Impact of Post-Thaw Enrichment of Primary Human Hepatocytes on Steatosis, Inflammation, and Fibrosis in the TruVivo® System
Abstract
1. Introduction
2. Results
2.1. Characterization of T2DM Donors After Enrichment in Low and High Percoll
2.2. Characterization of Diseased Steatotic Donors After Enrichment in Low and High Percoll
2.3. Differences in Expression of Fibrotic Markers After Enrichment of PHHs in Low and High Percoll
2.4. Inflammation in Fibrotic PHHs After Enrichment in Low and High Percoll
3. Discussion
4. Materials and Methods
4.1. TruVivo® System
4.2. Morphological Assessment
4.3. Calculating PHH Attachment
4.4. Albumin and Urea Assays
4.5. Basal CYP3A4 Activity Assay
4.6. Gene Expression
4.7. Immunofluorescence and Quantitation
4.8. Nile Red Staining
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Younossi, Z.M. Non-alcoholic fatty liver disease—A global public health perspective. J. Hepatol. 2019, 70, 531–544. [Google Scholar] [CrossRef]
- Marcellin, P.; Kutala, B.K. Liver diseases: A major, neglected global public health problem requiring urgent actions and large-scale screening. Liver Int. 2018, 38, 2–6. [Google Scholar] [CrossRef]
- Younossi, Z.M.; Wong, G.; Anstee, Q.M.; Henry, L. The Global Burden of Liver Disease. Clin. Gastroenterol. Hepatol. 2023, 21, 1978–1991. [Google Scholar] [CrossRef]
- Riazi, K.; Azhari, H.; Charette, J.H.; Underwood, F.E.; King, J.A.; Afshar, E.E.; Sawin, M.G.; Congly, S.E.; Kaplan, G.G.; Shaheen, A.A. The prevalence and incidence of NAFLD worldwide: A systematic review and meta-analysis. Lancet Gastroenterol. Hepatol. 2022, 7, 851–861. [Google Scholar] [CrossRef]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef]
- Pierantonelli, I.; Svegliati-Baroni, G. Nonalcoholic Fatty Liver Disease: Basic Pathogenetic Mechanisms in the Progression From NAFLD to NASH. Transplantation 2019, 103, e1–e13. [Google Scholar] [CrossRef]
- Teng, M.L.; Ng, C.H.; Huang, D.Q.; Chan, K.E.; Tan, D.J.; Lim, W.H.; Yang, J.D.; Tan, E.; Muthiah, M.D. Global incidence and prevalence of nonalcoholic fatty liver disease. Clin. Mol. Hepatol. 2023, 29, S32–S42. [Google Scholar] [CrossRef]
- Soret, P.A.; Magusto, J.; Housset, C.; Gautheron, J. In vitro and In Vivo Models of Non-Alcoholic Fatty Liver Disease: A Critical Appraisal. J. Clin. Med. 2021, 10, 36. [Google Scholar] [CrossRef] [PubMed]
- Mϋller, F.A.; Sturla, S.J. Human in vitro models of nonalcoholic fatty liver disease. Curr. Opin. Toxicol. 2019, 16, 9–16. [Google Scholar] [CrossRef]
- Swift, B.; Pfeifer, N.D.; Brouwer, K. L Sandwich-cultured hepatocytes: An in vitro model to evaluate hepatobiliary transporter-based drug interactions and hepatotoxicity. Drug Metabl. Rev. 2010, 42, 446–471. [Google Scholar] [CrossRef] [PubMed]
- Asgharpour, A.; Sanyal, A.J. Generation of a Diet-Induced Mouse Model of Nonalcoholic Fatty Liver Disease. Methods Mol. Biol. 2022, 2455, 19–30. [Google Scholar] [CrossRef]
- Weaver, J.R.; Odanga, J.J.; Wolf, K.K.; Piekos, S.; Biven, M.; Taub, M.; LaRocca, J.; Thomas, C.; Byer-Alcorace, A.; Chen, J.; et al. The morphology, functionality, and longevity of a novel all human hepatic cell-based tri-culture system. Toxicol. Vitr. 2023, 86, 105504. [Google Scholar] [CrossRef]
- Odanga, J.J.; Gianulis, E.; Whaley, L.; LeCluyse, E.L.; Presnell, S.; Weaver, J.R. An All-Human Hepatic Culture System for Drug Development Applications. J. Vis. Exp. 2023, 200, e65992. [Google Scholar] [CrossRef]
- Odanga, J.J.; Anderson, S.M.; Breathwaite, E.K.; Presnell, S.C.; LeCluyse, E.L.; Chen, J.; Weaver, J.R. Characterization of diseased primary human hepatocytes in an all-human cell-based triculture system. Sci. Rep. 2024, 14, 6772. [Google Scholar] [CrossRef]
- Pertoft, H. Fractionation of cells and subcellular particles with Percoll. J. Biochem. Biophys. Methods 2000, 44, 1–30. [Google Scholar] [CrossRef]
- Amiri Dash Atan, N.; Koushki, M.; Motedayen, M.; Dousti, M.; Sayehmiri, F.; Vafaee, R.; Norouzinia, M.; Gholami, R. Type 2 diabetes mellitus and non-alcoholic fatty liver disease: A systematic review and meta-analysis. Gastroenterol. Hepatol. Bed Bench 2017, 10, S1–S7. [Google Scholar]
- Targher, G.; Corey, K.E.; Byrne, C.D.; Roden, M. The complex link between NAFLD and type 2 diabetes mellitus—Mechanisms and treatments. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 599–612. [Google Scholar] [CrossRef]
- Pertoft, H.; Laurent, C.; Lääs, T.; Kägedak, L. Density gradients prepared from colloidal silica particles coated by polyvinylpyrrolidone (Percoll). Anal. Biochem. 1978, 88, 271–282. [Google Scholar] [CrossRef]
- Kegel, V.; Deharde, D.; Pfeiffer, E.; Zeilinger, K.; Seehofer, D.; Damm, G. Protocol for isolation of Primary Human Hepatocytes and Corresponding Major Populations of Non-parenchymal Liver Cells. J. Vis. Exp. 2016, 30, e53069. [Google Scholar] [CrossRef]
- Horner, R.; Gassner, J.G.M.V.; Kluge, M.; Tang, P.; Lippert, S.; Hillebrandt, K.H.; Moosburner, S.; Reutzel-Selke, A.; Pratschke, J.; Sauer, I.M.; et al. Impact of Percoll purification on isolation of primary human hepatocytes. Sci. Rep. 2019, 9, 6542. [Google Scholar] [CrossRef]
- Utesch, D.; Diener, B.; Molitor, E.; Oesch, F.; Platt, K.L. Characterization of cryopreserved rat liver parenchymal cells by metabolism of diagnostic substrates and activities of related enzymes. Biochem. Pharmacol. 1992, 44, 309–315. [Google Scholar] [CrossRef]
- Dou, M.; de Sousa, G.; Lacarelle, B.; Placidi, M.; Lechene de La Porte, P.; Domingo, M.; Lafont, H.; Rahmani, R. Thawed human hepatocytes in primary culture. Cryobiology 1992, 29, 454–469. [Google Scholar] [CrossRef]
- Li, A.P. Human hepatocytes: Isolation, cryopreservation and applications in drug development. Chem. Biol. Interact. 2007, 168, 16–29. [Google Scholar] [CrossRef]
- Musso, G.; Gambino, R.; Cassader, M.; Pagano, G. Meta-analysis: Natural history of non-alcoholic fatty liver disease (NAFLD) and diagnostic accuracy of non-invasive tests for liver disease severity. Ann. Med. 2011, 43, 617–649. [Google Scholar] [CrossRef]
- Williams, K.H.; Shackel, N.A.; Gorrell, M.D.; McLennan, S.V.; Twigg, S.M. Diabetes and nonalcoholic Fatty liver disease: A pathogenic duo. Endocr. Rev. 2013, 34, 84–129. [Google Scholar] [CrossRef]
- Giannopoulos, C.K.; Tzima, I.G.; Tentolouris, N.K.; Vasileiadis, I.A. Common Pathogenetic Pathways of Non-Alcoholic Fatty Liver Disease and Type 2 Diabetes Mellitus. Curr. Diabetes Rev. 2023, 19, e160223213720. [Google Scholar] [CrossRef] [PubMed]
- Vega, L.; Simian, D.; Gajardo, A.I.; Salinas, M.; Urra, A.; Cattaneo, M.; Pino, R.; Robiero, J.P.; Urzúa, Á.; Rojas, K.; et al. Coronary artery disease as a risk factor for metabolic dysfunction-associated steatotic liver disease and fibrosis. Ann. Hepatol. 2024, 29, 101511. [Google Scholar] [CrossRef]
- Lomonaco, R.; Leiva, E.G.; Bril, F.; Shrestha, S.; Mansour, L.; Budd, J.; Portillo Romero, J.; Schmidt, S.; Chang, K.L.; Samraj, G.; et al. Advanced Liver Fibrosis Is Common in Patients with Type 2 Diabetes Followed in the Outpatient Setting: The Need for Systematic Screening. Diabetes Care 2021, 44, 399–406. [Google Scholar] [CrossRef]
- Fracanzani, A.L.; Valenti, L.; Bugianesi, E.; Andreoletti, M.; Colli, A.; Vanni, E.; Bertelli, C.; Fatta, E.; Bignamini, D.; Marchesini, G.; et al. Risk of severe liver disease in nonalcoholic fatty liver disease with normal aminotransferase levels: A role for insulin resistance and diabetes. Hepatology 2008, 48, 792–798. [Google Scholar] [CrossRef]
- Mofrad, P.; Contos, M.J.; Haque, M.; Sargeant, C.; Fisher, R.A.; Luketic, V.A.; Sterling, R.K.; Shiffman, M.L.; Stravitz, R.T.; Sanyal, A.J. Clinical and histologic spectrum of nonalcoholic fatty liver disease associated with normal ALT values. Hepatology 2003, 37, 1286–1292. [Google Scholar] [CrossRef]
- Jung, Y.; Zhao, M.; Svensson, K.J. Isolation, culture, and functional analysis of hepatocytes from mice with fatty liver disease. STAR Protoc. 2020, 1, 100222. [Google Scholar] [CrossRef] [PubMed]
- Ye, Q.; Liu, Y.; Zhang, G.; Deng, H.; Wang, X.; Tuo, L.; Chen, C.; Pan, X.; Wu, K.; Fan, J.; et al. Deficiency of gluconeogenic enzyme PCK1 promotes metabolic-associated fatty liver disease through PI3K/AKT/PDGF axis activation in male mice. Nat. Commun. 2023, 14, 1402. [Google Scholar] [CrossRef] [PubMed]
- Gao, B.; Sakaguchi, K.; Ogawa, T.; Kagawa, Y.; Kubo, H.; Shimizu, T. Functional Analysis of Induced Human Ballooned Hepatocytes in a Cell Sheet-Based Three Dimensional Model. Tissue Eng. Regen. Med. 2021, 18, 217–224. [Google Scholar] [CrossRef] [PubMed]
- Kawaguchi, K.; Sakai, Y.; Terashima, T.; Shimode, T.; Seki, A.; Orita, N.; Takeshita, Y.; Shimakami, T.; Takatori, H.; Arai, K.; et al. Decline in serum albumin concentration is a predictor of serious events in nonalcoholic fatty liver disease. Medicine 2021, 100, e26835. [Google Scholar] [CrossRef] [PubMed]
- Gallego-Durán, R.; Ampuero, J.; Pastor-Ramírez, H.; Álvarez-Amor, L.; Del Campo, J.A.; Maya-Miles, D.; Montero-Vallejo, R.; Cárdenas-García, A.; Pareja, M.J.; Gato-Zambrano, S.; et al. Liver injury in non-alcoholic fatty liver disease is associated with urea cycle enzyme dysregulation. Sci. Rep. 2022, 121, 3418. [Google Scholar] [CrossRef]
- De Chiara, F.; Heebøll, S.; Marrone, G.; Montoliu, C.; Hamilton-Dutoit, S.; Ferrandez, A.; Andreola, F.; Rombouts, K.; Grønbæk, H.; Felipo, V.; et al. Urea cycle dysregulation in non-alcoholic fatty liver disease. J. Hepatol. 2018, 69, 905–915. [Google Scholar] [CrossRef]
- Shangraw, R.E.; Jahoor, F. Effect of liver disease and transplantation on urea synthesis in humans: Relationship to acid-base status. Am. J. Physiol. 1999, 276, G1145–G1152. [Google Scholar] [CrossRef]
- Wang, C.; Ma, C.; Gong, L.; Guo, Y.; Fu, K.; Zhang, Y.; Zhou, H.; Li, Y. Macrophage Polarization and Its Role in Liver Disease. Front. Immunol. 2021, 12, 803037. [Google Scholar] [CrossRef]
- Singla, T.; Muneshwar, K.N.; Pathade, A.G.; Yelne, S. Hepatocyte Ballooning in Non-Alcoholic Steatohepatitis: Bridging the Knowledge Gap and Charting Future Avenues. Cureus 2023, 15, e45884. [Google Scholar] [CrossRef]
- Lech, M.; Anders, H.-J. Macrophages and fibrosis: How resident and infiltrating mononuclear phagocytes orchestrate all phases of tissue injury and repair. Biochim. Biophys. Acta 2013, 1832, 989–997. [Google Scholar] [CrossRef]
- Binatti, E.; Gerussi, A.; Barisani, D.; Invernizzi, P. The Role of Macrophages in Liver Fibrosis: New Therapeutic Opportunities. Int. J. Mol. Sci. 2022, 23, 6649. [Google Scholar] [CrossRef] [PubMed]
- Duo, L.; Shi, X.; He, X.; Gao, Y. Macrophage Phenotype and Function in Liver Disorder. Front. Immunol. 2020, 10, 3112. [Google Scholar] [CrossRef]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.G.; Funk, J.; Robbins, J.B.; Crogan-Grundy, C.; Presnell, S.C.; Singer, T.; Roth, A.B. Bioprinted 3D Primary Liver Tissues Allow Assessment of Organ-level Response to Clinical Drug-Induced Toxicity In Vitro. PLoS ONE 2016, 11, e0158674. [Google Scholar] [CrossRef] [PubMed]
- Ware, B.R.; Durham, M.J.; Monckton, C.P.; Khetani, S.R. A Cell Culture Platform to Maintain Long-term Phenotype of Primary Human Hepatocytes and Endothelial Cells. Cell. Mol. Gastroenterol. Hepatol. 2018, 5, 187–207. [Google Scholar] [CrossRef]
- Messner, C.J.; Babrak, L.; Titolo, G.; Caj, M.; Miho, E.; Suter-Dick, L. Single Cell Gene Expression Analysis in a 3D Microtissue Liver Model Reveals Cell Type-Specific Responses to Pro-Fibrotic TGF-β1 Stimulation. Int. J. Mol. Sci. 2021, 22, 4372. [Google Scholar] [CrossRef]
- Nishimura, M.; Koeda, A.; Suzuki, E.; Shimizu, T.; Kawano, Y.; Nakayama, M.; Satoh, T.; Narimatsu, S.; Naito, S. Effects of prototypical drug-metabolizing enzyme inducers on mRNA expression of housekeeping genes in primary cultures of human and rat hepatocytes. Biochem. Biophys. Res. Commun. 2006, 346, 1033–1039. [Google Scholar] [CrossRef]
Donor | Age | Sex | Race | BMI | NAS Score | Steatosis Score | Lobular Inflammation Score | Hepatocyte Ballooning Score | Fibrosis Stage | Health Category |
---|---|---|---|---|---|---|---|---|---|---|
16117 | 41 | F | Caucasian | 30 | 0 | 0 | 0 | 0 | 0 | Normal |
2118143 | 44 | M | Caucasian | 30.1 | 3 | 1 | 2 | 0 | 2 | Normal + Fibrosis |
2116167 | 51 | M | Caucasian | 29.8 | 4 | 1 | 1 | 2 | 1 | Disease |
16096 | 73 | F | Caucasian | 30 | 4 | 2 | 1 | 1 | 0 | Disease |
1811122 | 28 | F | Caucasian | 34 | 5 | 3 | 0 | 2 | 1A, Focal | Disease |
2113766 | 56 | M | Hispanic | 23.9 | 1 | 0 | 1 | 0 | 2 | T2DM |
2118545 | 59 | M | Caucasian | 28.6 | 2 | 1 | 0 | 1 | 0 | T2DM |
Primer Name | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
GAPDH | GGTCACCAGGGCTGCTTTTA | GGATCTCGCTCCTGGAAGATG |
G6PC | TCATCTTGGTGTCCGTGATCG | TTTATCAGGGGCACGGAAGTG |
PCK1 | ACTCGAGGTTCTGCACCCCT | AGGCAGCATCAATGATGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Odanga, J.J.; Anderson, S.M.; Presnell, S.C.; LeCluyse, E.L.; Chen, J.; Weaver, J.R. Impact of Post-Thaw Enrichment of Primary Human Hepatocytes on Steatosis, Inflammation, and Fibrosis in the TruVivo® System. Pharmaceuticals 2024, 17, 1624. https://doi.org/10.3390/ph17121624
Odanga JJ, Anderson SM, Presnell SC, LeCluyse EL, Chen J, Weaver JR. Impact of Post-Thaw Enrichment of Primary Human Hepatocytes on Steatosis, Inflammation, and Fibrosis in the TruVivo® System. Pharmaceuticals. 2024; 17(12):1624. https://doi.org/10.3390/ph17121624
Chicago/Turabian StyleOdanga, Justin J., Sharon M. Anderson, Sharon C. Presnell, Edward L. LeCluyse, Jingsong Chen, and Jessica R. Weaver. 2024. "Impact of Post-Thaw Enrichment of Primary Human Hepatocytes on Steatosis, Inflammation, and Fibrosis in the TruVivo® System" Pharmaceuticals 17, no. 12: 1624. https://doi.org/10.3390/ph17121624
APA StyleOdanga, J. J., Anderson, S. M., Presnell, S. C., LeCluyse, E. L., Chen, J., & Weaver, J. R. (2024). Impact of Post-Thaw Enrichment of Primary Human Hepatocytes on Steatosis, Inflammation, and Fibrosis in the TruVivo® System. Pharmaceuticals, 17(12), 1624. https://doi.org/10.3390/ph17121624