Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.

doi:10.3390/s17050945

Open AccessErratum

Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

by

Kwang-Pyo Kim

^1,2,†,

Atul K. Singh

^1,†

,

Xingjian Bai

¹,

Lena Leprun

^1,‡ and

Arun K. Bhunia

^1,3,*

¹

Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, West Lafayette, IN 47907, USA

²

Department of Food Science and Technology, College of Agriculture and Life Sciences, Chonbuk National University, Jeonbuk 561756, Korea

³

Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 47907, USA

^*

Author to whom correspondence should be addressed.

^†

These authors contributed equally to this study.

^‡

Present address: CROUS de Dijon, Dijon CEDEX 21012, France.

Sensors 2017, 17(5), 945; https://doi.org/10.3390/s17050945

Submission received: 11 April 2017 / Accepted: 12 April 2017 / Published: 25 April 2017

(This article belongs to the Collection Sensors in Agriculture and Forestry)

Download Versions Notes

The authors wish to correct the oligonucleotide sequence of primer E-LAP-F1 and LIS-R1 in Table 1 in their paper published in Sensors [1], doi:10.3390/s150922672, https://www.mdpi.com/1424-8220/15/9/22672. The following table should be used.

The changes do not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage, with a reference to this Erratum.

Supplementary Materials

Supplementary File 1

Reference

Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K.; Kim, K-P. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. [Google Scholar] [CrossRef] [PubMed]

Table 1. Sequences of species-specific primers based on lap sequence used in this study.

Primer	Sequence ^a	Location in Lap Gene	Product Size (bp)	Specificity
ELAP-F1	5′CGGTCCCCGGGTACCATGGCAATTAAAGAAAATGCGGCC3′	1–1301	1301	Listeria spp. (except L. grayi, L. rocourtiae)
LIS-R1	5′TTTGTGATACAGAGTTTTTACC3′	1–1301	1301	Listeria spp. (except L. grayi, L. rocourtiae)
Inn-F1	5′GGAGTTATTAACGAAGATACT3′	286–822	536	L. innocua
Inn-R1	5′TTCTGCTTTTACTTCTTTAGCA3′	286–822	536	L. innocua
IvaSee-F1	5′AAGCTGCAGTTATTCATTCC3′	1137–1743	606	L. ivanovii, L. seeligeri
IvaSee-R1	5′ATCTAAGAATTTTTGTTTTAGT3′	1137–1743	606	L. ivanovii, L. seeligeri
Wel-F1	5′TTCTCGTATTATCGGTTTACCA3′	2344–2581	237	L. welshimeri
Wel-R1	5′GCTTCAAGATAGATTTCTTTCAA3′	2344–2581	237	L. welshimeri
Mar-F1	5′AGAATATATTTGGAACAGCATC3′	246–2059	1813	L. marthii
Mar-R1	5′GTTCGATTGCACGGATGGAAAG3′	246–2059	1813	L. marthii

^a Underlining indicates artificial nucleotide addition sites; translation start codon is indicated in bold.

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors 2017, 17, 945. https://doi.org/10.3390/s17050945

AMA Style

Kim K-P, Singh AK, Bai X, Leprun L, Bhunia AK. Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors. 2017; 17(5):945. https://doi.org/10.3390/s17050945

Chicago/Turabian Style

Kim, Kwang-Pyo, Atul K. Singh, Xingjian Bai, Lena Leprun, and Arun K. Bhunia. 2017. "Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691" Sensors 17, no. 5: 945. https://doi.org/10.3390/s17050945

APA Style

Kim, K.-P., Singh, A. K., Bai, X., Leprun, L., & Bhunia, A. K. (2017). Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors, 17(5), 945. https://doi.org/10.3390/s17050945

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Supplementary Materials

Reference

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI