Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage
Abstract
1. Introduction
2. Materials and Methods
2.1. Biological Materials
2.2. Extraction of Total RNA from Tissues
2.3. Full-Length Amplification of Sj5-HT6r
2.4. Expression Profile Analysis of Sj5-HT6r
2.5. In Situ Hybridization of Sj5-HT6r
2.6. Subcellular Localization of Sj5-HT6r
2.7. Sequence Characteristics Analysis of Sj5-HT6r
3. Results
3.1. cDNA Information for the Sj5-HT6r Gene
3.2. Multi-Sequence Alignment Analysis of the Sj5-HT6r
3.3. Evolutionary Analysis of Sj5-HT6r
3.4. Subcellular Localization of Sj5-HT6r
3.5. Expression of Sj5-HT6r Based on Sex and Life Stage
3.6. In Situ Hybridization Localization of Sj5-HT6r
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fan, F.; Yin, F.; Wang, J.; Li, J. Status and prospects on biological research of Sepiella maindroni. Mod. Fish. Inf. 2011, 26, 6–9. (In Chinese) [Google Scholar]
- Vlasova, E.V.; Sabirov, R.M.; Golikov, A.V. Reproductive biology of the golden cuttlefish Sepia esculenta (Cephalopoda, Sepiida). Diversity 2023, 15, 455. [Google Scholar] [CrossRef]
- Gao, T.; Wang, L.; Chi, C.; Jiang, L.; Wang, S. Karyotype analysis of Sepiella maindroni. J. Zhejiang Ocean. Univ. (Nat. Sci.) 2019, 38, 281–285. (In Chinese) [Google Scholar]
- Zheng, X.; Lin, X.; Wang, Z.; Yu, R.; Tian, C.; Li, Q. Life history studies on Sepiella japonica under fully artificial culture conditions. Trans. Oceanol. Limnol. Haiyang Huzhao Tongbao 2010, 3, 24–28. (In Chinese) [Google Scholar]
- Hannon, J.; Hoyer, D. Molecular biology of 5-HT receptors. Behav. Brain Res. 2008, 195, 198–213. [Google Scholar] [CrossRef] [PubMed]
- Hoyer, D.; Hannon, J.P.; Martin, G.R. Molecular, pharmacological and functional diversity of 5-HT receptors. Pharmacol. Biochem. Behav. 2002, 71, 533–554. [Google Scholar] [CrossRef] [PubMed]
- Norton, W.H.; Folchert, A.; Bally-Cuif, L. Comparative analysis of serotonin receptor (HTR1A/HTR1B families) and transporter (slc6a4a/b) gene expression in the zebrafish brain. J. Comp. Neurol. 2008, 511, 521–542. [Google Scholar] [CrossRef] [PubMed]
- Schneider, H.; Fritzky, L.; Williams, J.; Heumann, C.; Yochum, M.; Pattar, K.; Noppert, G.; Mock, V.; Hawley, E. Cloning and expression of a zebrafish 5-HT2C receptor gene. Gene 2012, 502, 108–117. [Google Scholar] [CrossRef]
- Nakeim, J.; Kornthong, N.; Saetan, J.; Duangprom, S.; Sobhon, P.; Sretarugsa, P. Presence of serotonin and its receptor in the central nervous system and ovary and molecular cloning of the novel crab serotonin receptor of the blue swimming crab, Portunus pelagicus. Acta Histoche 2020, 122, 151457. [Google Scholar] [CrossRef] [PubMed]
- Minosyan, T.Y.; Lu, R.; Eghbali, M.; Toro, L.; Stefani, E. Increased 5-HT contractile response in late pregnant rat myometrium is associated with a higher density of 5-HT2A receptors. J. Physiol. 2007, 581, 91–97. [Google Scholar] [CrossRef]
- Ishigami, T.; Yoshioka, K.; Karicheti, V.; Marson, L. A role for peripheral 5-HT2 receptors in serotonin-induced facilitation of the expulsion phase of ejaculation in male rats. J. Sex. Med. 2013, 10, 2688–2702. [Google Scholar] [CrossRef]
- Uphouse, L. Pharmacology of serotonin and female sexual behavior. Pharmacol. Biochem. Behav. 2014, 121, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Rao, S.; Turek, I.; Irving, H.R. Phylogenetic analyses of 5-hydroxytryptamine 3 (5-HT3) receptors in Metazoa. PLoS ONE 2023, 18, e0281507. [Google Scholar] [CrossRef] [PubMed]
- Tata, S.R. Combined In-Silico and Experimental Approach to Understanding 5-Hydroxytryptamine 3 (5-HT3) Receptor Expression. Ph.D. Thesis, La Trobe Rural Health School, Flora Hill, VIC, Australia, 2023. [Google Scholar]
- Wang, Q.; He, M. Molecular characterization and analysis of a putative 5-HT receptor involved in reproduction process of the pearl oyster Pinctada fucata. Gen. Comp. Endocrinol. 2014, 204, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Gerhardt, C.C.; Leysen, J.E.; Planta, R.; Vreugdenhil, E.; van Heerikhuizen, H. Functional characterisation of a 5-HT2 receptor cDNA cloned from Lymnaea stagnalis. Eur. J. Pharmacol. 1996, 311, 249–258. [Google Scholar] [CrossRef]
- Sugamori, K.S.; Sunahara, R.K.; Guan, H.C.; Bulloch, A.G.; Tensen, C.P.; Seeman, P.; Niznik, H.B.; Van Tol, H.H. Serotonin receptor cDNA cloned from Lymnaea stagnalis. Proc. Natl. Acad. Sci. USA 1993, 90, 11–15. [Google Scholar] [CrossRef]
- Yang, X.; Noor, Z.; Guo, S.; Zhao, Z.; Cai, B.; Huang, G.; Ma, H.; Qin, Y.; Yu, Z.; Li, J.; et al. Analysis of molecular identity and function of putative serotonin receptors in the giant clam (Tridacna crocea) and the potential role of 5-HT1D-like receptor in reproduction. Aquaculture 2024, 593, 741247. [Google Scholar] [CrossRef]
- Kim, K.S.; Kim, M.A.; Sohn, Y.C. Molecular characterization, expression analysis, and functional properties of multiple 5-hydroxytryptamine receptors in Pacific abalone (Haliotis discus hannai). Gen. Comp. Endocrinol. 2019, 276, 52–59. [Google Scholar] [CrossRef]
- You, Q.; Li, Q.; Lv, L.; Lin, Z.; Dong, Y.; Yao, H. Genome-Wide Identification of 5-HT receptor gene family in razor clam Sinonovacula constricta and their circadian rhythm expression analysis. Animals 2023, 13, 3208. [Google Scholar] [CrossRef]
- Jiang, X.; Fu, F.; Li, Z.; Feng, X. Study on the oogenesis and ovarial development of Sepiella maindroni. J. Fish. China 2007, 31, 607–617. (In Chinese) [Google Scholar]
- Luo, J.; Jiang, X.M.; Liu, M.H.; Tang, F.; Peng, R.B. Oogenesis and ovarian development in Sepia lycidas. Acta Hydrobiol. Sin. 2014, 38, 1107–1116. [Google Scholar]
- Sauer, W.H.; Lipiński, M.R. Histological validation of morphological stages of sexual maturity in chokker squid Loligo vulgaris reynaudii D’Orb (Cephalopoda: Loliginidae). S. Afr. J. Mar. Sci. 1990, 9, 189–200. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.J.; Li, Y.; Wu, J.H.; Fang, P.X.; Li, S.; Zhou, X.; Chi, C.F. FMRFamide G protein-coupled receptors (GPCR) in the cuttlefish Sepiella japonica: Identification, characterization and expression profile. Neuropeptides 2024, 109, 102491. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.M.; Wu, J.H.; Li, S.; Zhou, X.; Zheng, L.B.; Chi, C.F. A Na+ channel receptor of FMRFamide in the cephalopod Sepiella japonica: Identification, characterisation, and expression profiling during different stages of gonadal development. Neuropeptides 2024, 106, 102437. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Sun, L.L.; Wu, J.H.; Liu, H.H.; Zheng, L.B.; Lü, Z.M.; Chi, C.F. An FMRFamide neuropeptide in cuttlefish Sepia pharaonis: Identification, characterization, and potential function. Molecules 2020, 25, 1636. [Google Scholar] [CrossRef] [PubMed]
- Ruat, M.; Traiffort, E.; Arrang, J.; Tardivellacombe, J.; Diaz, J.; Leurs, R.; Schwartz, J.-C. A novel rat serotonin (5-HT6) receptor: Molecular cloning, localization and stimulation of cAMP accumulation. Biochem. Biophys. Res. Commun. 1993, 193, 268–276. [Google Scholar] [CrossRef] [PubMed]
- Kohen, R.; Fashingbauer, L.A.; Heidmann, D.E.A.; Guthrie, C.R.; Hamblin, M.W. Cloning of the mouse 5-HT6 serotonin receptor and mutagenesis studies of the third cytoplasmic loop. Mol. Brain Res. 2001, 90, 110–117. [Google Scholar] [CrossRef]
- Jones, R.D. Information transmission in G protein-coupled receptors. Int. J. Mol. Sci. 2024, 25, 1621. [Google Scholar] [CrossRef]
- Weis, W.I.; Kobilka, B.K. The Molecular basis of G protein-coupled receptor activation. Annu. Rev. Biochem. 2018, 87, 897–919. [Google Scholar] [CrossRef]
- Núñez-Villanueva, D. Revisiting 310-helices: Biological relevance, mimetics and applications. Explor. Drug Sci. 2024, 2, 6–37. [Google Scholar] [CrossRef]
- Wang, C.; Jiang, Y.; Ma, J.; Wu, H.; Wacker, D.; Katritch, V.; Han, G.W.; Liu, W.; Huang, X.P.; Vardy, E.; et al. Structural basis for molecular recognition at serotonin receptors. Science 2013, 340, 610–614. [Google Scholar] [CrossRef] [PubMed]
- Prasad, P.; Ogawa, S.; Parhar, I.S. Role of serotonin in fish reproduction. Front. Neurosci. 2015, 9, 195. [Google Scholar] [CrossRef]
- Cerda, J.; Subhedar, N.; Reich, G.; Wallace, R.A.; Selman, K. Oocyte sensitivity to serotonergic regulation during the follicular cycle of the teleost Fundulus heteroclitus. Biol. Reprod. 1998, 59, 53–61. [Google Scholar] [CrossRef] [PubMed]
- Tsai, C.-L.; Wang, L.-H. Effects of gonadal steroids on the serotonin synthesis and metabolism in the early developing tilapia brain. Neurosci. Lett. 1999, 264, 45–48. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Rauda, R.; Aldegunde, M. Changes in dopamine, norepinephrine and serotonin levels in the pituitary, telencephalon and hypothalamus during gonadal development of male Lutjanus argentiventris (Teleostei). Mar. Biol. 2002, 141, 209–216. [Google Scholar]
- Sloley, B.; Cunjak, R.; Power, G.; Downer, R. The influence of sex and spawning on levels of tryptophan, serotonin and 5-hydroxyindoleacetic acid in the brains of wild brook trout, Salvelinus fontinalis. J. Fish. Biol. 1986, 29, 663–669. [Google Scholar] [CrossRef]
- Iwamatsu, T.; Toya, Y.; Sakai, N.; Terada, Y.; Nagata, R.; Nagahama, Y. Effect of 5-hydroxytryptamine on steroidogenesis and oocyte maturation in pre-ovulatory follicles of the medaka Oryzias latipes. Dev. Growth Differ. 1993, 35, 625–630. [Google Scholar] [CrossRef]
- Lahogue, C.; Billard, J.M.; Freret, T.; Bouet, V. 5-HT6 receptors sex-dependently modulate hippocampal synaptic activity through GABA inhibition. Biomolecules 2023, 13, 751. [Google Scholar] [CrossRef] [PubMed]
- Tanabe, T.; Yuan, Y.; Nakamura, S.; Itoh, N.; Takahashi, K.G.; Osada, M. The role in spawning of a putative serotonin receptor isolated from the germ and ciliary cells of the gonoduct in the gonad of the Japanese scallop, Patinopecten yessoensis. Gen. Comp. Endocrinol. 2010, 166, 620–627. [Google Scholar] [CrossRef]
- Gérard, C.; Martres, M.-P.; Lefèvre, K.; Miquel, M.-C.; Vergé, D.; Lanfumey, L.; Doucet, E.; Hamon, M.; El Mestikawy, S. Immuno-localization of serotonin 5-HT6 receptor-like material in the rat central nervous system. Brain Res. 1997, 746, 207–219. [Google Scholar] [CrossRef] [PubMed]
- Roberts, J.C.; Reavill, C.; East, S.Z.; Harrison, P.J.; Patel, S.; Routledge, C.; Leslie, R.A. The distribution of 5-HT6 receptors in rat brain: An autoradiographic binding study using the radiolabelled 5-HT6 receptor antagonist [125I]SB-258585. Brain Res. 2002, 934, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Mager, E.M.; Medeiros, L.R.; Lange, A.P.; McDonald, M.D. The toadfish serotonin 2A (5-HT2A) receptor: Molecular characterization and its potential role in urea excretion. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2012, 163, 319–326. [Google Scholar] [CrossRef] [PubMed]
- Helboe, L.; Egebjerg, J.; de Jong, I.E. Distribution of serotonin receptor 5-HT6 mRNA in rat neuronal subpopulations: A double in situ hybridization study. Neuroscience 2015, 310, 442–454. [Google Scholar] [CrossRef] [PubMed]
- Glikmann-Johnston, Y.; Saling, M.M.; Reutens, D.C.; Stout, J.C. Hippocampal 5-HT1A receptor and spatial learning and memory. Front. Pharmacol. 2015, 6, 289. [Google Scholar] [CrossRef]
- Stiedl, O.; Pappa, E.; Konradsson-Geuken, A.; Ogren, S.O. The role of the serotonin receptor subtypes 5-HT1A and 5-HT7 and its interaction in emotional learning and memory. Front. Pharmacol. 2015, 6, 162. [Google Scholar] [CrossRef] [PubMed]
- Pitoy, M.; Gauthier, L.; Debatisse, J.; Maulave, J.; Metereau, E.; Beaudoin, M.; Portier, K.; Sgambato, V.; Billard, T.; Zimmer, L.; et al. SB-258585 reduces food motivation while blocking 5-HT6 receptors in the non-human primate striatum. Prog. Neuropsychopharmacol. Biol. Psychiatry 2024, 131, 110970. [Google Scholar] [CrossRef]
Name | Sequence (5′-3′) | Application |
---|---|---|
Sj5-HT6r-F | GCTGATTTCTTGGTTGGCAA | cDNA clone |
Sj5-HT6r-R | TCACTTCACCTTGATACCGAT | |
5′-RACE Adapter | ACCGTTCACCCGAAAAGCAACCGTCA | RACE |
3′-RACE Adapter | GGTTGGTCATTATGGTGTTGTAACGAAGTGG | |
5′-Sj5-HT6r-outter | TGAGGCAGTTTGTAGATGTA | |
5′-Sj5-HT6r-inner | GCCCAGATAGAGCAAAATGT | |
3′-Sj5-HT6r-outter | TACCCGTTATTTATGCGAGAC | |
5′-Sj5-HT6r-inner | GCCAACCAAGAAATCAGC | |
Sj5-HT6r-F | CACCCGAAAAGCAACCGTC | qPCR |
Sj5-HT6r-R | CGTCAAGCCCTCCATGTAAACT | |
GAPDH-F | TGGTTCCTTGGCTTTTGCT | |
GAPDH-R | GGTGGTGGTGCGGGTAGT | |
β-actin-F | GCCAGTTGCTCGTTACAG | |
β-actin-R | GCCAACAATAGATGGGAAT | |
S-Sj5-HT6r-F | ATTGTTGTCGCCTTTGTTC | ISH |
S-Sj5-HT6r-R | TAATACGACTCACTATAGGTTTTAGTTTTCGCTCGTT | |
A-Sj5-HT6r-F | TAATACGACTCACTATAGATTGTTGTCGCCTTTGTTC | |
A-Sj5-HT6r-R | GTTTTAGTTTTCGCTCGTT | |
Sj5-HT6r-Xho1-F | CCGCTCGAGATGCAGAAATCTTTT | Subcellular localization |
Sj5-HT6r-EcoR1-R | CGGGAATTCGCACAGATGCTGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, W.-B.; Issangya, P.J.; Li, S.; Zhou, X.; Zheng, L.-B.; Chi, C.-F. Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage. Diversity 2025, 17, 104. https://doi.org/10.3390/d17020104
Cui W-B, Issangya PJ, Li S, Zhou X, Zheng L-B, Chi C-F. Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage. Diversity. 2025; 17(2):104. https://doi.org/10.3390/d17020104
Chicago/Turabian StyleCui, Wen-Bo, Prisca John Issangya, Shuang Li, Xu Zhou, Li-Bing Zheng, and Chang-Feng Chi. 2025. "Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage" Diversity 17, no. 2: 104. https://doi.org/10.3390/d17020104
APA StyleCui, W.-B., Issangya, P. J., Li, S., Zhou, X., Zheng, L.-B., & Chi, C.-F. (2025). Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage. Diversity, 17(2), 104. https://doi.org/10.3390/d17020104