 14, 1196033. [Google Scholar] [CrossRef]
- Hernandez, G.E.; Iruela-Arispe, M.L. The many flavors of monocyte/macrophage--endothelial cell interactions. Curr. Opin. Hematol. 2020, 27, 181–189. [Google Scholar] [CrossRef] [PubMed]
- Schubert, S.Y.; Benarroch, A.; Monter-Solans, J.; Edelman, E.R. Monocyte activation state regulates monocyte-induced endothelial proliferation through Met signaling. Blood 2010, 115, 3407–3412. [Google Scholar] [CrossRef]
- Jebari-Benslaiman, S.; Galicia-Garcia, U.; Larrea-Sebal, A.; Olaetxea, J.R.; Alloza, I.; Vandenbroeck, K.; Benito-Vicente, A.; Martin, C. Pathophysiology of Atherosclerosis. Int. J. Mol. Sci. 2022, 23, 3346. [Google Scholar] [CrossRef]
- Theofilis, P.; Oikonomou, E.; Tsioufis, K.; Tousoulis, D. The Role of Macrophages in Atherosclerosis: Pathophysiologic Mechanisms and Treatment Considerations. Int. J. Mol. Sci. 2023, 24, 9568. [Google Scholar] [CrossRef]
- Moore, K.J.; Sheedy, F.J.; Fisher, E.A. Macrophages in atherosclerosis: A dynamic balance. Nat. Rev. Immunol. 2013, 13, 709–721. [Google Scholar] [CrossRef] [PubMed]
- Tabas, I.; Garcia-Cardena, G.; Owens, G.K. Recent insights into the cellular biology of atherosclerosis. J. Cell Biol. 2015, 209, 13–22. [Google Scholar] [CrossRef] [PubMed]
- Tete, S.; Tripodi, D.; Rosati, M.; Conti, F.; Maccauro, G.; Saggini, A.; Salini, V.; Cianchetti, E.; Caraffa, A.; Antinolfi, P.; et al. Endothelial cells, cholesterol, cytokines, and aging. Int. J. Immunopathol. Pharmacol. 2012, 25, 355–363. [Google Scholar] [CrossRef]
- Jiang, H.; Zhou, Y.; Nabavi, S.M.; Sahebkar, A.; Little, P.J.; Xu, S.; Weng, J.; Ge, J. Mechanisms of Oxidized LDL-Mediated Endothelial Dysfunction and Its Consequences for the Development of Atherosclerosis. Front. Cardiovasc. Med. 2022, 9, 925923. [Google Scholar] [CrossRef] [PubMed]
- Kwak, B.R.; Back, M.; Bochaton-Piallat, M.L.; Caligiuri, G.; Daemen, M.J.; Davies, P.F.; Hoefer, I.E.; Holvoet, P.; Jo, H.; Krams, R.; et al. Biomechanical factors in atherosclerosis: Mechanisms and clinical implications. Eur. Heart J. 2014, 35, 3013–3020. [Google Scholar] [CrossRef]
- Tamargo, I.A.; Baek, K.I.; Kim, Y.; Park, C.; Jo, H. Flow-induced reprogramming of endothelial cells in atherosclerosis. Nat. Rev. Cardiol. 2023, 20, 738–753. [Google Scholar] [CrossRef]
- Nigro, P.; Abe, J.; Berk, B.C. Flow shear stress and atherosclerosis: A matter of site specificity. Antioxid. Redox Signal 2011, 15, 1405–1414. [Google Scholar] [CrossRef] [PubMed]
- Pahwa, R.; Jialal, I. Disclosure: Ishwarlal Jialal declares no relevant financial relationships with ineligible companies. In Atherosclerosis; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar]
- Davies, P.F.; Civelek, M.; Fang, Y.; Fleming, I. The atherosusceptible endothelium: Endothelial phenotypes in complex haemodynamic shear stress regions in vivo. Cardiovasc. Res. 2013, 99, 315–327. [Google Scholar] [CrossRef]
- Gusev, E.; Sarapultsev, A. Atherosclerosis and Inflammation: Insights from the Theory of General Pathological Processes. Int. J. Mol. Sci. 2023, 24, 7910. [Google Scholar] [CrossRef] [PubMed]
- Botts, S.R.; Fish, J.E.; Howe, K.L. Dysfunctional Vascular Endothelium as a Driver of Atherosclerosis: Emerging Insights into Pathogenesis and Treatment. Front. Pharmacol. 2021, 12, 787541. [Google Scholar] [CrossRef]
- Li, H.; Zhou, W.Y.; Xia, Y.Y.; Zhang, J.X. Endothelial Mechanosensors for Atheroprone and Atheroprotective Shear Stress Signals. J. Inflamm. Res. 2022, 15, 1771–1783. [Google Scholar] [CrossRef]
- Green, J.P.; Souilhol, C.; Xanthis, I.; Martinez-Campesino, L.; Bowden, N.P.; Evans, P.C.; Wilson, H.L. Atheroprone flow activates inflammation via endothelial ATP-dependent P2X7-p38 signalling. Cardiovasc. Res. 2018, 114, 324–335. [Google Scholar] [CrossRef] [PubMed]
- Aryal, B.; Singh, A.K.; Rotllan, N.; Price, N.; Fernandez-Hernando, C. MicroRNAs and lipid metabolism. Curr. Opin. Lipidol. 2017, 28, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Citrin, K.M.; Fernandez-Hernando, C.; Suarez, Y. MicroRNA regulation of cholesterol metabolism. Ann. N. Y. Acad. Sci. 2021, 1495, 55–77. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Tussy, P.; Ruz-Maldonado, I.; Fernandez-Hernando, C. MicroRNAs and Circular RNAs in Lipoprotein Metabolism. Curr. Atheroscler. Rep. 2021, 23, 33. [Google Scholar] [CrossRef] [PubMed]
- Wagschal, A.; Najafi-Shoushtari, S.H.; Wang, L.; Goedeke, L.; Sinha, S.; deLemos, A.S.; Black, J.C.; Ramirez, C.M.; Li, Y.; Tewhey, R.; et al. Genome-wide identification of microRNAs regulating cholesterol and triglyceride homeostasis. Nat. Med. 2015, 21, 1290–1297. [Google Scholar] [CrossRef]
- Xiang, Y.; Mao, L.; Zuo, M.L.; Song, G.L.; Tan, L.M.; Yang, Z.B. The Role of MicroRNAs in Hyperlipidemia: From Pathogenesis to Therapeutical Application. Mediators Inflamm. 2022, 2022, 3101900. [Google Scholar] [CrossRef] [PubMed]
- Rottiers, V.; Naar, A.M. MicroRNAs in metabolism and metabolic disorders. Nat. Rev. Mol. Cell Biol. 2012, 13, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Ono, K. Functions of microRNA-33a/b and microRNA therapeutics. J. Cardiol. 2016, 67, 28–33. [Google Scholar] [CrossRef] [PubMed]
- Sidorkiewicz, M. Is microRNA-33 an Appropriate Target in the Treatment of Atherosclerosis? Nutrients 2023, 15, 902. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Hernando, C.; Baldan, A. MicroRNAs and Cardiovascular Disease. Curr. Genet. Med. Rep. 2013, 1, 30–38. [Google Scholar] [CrossRef] [PubMed]
- Tanashyan, M.M.; Shabalina, A.A.; Kuznetsova, P.I.; Raskurazhev, A.A. miR-33a and Its Association with Lipid Profile in Patients with Carotid Atherosclerosis. Int. J. Mol. Sci. 2023, 24, 6376. [Google Scholar] [CrossRef]
- Oladosu, O.; Chin, E.; Barksdale, C.; Powell, R.R.; Bruce, T.; Stamatikos, A. Inhibition of miR-33a-5p in Macrophage-like Cells In Vitro Promotes apoAI-Mediated Cholesterol Efflux. Pathophysiology 2024, 31, 117–126. [Google Scholar] [CrossRef] [PubMed]
- Najafi-Shoushtari, S.H.; Kristo, F.; Li, Y.; Shioda, T.; Cohen, D.E.; Gerszten, R.E.; Naar, A.M. MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science 2010, 328, 1566–1569. [Google Scholar] [CrossRef]
- Han, S.Y.; Han, H.B.; Tian, X.Y.; Sun, H.; Xue, D.; Zhao, C.; Jiang, S.T.; He, X.R.; Zheng, W.X.; Wang, J.; et al. MicroRNA-33a-3p suppresses cell migration and invasion by directly targeting PBX3 in human hepatocellular carcinoma. Oncotarget 2016, 7, 42461–42473. [Google Scholar] [PubMed]
- Gao, C.; Wei, J.; Tang, T.; Huang, Z. Role of microRNA-33a in malignant cells. Oncol. Lett. 2020, 20, 2537–2556. [Google Scholar] [PubMed]
- Naar, A.M. Anti-atherosclerosis or No Anti-atherosclerosis: That is the miR-33 question. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 447–448. [Google Scholar] [CrossRef]
- Naar, A.M. miR-33: A Metabolic Conundrum. Trends Endocrinol. Metab. 2018, 29, 667–668. [Google Scholar] [CrossRef]
- Stamatikos, A.; Knight, E.; Vojtech, L.; Bi, L.; Wacker, B.K.; Tang, C.; Dichek, D.A. Exosome-Mediated Transfer of Anti-miR-33a-5p from Transduced Endothelial Cells Enhances Macrophage and Vascular Smooth Muscle Cell Cholesterol Efflux. Hum. Gene Ther. 2020, 31, 219–232. [Google Scholar] [CrossRef]
- Rayner, K.J.; Suarez, Y.; Davalos, A.; Parathath, S.; Fitzgerald, M.L.; Tamehiro, N.; Fisher, E.A.; Moore, K.J.; Fernandez-Hernando, C. MiR-33 contributes to the regulation of cholesterol homeostasis. Science 2010, 328, 1570–1573. [Google Scholar] [CrossRef] [PubMed]
- Goedeke, L.; Vales-Lara, F.M.; Fenstermaker, M.; Cirera-Salinas, D.; Chamorro-Jorganes, A.; Ramirez, C.M.; Mattison, J.A.; de Cabo, R.; Suarez, Y.; Fernandez-Hernando, C. A regulatory role for microRNA 33* in controlling lipid metabolism gene expression. Mol. Cell Biol. 2013, 33, 2339–2352. [Google Scholar] [CrossRef] [PubMed]
- Mao, M.; Lei, H.; Liu, Q.; Chen, Y.; Zhao, L.; Li, Q.; Luo, S.; Zuo, Z.; He, Q.; Huang, W.; et al. Effects of miR-33a-5P on ABCA1/G1-mediated cholesterol efflux under inflammatory stress in THP-1 macrophages. PLoS ONE 2014, 9, e109722. [Google Scholar] [CrossRef] [PubMed]
- Ni, C.W.; Kumar, S.; Ankeny, C.J.; Jo, H. Development of immortalized mouse aortic endothelial cell lines. Vasc. Cell 2014, 6, 7. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.; Jo, H.; Echesabal-Chen, J.; Stamatikos, A. Combined LXR and RXR Agonist Therapy Increases ABCA1 Protein Expression and Enhances ApoAI-Mediated Cholesterol Efflux in Cultured Endothelial Cells. Metabolites 2021, 11, 640. [Google Scholar] [CrossRef] [PubMed]
- Echesabal-Chen, J.; Huang, K.; Vojtech, L.; Oladosu, O.; Esobi, I.; Sachdeva, R.; Vyavahare, N.; Jo, H.; Stamatikos, A. Constructing Lipoparticles Capable of Endothelial Cell-Derived Exosome-Mediated Delivery of Anti-miR-33a-5p to Cultured Macrophages. Curr. Issues Mol. Biol. 2023, 45, 5631–5644. [Google Scholar] [CrossRef]
- Huang, K.; Pitman, M.; Oladosu, O.; Echesabal-Chen, J.; Vojtech, L.; Esobi, I.; Larsen, J.; Jo, H.; Stamatikos, A. The Impact of MiR-33a-5p Inhibition in Pro-Inflammatory Endothelial Cells. Diseases 2023, 11, 88. [Google Scholar] [CrossRef] [PubMed]
- Peterson, M.F.; Otoc, N.; Sethi, J.K.; Gupta, A.; Antes, T.J. Integrated systems for exosome investigation. Methods 2015, 87, 31–45. [Google Scholar] [CrossRef] [PubMed]
- Esobi, I.; Olanrewaju, O.; Echesabal-Chen, J.; Stamatikos, A. Utilizing the LoxP-Stop-LoxP System to Control Transgenic ABC-Transporter Expression In Vitro. Biomolecules 2022, 12, 679. [Google Scholar] [CrossRef] [PubMed]
- Esobi, I.C.; Oladosu, O.; Echesabal-Chen, J.; Powell, R.R.; Bruce, T.; Stamatikos, A. miR-33a Expression Attenuates ABCA1-Dependent Cholesterol Efflux and Promotes Macrophage-Like Cell Transdifferentiation in Cultured Vascular Smooth Muscle Cells. J. Lipids 2023, 2023, 8241899. [Google Scholar] [CrossRef]
- Esobi, I.C.; Barksdale, C.; Heard-Tate, C.; Reigers Powell, R.; Bruce, T.F.; Stamatikos, A. MOVAS Cells: A Versatile Cell Line for Studying Vascular Smooth Muscle Cell Cholesterol Metabolism. Lipids 2021, 56, 413–422. [Google Scholar] [CrossRef] [PubMed]
- Oladosu, O.; Esobi, I.C.; Powell, R.R.; Bruce, T.; Stamatikos, A. Dissecting the Impact of Vascular Smooth Muscle Cell ABCA1 versus ABCG1 Expression on Cholesterol Efflux and Macrophage-like Cell Transdifferentiation: The Role of SR-BI. J. Cardiovasc. Dev. Dis. 2023, 10, 416. [Google Scholar] [CrossRef]
- Fernando, L.; Echesabal-Chen, J.; Miller, M.; Powell, R.R.; Bruce, T.; Paul, A.; Poudyal, N.; Saliutama, J.; Parman, K.; Paul, K.S.; et al. Cholesterol Efflux Decreases TLR4-Target Gene Expression in Cultured Macrophages Exposed to T. brucei Ghosts. Microorganisms 2024, 12, 1730. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.; Garimella, S.; Clay-Gilmour, A.; Vojtech, L.; Armstrong, B.; Bessonny, M.; Stamatikos, A. Comparison of Human Urinary Exosomes Isolated via Ultracentrifugation Alone versus Ultracentrifugation Followed by SEC Column-Purification. J. Pers. Med. 2022, 12, 340. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- White-Gilbertson, S.; Lu, P.; Esobi, I.; Echesabal-Chen, J.; Mulholland, P.J.; Gooz, M.; Ogretmen, B.; Stamatikos, A.; Voelkel-Johnson, C. Polyploid giant cancer cells are dependent on cholesterol for progeny formation through amitotic division. Sci. Rep. 2022, 12, 8971. [Google Scholar] [CrossRef] [PubMed]
- Stamatikos, A.; Dronadula, N.; Ng, P.; Palmer, D.; Knight, E.; Wacker, B.K.; Tang, C.; Kim, F.; Dichek, D.A. ABCA1 Overexpression in Endothelial Cells In Vitro Enhances ApoAI-Mediated Cholesterol Efflux and Decreases Inflammation. Hum. Gene Ther. 2019, 30, 236–248. [Google Scholar] [CrossRef]
- Kong, D.H.; Kim, Y.K.; Kim, M.R.; Jang, J.H.; Lee, S. Emerging Roles of Vascular Cell Adhesion Molecule-1 (VCAM-1) in Immunological Disorders and Cancer. Int. J. Mol. Sci. 2018, 19, 1057. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.; Kaur, R.; Kumari, P.; Pasricha, C.; Singh, R. ICAM-1 and VCAM-1: Gatekeepers in various inflammatory and cardiovascular disorders. Clin. Chim. Acta 2023, 548, 117487. [Google Scholar] [CrossRef]
- Chong, Z.X.; Yeap, S.K.; Ho, W.Y. Transfection types, methods and strategies: A technical review. PeerJ 2021, 9, e11165. [Google Scholar] [CrossRef] [PubMed]
- Kalidasan, V.; Ng, W.H.; Ishola, O.A.; Ravichantar, N.; Tan, J.J.; Das, K.T. A guide in lentiviral vector production for hard-to-transfect cells, using cardiac-derived c-kit expressing cells as a model system. Sci. Rep. 2021, 11, 19265. [Google Scholar] [CrossRef] [PubMed]
- Tietz, S.M.; Berghoff, M. Gene silencing of MK2 in hard-to-transfect human U937 cells. J. Biomol. Tech. 2012, 23, 47–50. [Google Scholar] [CrossRef]
- Rybakovsky, E.; Valenzano, M.C.; DiGuilio, K.M.; Buleza, N.B.; Moskalenko, D.V.; Harty, R.N.; Mullin, J.M. Improving Transient Transfection Efficiency in a Differentiated, Polar Epithelial Cell Layer. J. Biomol. Tech. 2019, 30, 19–24. [Google Scholar] [CrossRef]
- Dong, S.X.M.; Caballero, R.; Ali, H.; Roy, D.L.F.; Cassol, E.; Kumar, A. Transfection of hard-to-transfect primary human macrophages with Bax siRNA to reverse Resveratrol-induced apoptosis. RNA Biol. 2020, 17, 755–764. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Romero, E.; Martinez-Valiente, C.; Garcia-Garcia, G.; Rosal-Vela, A.; Millan, J.M.; Sanz, M.A.; Sanz, G.; Liquori, A.; Cervera, J.V.; Vazquez-Manrique, R.P. PCR-Based Strategy for Introducing CRISPR/Cas9 Machinery into Hematopoietic Cell Lines. Cancers 2023, 15, 4263. [Google Scholar] [CrossRef] [PubMed]
- Berthier, A.; Staels, B.; Lefebvre, P. An optimized protocol with a stepwise approach to identify specific nuclear receptor ligands from cultured mammalian cells. STAR Protoc. 2021, 2, 100658. [Google Scholar] [CrossRef]
- Churov, A.; Summerhill, V.; Grechko, A.; Orekhova, V.; Orekhov, A. MicroRNAs as Potential Biomarkers in Atherosclerosis. Int. J. Mol. Sci. 2019, 20, 5547. [Google Scholar] [CrossRef] [PubMed]
- Feinberg, M.W.; Moore, K.J. MicroRNA Regulation of Atherosclerosis. Circ. Res. 2016, 118, 703–720. [Google Scholar] [CrossRef] [PubMed]
- Giral, H.; Kratzer, A.; Landmesser, U. MicroRNAs in lipid metabolism and atherosclerosis. Best. Pract. Res. Clin. Endocrinol. Metab. 2016, 30, 665–676. [Google Scholar] [CrossRef]
- Li, Z.; Zhao, Y.; Suguro, S.; Suguro, R. MicroRNAs Regulate Function in Atherosclerosis and Clinical Implications. Oxid. Med. Cell Longev. 2023, 2023, 2561509. [Google Scholar] [CrossRef] [PubMed]
- Loyer, X.; Mallat, Z.; Boulanger, C.M.; Tedgui, A. MicroRNAs as therapeutic targets in atherosclerosis. Expert. Opin. Ther. Targets 2015, 19, 489–496. [Google Scholar] [CrossRef]
- Lu, Y.; Thavarajah, T.; Gu, W.; Cai, J.; Xu, Q. Impact of miRNA in Atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2018, 38, e159–e170. [Google Scholar] [CrossRef]
- Menghini, R.; Stohr, R.; Federici, M. MicroRNAs in vascular aging and atherosclerosis. Ageing Res. Rev. 2014, 17, 68–78. [Google Scholar] [CrossRef] [PubMed]
- Vartak, T.; Kumaresan, S.; Brennan, E. Decoding microRNA drivers in atherosclerosis. Biosci. Rep. 2022, 42, BSR20212355. [Google Scholar] [CrossRef]
- Price, N.L.; Goedeke, L.; Suarez, Y.; Fernandez-Hernando, C. miR-33 in cardiometabolic diseases: Lessons learned from novel animal models and approaches. EMBO Mol. Med. 2021, 13, e12606. [Google Scholar] [CrossRef]
- Clerbaux, L.A.; Schultz, H.; Roman-Holba, S.; Ruan, D.F.; Yu, R.; Lamb, A.M.; Bommer, G.T.; Kennell, J.A. The microRNA miR-33 is a pleiotropic regulator of metabolic and developmental processes in Drosophila melanogaster. Dev. Dyn. 2021, 250, 1634–1650. [Google Scholar] [CrossRef]
- Price, N.L.; Fernandez-Tussy, P.; Varela, L.; Cardelo, M.P.; Shanabrough, M.; Aryal, B.; de Cabo, R.; Suarez, Y.; Horvath, T.L.; Fernandez-Hernando, C. microRNA-33 controls hunger signaling in hypothalamic AgRP neurons. Nat. Commun. 2024, 15, 2131. [Google Scholar] [CrossRef] [PubMed]
- Rayner, K.J.; Sheedy, F.J.; Esau, C.C.; Hussain, F.N.; Temel, R.E.; Parathath, S.; van Gils, J.M.; Rayner, A.J.; Chang, A.N.; Suarez, Y.; et al. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis. J. Clin. Investig. 2011, 121, 2921–2931. [Google Scholar] [CrossRef] [PubMed]
- Marquart, T.J.; Wu, J.; Lusis, A.J.; Baldan, A. Anti-miR-33 therapy does not alter the progression of atherosclerosis in low-density lipoprotein receptor-deficient mice. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 455–458. [Google Scholar] [CrossRef] [PubMed]
- Goedeke, L.; Salerno, A.; Ramirez, C.M.; Guo, L.; Allen, R.M.; Yin, X.; Langley, S.R.; Esau, C.; Wanschel, A.; Fisher, E.A.; et al. Long-term therapeutic silencing of miR-33 increases circulating triglyceride levels and hepatic lipid accumulation in mice. EMBO Mol. Med. 2014, 6, 1133–1141. [Google Scholar] [CrossRef] [PubMed]
- Price, N.L.; Zhang, X.; Fernandez-Tussy, P.; Singh, A.K.; Burnap, S.A.; Rotllan, N.; Goedeke, L.; Sun, J.; Canfran-Duque, A.; Aryal, B.; et al. Loss of hepatic miR-33 improves metabolic homeostasis and liver function without altering body weight or atherosclerosis. Proc. Natl. Acad. Sci. USA 2021, 118, e2006478118. [Google Scholar] [CrossRef]
- Karunakaran, D.; Thrush, A.B.; Nguyen, M.A.; Richards, L.; Geoffrion, M.; Singaravelu, R.; Ramphos, E.; Shangari, P.; Ouimet, M.; Pezacki, J.P.; et al. Macrophage Mitochondrial Energy Status Regulates Cholesterol Efflux and Is Enhanced by Anti-miR33 in Atherosclerosis. Circ. Res. 2015, 117, 266–278. [Google Scholar] [CrossRef]
- Ouimet, M.; Ediriweera, H.N.; Gundra, U.M.; Sheedy, F.J.; Ramkhelawon, B.; Hutchison, S.B.; Rinehold, K.; van Solingen, C.; Fullerton, M.D.; Cecchini, K.; et al. MicroRNA-33-dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis. J. Clin. Investig. 2015, 125, 4334–4348. [Google Scholar] [CrossRef] [PubMed]
- Ouimet, M.; Ediriweera, H.; Afonso, M.S.; Ramkhelawon, B.; Singaravelu, R.; Liao, X.; Bandler, R.C.; Rahman, K.; Fisher, E.A.; Rayner, K.J.; et al. microRNA-33 Regulates Macrophage Autophagy in Atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2017, 37, 1058–1067. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.Y.; Li, C.J.; Hou, M.F.; Chu, P.Y. New Insights into the Role of Inflammation in the Pathogenesis of Atherosclerosis. Int. J. Mol. Sci. 2017, 18, 2034. [Google Scholar] [CrossRef]
- Baumer, Y.; McCurdy, S.; Weatherby, T.M.; Mehta, N.N.; Halbherr, S.; Halbherr, P.; Yamazaki, N.; Boisvert, W.A. Hyperlipidemia-induced cholesterol crystal production by endothelial cells promotes atherogenesis. Nat. Commun. 2017, 8, 1129. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.B.; Luan, J.N.; Dong, K.; Chen, S.; Wang, Y.; Watford, W.T.; Chen, S.Y. RGC-32 (Response Gene to Complement 32) Deficiency Protects Endothelial Cells from Inflammation and Attenuates Atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2018, 38, e36–e47. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.K. Linking endothelial dysfunction with endothelial cell activation. J. Clin. Investig. 2013, 123, 540–541. [Google Scholar] [CrossRef] [PubMed]
- Westerterp, M.; Tsuchiya, K.; Tattersall, I.W.; Fotakis, P.; Bochem, A.E.; Molusky, M.M.; Ntonga, V.; Abramowicz, S.; Parks, J.S.; Welch, C.L.; et al. Deficiency of ATP-Binding Cassette Transporters A1 and G1 in Endothelial Cells Accelerates Atherosclerosis in Mice. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 1328–1337. [Google Scholar] [CrossRef] [PubMed]
- Vaisman, B.L.; Demosky, S.J.; Stonik, J.A.; Ghias, M.; Knapper, C.L.; Sampson, M.L.; Dai, C.; Levine, S.J.; Remaley, A.T. Endothelial expression of human ABCA1 in mice increases plasma HDL cholesterol and reduces diet-induced atherosclerosis. J. Lipid Res. 2012, 53, 158–167. [Google Scholar] [CrossRef] [PubMed]
- Kaur, G.; Dufour, J.M. Cell lines: Valuable tools or useless artifacts. Spermatogenesis 2012, 2, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Kheirolomoom, A.; Kim, C.W.; Seo, J.W.; Kumar, S.; Son, D.J.; Gagnon, M.K.; Ingham, E.S.; Ferrara, K.W.; Jo, H. Multifunctional Nanoparticles Facilitate Molecular Targeting and miRNA Delivery to Inhibit Atherosclerosis in ApoE-/- Mice. ACS Nano 2015, 9, 8885–8897. [Google Scholar] [CrossRef]
- Noveir, S.D.; Kerman, B.E.; Xian, H.; Meuret, C.; Smadi, S.; Martinez, A.E.; Johansson, J.; Zetterberg, H.; Parks, B.A.; Kuklenyik, Z.; et al. Effect of the ABCA1 agonist CS-6253 on amyloid-beta and lipoprotein metabolism in cynomolgus monkeys. Alzheimers Res. Ther. 2022, 14, 87. [Google Scholar] [CrossRef] [PubMed]
- Oram, J.F.; Lawn, R.M.; Garvin, M.R.; Wade, D.P. ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages. J. Biol. Chem. 2000, 275, 34508–34511. [Google Scholar] [CrossRef]
- Haidar, B.; Denis, M.; Krimbou, L.; Marcil, M.; Genest, J., Jr. cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts. J. Lipid Res. 2002, 43, 2087–2094. [Google Scholar] [CrossRef]
Target | Sequence (5′-3′) |
---|---|
NPC1 | forward: TGTTTGGTATGGAGAGTGTGGA |
reverse: GTCACAGCAGAGACTGACATTG | |
ABCA1 | forward: AAAACCGCAGACATCCTTCAG |
reverse: CATACCGAAACTCGTTCACCC | |
GAPDH | forward: AGGTCGGTGTGAACGGATTTG |
reverse: GGGGTCGTTGATGGCAACA | |
U6 | forward: GGAACGATACAGAGAAGATTAGC |
reverse: TGGAACGCTTCACGAATTTGCG | |
MiR-33a-3p | forward: CAATGTTTCCACAGTGCATCA |
Anti-miR-33a-3p | forward: GTGATGCACTGTGGAAACATTG |
Scrambled Anti-miR | forward: TAAGGTTAAGTCGCCCTCGC |
Universal Small RNA | reverse: Proprietary (Takara) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Published by MDPI on behalf of the Lithuanian University of Health Sciences. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, K.; Pokhrel, A.; Echesabal-Chen, J.; Scott, J.; Bruce, T.; Jo, H.; Stamatikos, A. Inhibiting MiR-33a-3p Expression Fails to Enhance ApoAI-Mediated Cholesterol Efflux in Pro-Inflammatory Endothelial Cells. Medicina 2025, 61, 329. https://doi.org/10.3390/medicina61020329
Huang K, Pokhrel A, Echesabal-Chen J, Scott J, Bruce T, Jo H, Stamatikos A. Inhibiting MiR-33a-3p Expression Fails to Enhance ApoAI-Mediated Cholesterol Efflux in Pro-Inflammatory Endothelial Cells. Medicina. 2025; 61(2):329. https://doi.org/10.3390/medicina61020329
Chicago/Turabian StyleHuang, Kun, Achala Pokhrel, Jing Echesabal-Chen, Justin Scott, Terri Bruce, Hanjoong Jo, and Alexis Stamatikos. 2025. "Inhibiting MiR-33a-3p Expression Fails to Enhance ApoAI-Mediated Cholesterol Efflux in Pro-Inflammatory Endothelial Cells" Medicina 61, no. 2: 329. https://doi.org/10.3390/medicina61020329
APA StyleHuang, K., Pokhrel, A., Echesabal-Chen, J., Scott, J., Bruce, T., Jo, H., & Stamatikos, A. (2025). Inhibiting MiR-33a-3p Expression Fails to Enhance ApoAI-Mediated Cholesterol Efflux in Pro-Inflammatory Endothelial Cells. Medicina, 61(2), 329. https://doi.org/10.3390/medicina61020329