Next Article in Journal
Impact of Tick-Borne Orthoflaviviruses Infection on Compact Human Brain Endothelial Barrier
Previous Article in Journal
Resveratrol Upregulates Antioxidant Factors Expression and Downmodulates Interferon-Inducible Antiviral Factors in Aging
Previous Article in Special Issue
Genetic Diversity and Fingerprinting of 231 Mango Germplasm Using Genome SSR Markers
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers

1
College of Horticulture & Landscape Architecture, Northeast Agricultural University, Harbin 150038, China
2
Mudanjiang Branch Institute, Heilongjiang Academy of Agricultural Sciences, Mudanjiang 157041, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(5), 2346; https://doi.org/10.3390/ijms26052346
Submission received: 17 December 2024 / Revised: 28 February 2025 / Accepted: 3 March 2025 / Published: 6 March 2025
(This article belongs to the Special Issue Advances in Breeding, Genetics, and Genomics of Fruit Crops)

Abstract

Blackcurrant (Ribes nigrum L.) has high nutritional value for human health due to its abundant vitamin C, flavonoids, and organic acids. However, its breeding and genetic research have been severely hindered by the lack of scientific tools such as molecular markers. Here, we identified 14,258 EST-SSR loci from 9531 CDS sequences with lengths greater than 1 kb, which comprised 6211 mononucleotide repeats, 4277 dinucleotide repeats, and 2469 trinucleotide repeats. We then randomly selected 228 EST-SSR loci for PCR amplification and gel electrophoresis imaging in the Ribes collection of Northeast Agricultural University (95 blackcurrant cultivars and 12 other Ribes accessions). As a result, 31 pairs of markers produced clear and reproducible bands of the expected size. Based on the 107 Ribes accessions, the allele number (Na), information index (I), observed heterozygosity (Ho), expected heterozygosity (He), and polymorphic information content (PIC) of the 31 markers were 2–5, 0.23–1.32, 0.07–0.71, 0.11–0.68, and 0.14–0.67, respectively. For the blackcurrant gene pool, neighbor-joining and population structure analysis revealed three clusters, which did not align well with their geographical origins. Based on the results, two sets with 21 and 19 blackcurrant cultivars were identified by Power Core (PC) and Core Hunter (CH) programs. The integrated core germplasm (IC) set with 27 cultivars derived from the PC and CH sets harbored abundant genetic diversity, where the allele retention rate accounted for 98.9% of the blackcurrant gene pool. The SSR markers, data, and core germplasms presented in this study lay a solid foundation for the phylogenetic study, molecular breeding, and conservation genetics of Ribes, especially Ribes nigrum.

1. Introduction

Blackcurrant (Ribes nigrum L.) is the most economically significant species within the Ribes genus of the Grossulariaceae family [1]. The annual global production of blackcurrant-dominated currants reaches 764,499 tons [2]. Blackcurrant is rich in bioactive compounds including anthocyanins, flavonoids, polysaccharides, vitamins, and organic acids [3,4,5,6,7]. Additionally, its seed oil contains unsaturated fatty acids such as alpha-linolenic acid and gamma-linolenic acid, as well as phytosterols [8,9]. These functional attributes offer distinctive pharmacological properties in reducing the incidence of type 2 diabetes, lowering blood lipids, protecting vision, exhibiting antiviral and anticancer effects, and enhancing immune function [10]. Data have shown that currants, particularly blackcurrants, are cultivated in 37 countries, among which the Russian Federation and Poland account for 49.89% and 32.24% of the total cultivation area, respectively [2,11]. The cultivation of blackcurrants in China can be traced back to as early as 1917 [12,13]. Elite blackcurrant cultivars were initially introduced to Northeast China by Russian immigrants from the northern side of the Amur River, resulting in a cultivation history spanning over one century. With the rapid development of China’s light industry after 1958, blackcurrant fructose and fruit wine have gained increasing popularity in both domestic and international markets, which has significantly increased the demand for blackcurrant raw materials, leading to a steady expansion of the cultivation area. By 1985, the blackcurrant cultivation area in Heilongjiang and Jilin provinces reached 21,940 hectares [14], which triggered great efforts in the selection and breeding of blackcurrant cultivars with desirable traits. In 1986, some Chinese breeding institutions, such as Northeast Agricultural University (NEAU), introduced elite blackcurrant germplasms from foreign countries including Russia, Poland, and Sweden. During the past 70 years, a total of 95 blackcurrant cultivars and other 12 Ribes accessions have been collected and preserved in Northeast Agricultural University (hereinafter referred to as NEAU collection). By crossbreeding these foreign germplasms with the germplasms native to China, breeders have successfully developed high-yielding, cold-resistant, and superior-quality cultivars such as ‘Daisha’, ‘HanFeng’, and ‘Danjianghei’ [14,15,16]. However, the genetic diversity level and population structure of Chinese blackcurrant germplasms remain unknown due to the limited original information, incomplete or missing breeding records, possible repeated introduction of identical germplasms, and the involvement of local wild species, which has severely limited the further breeding and improvement in blackcurrant.
Genetic diversity assessment of plant germplasm can be conducted based on morphological traits, anatomical and biochemical markers, and molecular markers [17]. Molecular markers offer greater advantages over other methods due to their independence from complex environmental factors and phenological stages, high repeatability, and simplicity and speed of sampling [18]. Since 1995, molecular markers such as RAPD (random amplified polymorphic DNA), AFLP (amplified fragment length polymorphism), and ISSR (inter-simple sequence repeat) have been extensively utilized to assess the genetic diversity of different blackcurrant germplasms [19,20,21,22]. However, the further development of molecular markers was impeded by high cost, poor reproducibility, and low polymorphism. In 2002, Brennan and Jorgensen developed SSR (simple sequence repeat) markers by using the microsatellite library enrichment method for blackcurrants [23]. These markers offer high diversity, excellent reproducibility, and ease of use, and have been employed in the analysis of genetic diversity in blackcurrant populations and the identification of related species. However, the cost of developing related SSR markers was not reduced until the development of NGS (next-generation sequencing) technology [24,25]. To date, the development of SSR markers using genomics and EST (expressed sequence tag) has been applied to genetic research on berries such as Vaccinium [26], Rubus [27], and Vitis [28]. In addition, on the basis of an existing collection of blackcurrant resources and breeding, it is equally important to establish a core germplasm set for the better utilization of blackcurrant resources and the reduction of cost of research and breeding, which can be accomplished by the application of SSR markers [29,30].
This study utilized blackcurrant transcriptome data to develop EST-SSR markers, aiming to (1) develop new SSR markers that are universally applicable to crops within the Ribes genus, (2) analyze the genetic diversity levels of existing blackcurrant cultivars in China, (3) establish core germplasm set as a material basis for breeding and selection efforts, and (4) assess the phylogenetic relationships between blackcurrant and other Ribes accessions, providing a database for the intraspecific genetic classification of Ribes.

2. Results

2.1. Identification of SSR Loci

SSR loci were identified for transcriptomic data on blackcurrant fruit development (PRJNA1021373) [31]. Among the 23,220 assembled unigenes with lengths exceeding 1 kb, 9531 (41.0%) of them were found to harbor a total of 14,258 SSR loci, which were predominantly composed of mononucleotide repeats (6211), dinucleotide repeats (4277), and trinucleotide repeats (2469) (Figure 1A, Table S1). In total, 98 motif types were identified among the EST-SSR loci in addition to the presence of compound repeats. The largest number of mononucleotide repeats was A/T (6062), followed by three dinucleotide repeats, including AG/GA (1621), CT/TC (1600), and AT/TA (683). The three most frequent trinucleotide repeats were CTT/GAA (286), AGA/TCT (249), and AAG/TTC (242) (Figure 1B). Except for the compound-type EST-SSR loci, other loci showed lengths ranging from 10 to 72 bp, with 12 bp loci (793 mononucleotide repeats and 1497 dinucleotide repeats) being the most prevalent loci, followed by 15 bp loci (387 mononucleotide repeats and 1588 trinucleotide repeats), and 14 bp loci (447 mononucleotide repeats and 1184 dinucleotide repeats) (Table S2).

2.2. EST-SSR Marker Development and Their Effectiveness Among Different Cultivars

A total of 228 EST-SSR loci were randomly selected, and primers were designed and synthesized to test their amplification on the 107 Ribes accessions. Eventually, 31 pairs of primers (13.6%) could amplify unambiguous bands (Table 1). The number of effective alleles (Ne) varied from 1.13 to 3.12, with a mean value of 1.83; the Shannon information index (I) varied between 0.23 and 1.32, with a mean value of 0.71; the observed heterozygosity (Ho) ranged from 0.07 to 0.71, with an average value of 0.33; the expected heterozygosity (He) values varied from 0.11 to 0.68, with a mean value of 0.40. Polymorphic information content (PIC) varied from 0.14 to 0.67, with a mean value of 0.40. Ten primers exhibited high polymorphisms (PIC > 0.5), among which S-18 exhibited the highest polymorphism. There were 14 primers showing moderate polymorphisms (0.25 ≤ PIC ≤ 0.5). Seven primers showed low polymorphisms (PIC < 0.25), in which S-172 exhibited the lowest polymorphism.

2.3. Genetic Assessment via Neighbor-Joining Cluster Analysis

Genetic relatedness among the 95 blackcurrant cultivars was evaluated using 31 pairs of EST-SSR markers and analyzed with NJ (neighbor-joining) cluster analysis (Figure 2). The NJ cluster analysis classified the 95 blackcurrant cultivars into three clusters, which was not totally consistent with their origins (Figure 2A). Cluster 1 comprised two sub-clusters, with Sub-cluster 1 (purple branch) including nine exotic cultivars and eight Chinese cultivars, while Sub-cluster 2 (pink branch) consisting of 28 cultivars, all of which were from China. Cluster 2 contained 13 exotic cultivars and 11 Chinese cultivars. Cluster 3 included 26 cultivars, half of which were introduced from foreign countries. ‘Baopifengchan’ in Sub-cluster 1 was the most genetically distant from the other 94 cultivars, with a genetic distance of 0.29.
To elucidate the genetic relationships among the 107 Ribes accessions, an NJ tree based on 31 EST-SSR markers was constructed to calculate the genetic distances. The results showed that these Ribes accessions could be divided into two main branches, with one branch including seven cultivars, all of which belong to R. rubrum, while the other branch includes 100 cultivars, which belong to the remaining six species (Figure 2B). Among the 100 cultivars in the second branch, two cultivars, ‘Xinganchabiao’ (R. panciflorum) and ‘Ussuri’ (R. ussuriensis), were grouped together with 95 cultivars of R. nigrum, probably due to gene introgression caused by the use of R. nigrum in crossbreeding trials. For the remaining three cultivars, ‘Hongyeheidou’ (R. americanum) was classified as a separate branch, while ‘Pixwell’ (R. uva-crispa) and ‘Xiangchabiaozi’ (R. odoratum) formed sister branches to each other. Within the blackcurrant gene pool, the 95 cultivars generally exhibited the same affinities as shown in Figure 3A. Nine cultivars in Sub-cluster 1 had a close distance to other Ribes species, with the ‘Sophia’ (R. nigrum) cultivar being the sister of ‘Ussuri’ (R. ussuriensis).

2.4. Genetic Assessment via Population Structure Analysis

Among the 95 blackcurrant cultivars collected and bred, there were twenty Russian cultivars, four Polish cultivars, seven British cultivars, one Swedish cultivar, one Dutch cultivar, one Danish cultivar, one Canadian cultivar, and sixty Chinese cultivars. These cultivars from eight sources were used for population structure analysis. The log-likelihood of the structure analysis indicated an optimal K-value of 3 (K = 3), suggesting that the blackcurrant gene pool could be divided into three clusters (Figure 3A). Cluster A had a total of thirty-three cultivars, including eleven Russian cultivars, three Polish cultivars, two British cultivars, one Swedish cultivar, and sixteen Chinese cultivars. Cluster B had thirty-one cultivars, including eight Russian cultivars, four British cultivars, one Polish cultivar, one Danish cultivar, one Dutch cultivar, one Canadian cultivar, and fifteen Chinese-selected cultivars. Cluster C contained thirty-one cultivars, except for ‘Vologda’ introduced from Russia and ‘Ben Lomond’ introduced from the United Kingdom, and the remaining twenty-nine cultivars were all from China (Figure 3B, Table S3). The AMOVA among clusters at K = 3 showed that genetic variation occurred predominantly between cultivars within the blackcurrant cultivars (81%) (Table 2). The blackcurrant gene pool at K = 5 also showed a peak, though the size was smaller than that observed at K = 3 (Figure 3C, Table S4). Cluster D contained fourteen cultivars, including one Polish cultivar, six Russian cultivars, and seven Chinese cultivars. Cluster E comprised seventeen cultivars, including five Russian cultivars, two British cultivars, one Swedish cultivar, and nine Chinese cultivars. Cluster F had fifteen cultivars, including one Polish cultivar, five Russian cultivars, and nine Chinese cultivars. Cluster G contained five British cultivars, four Russian cultivars, two Polish cultivars, one Canadian cultivar, one Danish cultivar, one Dutch cultivar, and eight Chinese cultivars. Cluster H included twenty-seven cultivars, all of which were selected and bred in China.
We further investigated the population structure of 107 Ribes accessions. The highest peak (K = 2) appeared at ΔK = 657.28, indicating that the tested accessions can be divided into two clusters (Figure S1A). Cluster I (98 accessions) includes all accessions of R. nigrum (95 cultivars), R. ussuriensis (1 accession), R. uva-crispa (1 accession), and R. panciflorum (1 accession), while Cluster II includes all accessions of R. rubrum (7 accessions), R. americanum (1 accession), and R. odoratum (1 accession) (Figure S1B, Table S5). Interestingly, another peak (K = 7) appeared at ΔK = 85.48, where R. rubrum (Cluster VII, 7 accessions) forms a distinct group separate from the other 100 Ribes accessions (Figure S1C, Table S6). The results were consistent with the phylogenetic analysis (Figure 2B).

2.5. Establishment of a Core Germplasm Repository

To better conserve the genetic diversity of the NEAU collection and simultaneously provide instructive information for subsequent breeding programs, a core germplasm set was established using Power Core v 1.0 (PC) and Core Hunter (https://www.corehunter.org/, accessed on 26 May 2024) (CH) programs based on genetic markers, matrices, and genetic parameters of populations. The sample size and genetic diversity parameters for each set are shown in Table 3. The PC set contained 21 (22.1%) blackcurrant cultivars, while the CH set contained 19 (20.0%) cultivars. A comparison of the genetic diversity and retention rate of the two sets revealed that the PC set had higher values of I, He, and PIC and lower values of Ne and Ho than the CH set. The two sets included thirteen repetitive cultivars, while there were eight cultivars unique to the PC set and six cultivars unique to the CH set (Figure 4A, Table S7). To ensure the representativeness of the core germplasm resources, the two sets obtained with different methods were combined to create an integrated core germplasm (IC) set. The IC set included one Swedish cultivar, four Russian cultivars, four Polish cultivars, and eighteen Chinese cultivars. A comparative analysis of genetic diversity parameters revealed that the IC set exhibited significantly higher genetic diversity than the PC and CH sets. The principal coordinate analysis (PCoA) results indicated that the IC set could better represent the initial collection than the PC and CH sets, which is consistent with the initial set in terms of genetic distribution (Figure 4B–D).

3. Discussion

3.1. Genetic Diversity and Genetic Structure in Blackcurrant

The earliest study by R. Brennan utilized the microsatellite-enriched libraries method to develop 11 simple sequence repeat (SSR) markers, achieving diversity levels ranging from 0.18 to 0.91. Due to the high cost and experimental difficulty of this method, it was not subsequently adopted for further marker development [23,32]. The study of SSR markers in blackcurrants did not gain popularity until Joanne R. Russell and her colleagues from the James Hutton Institute in the UK applied transcriptome-based second-generation sequencing (2GS) technology to develop 3000 pairs of expressed sequence tag–simple sequence repeat (EST-SSR) markers [33]. However, there are fewer new SSR markers for genetic identification, mostly following the already developed markers (e.g., RJL1-11, e1-O01, g2-G12, etc.) for analysis [34,35,36]. This study utilized newly developed EST-SSR markers to investigate blackcurrant cultivars collected and cultivated in China for over a century, and for the first time explored primer polymorphism. The mean values of He and Ho for the newly developed EST-SSR markers are lower than those for the SSR markers [23,37]. On the one hand, frequent gene exchange among experimental materials is observed during the process of breeding new varieties. On the other hand, the relatively low variation in EST markers developed during genetic evolution may also be a contributing factor. However, 10 pairs of the developed primers still demonstrate high representativeness (PIC > 0.5). The newly developed markers provide an important tool for further studying the genetic diversity of blackcurrant cultivars, laying a foundation for future cultivar improvement and genetic research.
Genetic polymorphism is ubiquitous and necessary in the process of species evolution, which is formed under the joint action of biological factors such as gene mutation and gene migration and abiotic factors such as climate change and geographical isolation [38,39]. The earlier genetic diversity of blackcurrant was determined based on phenological periods, plant morphological identification, yield, fruit quality, and resistance studies [40]. However, the application of this method is restricted by the influence of the environment on phenotypic traits and the limited morphological variation. In contrast, genetic diversity analysis based on markers such as SSR and SNP allows the more accurate identification and analysis of the diversity of different blackcurrant cultivars. Among them, the ‘Baopifengchan’ cultivar is extremely resistant to cold and powdery mildew, presumably domesticated from a wild variety in Russia. In its original sampling place, other Russian cultivars have natural geographic isolation, less gene exchange, and more genetic distance. The results of population structure analyses with different methods were inconsistent with the geographical origins of blackcurrant. Over the past century, introgression of blackcurrant gene pool from different origins and genetic improvement by breeders have increased gene flow, thereby reducing the geographic differentiation in their distribution. In addition, we corrected the information on three cultivars that were repeatedly introduced at different times, ‘Ojebyn’, ‘Fertodi’, and ‘Hanfeng’, through the results of the trial.

3.2. Construction of Core Germplasm Resources

The construction of core germplasm sets is essential for crops with high economic value and wide cultivation areas to maximize the conservation of genetic diversity while minimizing genetic redundancy [41,42,43]. Researchers can use phenotypic data, geo-environmental data, agronomic trait data, genotypic data, genetic diversity data, and other data for the construction of core germplasm resources [44,45]. For instance, the RIBESCO project, launched from 2007 to 2011, aimed to establish a core germplasm collection of Ribes through phenotypic and molecular characterization, thereby enhancing the informational and safety standards of Ribes genetic resource repositories [46]. This study has the same purpose as the RIBESCO project: to strengthen the characterization and conservation of the Ribes genus, particularly the blackcurrant germplasm, as well as to promote the transfer and use of genetic materials from the Ribes genus. In this study, the genotyping data obtained by EST-SSR markers were used to initially construct core germplasm resources, and a core germplasm resource set containing 27 (28.7%) blackcurrant germplasms was finally constructed. The next step will involve the identification of phenotypic and agronomic traits to address the limitations of the IC set and establish a comprehensive blackcurrant core collection, which will provide more valuable information for guiding parent selection.

3.3. Genetic Polymorphisms Within the Ribes Genus

As economically valuable plants, some Ribes species possess ornamental properties (R. alpinum, R. americanum, and R. odoratum), medicinal value (R. nigrum, R. rubrum, and R. uva-crispa), and stress resistance (R. rubrum) [47,48,49,50]. In recent years, some research has revealed that certain species in the Ribes genus can be crossed with each other, not only improving the environmental resilience of the plant but also increasing the economic value of certain species [37]. The results of phylogenetic and genetic structure studies of seven different Ribes species using EST-SSR markers were similar to the ML evolutionary trees constructed in the previous phase by applying the whole chloroplast genome [51] and by applying chloroplast DNA simple sequence repeats (cpSSRs) [52]. In addition, the phylogenetic tree showed that cultivars of ‘Xinganchabiao’ (R. panciflorum) and R. nigrum were clustered together. Due to the small amount of materials in this experiment for Ribes compared with that of blackcurrant, our results may be relatively biased, and more materials are needed to further explore intrageneric differentiation. Their relationship will be further explored in the future with the joint analysis of their morphological traits.

4. Materials and Methods

4.1. Plant Materials

Over the years, 107 Ribes accessions were collected and selected, which are designated as NEAU collection hereafter. This collection includes ninety-five cultivars of R. nigrum, six accessions of Ribes rubrum (red currant), one cultivar of Ribes rubrum (white currant), one cultivar of Ribes uva-crispa, one cultivar of Ribes ussuriensis, one cultivar of Ribes panciflorum, one cultivar of Ribes americanum, and one cultivar of Ribes odoratum. These accessions included some imported from Russia (27 accessions), Poland (5 accessions), Britain (7 accessions), America (1 accession), Canada (1 cultivar), Denmark (1 cultivar), French (1 accession), Netherland (1 cultivar), Sweden (1 cultivar), and 62 accessions selected and bred in China over the past years (Table 4). The materials are currently grown at the Horticultural Station of Northeast Agricultural University (126.73° E, 45.74° N). Between April and June 2023, tender leaves from all materials were collected and preserved in an ultra-low temperature freezer at −80 °C.

4.2. DNA Extraction and Quantification

DNA extraction was carried out using the Hi-Fast Plant Genomic DNA Kit (GeneBetter BioTech Co., Ltd., Beijing, China) following the manufacturer’s instructions (http://www.gene-better.cn/) (accessed on 12 April 2023). The purity and concentration of the DNA were measured using an ultra-micro spectrophotometer (Implen N60, Munich, Germany), and the DNA samples that passed the test were diluted to 10 ng/μL and stored in a refrigerator at −20 °C.

4.3. Genotyping with EST-SSR Markers

The development of EST-SSR loci and markers was based on the transcriptome data of blackcurrant obtained from the NCBI database (PRJNA1021373) [31]. After assembly, unigenes with lengths greater than 1 kb were selected for subsequent analysis. MISA (MIcroSAtellite identification tool) (v1.0) [53] was used to identify EST-SSR sites with default parameters. Primer Premier 5 [54] was employed to design upstream and downstream primers for the EST-SSRs. The parameters for primer design were as follows: primer pairs with annealing temperatures ranging from 57 to 63 °C, primer lengths between 18 and 27 bp, product lengths ranging from 100 to 280 bp, and GC content between 40% and 60%.
The PCR reactions were conducted in a 20 μL reaction volume, each containing 2 μL of 10 ng/μL DNA template, 1 μL of both forward and reverse primers, and 16 μL of T3 Super PCR Mix (Beijing Tsingke Biotech Co., Ltd., Beijing, China). The PCR program was as follows: an initial denaturation at 98 °C for 2 min, followed by 26–30 cycles of denaturation at 98 °C for 10 s, annealing at 55–59 °C for 15 s, and extension at 72 °C for 15 s; the final extension was performed at 72 °C for 5 min. An electrophoresis apparatus model JY-ECP 3000 (Bio-Rad, Hercules, CA, USA) was used to perform 8% polyacrylamide gel electrophoresis for analyzing PCR products, which was silver-stained for the visualization of the bands following the previously reported protocol [55].

4.4. Statistical Analysis

The assessment of genetic diversity involved the use of GenAlEx (v6.502) [56] and PowerMarker (v3.25) [57] for the calculation of amplification band observed alleles (Na), effective alleles (Ne), expected heterozygosity (He), Shannon’s information index (I), and polymorphic information content (PIC). The population structure analysis of the accessions was conducted using Structure (v 2.3.4) [58]. The analysis of molecular variance (AMOVA) was carried out using GenAlEx (v6.502). Clustering analysis was performed using MEGA7 [59], and the resulting dendrogram was constructed using the Tree plot module. Subsequently, ITOL [60] was used to enhance the esthetics of the phylogenetic tree.

4.5. Construction of a Core Germplasm Repository

Core germplasm libraries were constructed using Power Core (v 1.0) [61] for M-strategy and Core Hunter (https://www.corehunter.org/, accessed on 13 June 2024) for the rapid construction of core subsets based on genetic markers, matrices, and genetic parameters of populations, evaluated using GenAlEx (v6.502) and Powermarker (v3.25). The online website https://www.chiplot.online/ (accessed on 6 July 2024) was used for PCoA (principal coordinate analysis) mapping based on Nei’s distances [62].

5. Conclusions

In this study, the development of universal EST-SSR markers, analysis of genetic polymorphisms, and construction of core germplasm resources were conducted for 95 blackcurrant cultivars widely cultivated in China. A total of 31 pairs of EST-SSR markers were successfully developed and applied to the genetic analysis of blackcurrant cultivars. Additionally, the 31 EST-SSR markers were successfully employed to investigate the genetic relationships within the Ribes genus. The results of NJ and structural analyses indicated that there was no specific correlation between different germplasms based on geographic origins. The 27 blackcurrant cultivars in the integrated core germplasm (IC) exhibited higher genetic similarity to the initial collection compared with the PC and CH sets. The results provide a tool for the further exploration of different species within the genus Ribes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26052346/s1.

Author Contributions

Conceptualization, X.S., C.Z., and D.Q.; methodology, X.S. and Q.F.; validation, X.S. and Q.F.; formal analysis, X.S., J.X., and X.Q.; investigation, X.S., Q.F., X.Q., and H.G.; resources, X.S., H.G., and J.T.; data curation and writing—original draft preparation, X.S.; writing—review and editing, D.Q., C.Z., and X.S.; visualization, J.X.; supervision, J.H. and C.Z.; project administration, J.H.; funding acquisition, J.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by ‘National Key R&D Program of China’ (2022YFD1600500) and the Opening Project of National-local Joint Engineering Research Center for Development and Utilization of Small Fruits in Cold Regions.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Original contributions to this research are included in the article; please contact the corresponding authors for further inquiries.

Acknowledgments

We would like to thank Yonghe Zhang from Northeast Agricultural University for collecting most of the experimental materials, as well as Wujie Zhang and Hongna Gao from the Mudanjiang Branch of the Heilongjiang Academy of Agricultural Sciences for providing some of the plant materials used in this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Weigend, M. Grossulariaceae: Grossulariaceae DC. in Lam. & DC., Fl. Franç., ed. 3., 4, 2: 405 (1805), nom. cons. In Flowering Plants. Eudicots: Berberidopsidales, Buxales, Crossosomatales, Fabales p.p., Geraniales, Gunnerales, Myrtales p.p., Proteales, Saxifragales, Vitales, Zygophyllales, Clusiaceae Alliance, Passifloraceae Alliance, Dilleniaceae, Huaceae, Picramniaceae, Sabiaceae; Springer: Berlin/Heidelberg, Germany, 2007; pp. 168–176. [Google Scholar]
  2. FAOSTAT. Agricultural Organization of the United Nations (2022). Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 29 January 2024).
  3. Slimestad, R.; Solheim, H. Anthocyanins from black currants (Ribes nigrum L.). J. Agric. Food Chem. 2002, 50, 3228–3231. [Google Scholar] [CrossRef] [PubMed]
  4. Xu, Y.; Liu, G.; Yu, Z.; Song, X.; Li, X.; Yang, Y.; Wang, L.; Liu, L.; Dai, J. Purification, characterization and antiglycation activity of a novel polysaccharide from black currant. Food Chem. 2016, 199, 694–701. [Google Scholar] [CrossRef]
  5. Zhang, J.; Sun, L.; Dong, Y.; Fang, Z.; Nisar, T.; Zhao, T.; Wang, Z.-C.; Guo, Y. Chemical compositions and α-glucosidase inhibitory effects of anthocyanidins from blueberry, blackcurrant and blue honeysuckle fruits. Food Chem. 2019, 299, 125102. [Google Scholar] [CrossRef] [PubMed]
  6. Barik, S.K.; Russell, W.R.; Moar, K.M.; Cruickshank, M.; Scobbie, L.; Duncan, G.; Hoggard, N. The anthocyanins in black currants regulate postprandial hyperglycaemia primarily by inhibiting α-glucosidase while other phenolics modulate salivary α-amylase, glucose uptake and sugar transporters. J. Nutr. Biochem. 2020, 78, 108325. [Google Scholar] [CrossRef] [PubMed]
  7. Hui, X.; Wu, G.; Han, D.; Stipkovits, L.; Wu, X.; Tang, S.; Brennan, M.A.; Brennan, C.S. The effects of bioactive compounds from blueberry and blackcurrant powders on the inhibitory activities of oat bran pastes against α-amylase and α-glucosidase linked to type 2 diabetes. Food Res. Int. 2020, 138, 109756. [Google Scholar] [CrossRef]
  8. Piasecka, I.; Brzezińska, R.; Kalisz, S.; Wiktor, A.; Górska, A. Recovery of antioxidants and oils from blackcurrant and redcurrant wastes by ultrasound-assisted extraction. Food Biosci. 2024, 57, 103511. [Google Scholar] [CrossRef]
  9. Sovová, H.; Topiař, M.; Pleskač, O. 1,3-Selective hydrolysis of blackcurrant seed oil for the concentration of alpha- and gamma-linolenic acids. J. Supercrit. Fluids 2023, 200, 105999. [Google Scholar] [CrossRef]
  10. Cortez, R.E.; Gonzalez de Mejia, E. Blackcurrants (Ribes nigrum): A Review on Chemistry, Processing, and Health Benefits. J. Food Sci. 2019, 84, 2387–2401. [Google Scholar] [CrossRef]
  11. Gopalan, A.; Reuben, S.C.; Ahmed, S.; Darvesh, A.S.; Hohmann, J.; Bishayee, A. The health benefits of blackcurrants. Food Funct. 2012, 3, 795–809. [Google Scholar] [CrossRef]
  12. Wei, S.; Zhiguo, D.; Junwei, H. Efficient Cultivation Techniques of Blackcurrant; Heilongjiang Science and Technology Press: Harbin, China, 2004; pp. 6–7. [Google Scholar]
  13. Qin, D.; Huo, J.; Sui, W.; Zhang, Z. Black currant production, breeding and processing in China. Acta Hortic. 2012, 926, 119–122. [Google Scholar]
  14. Li, Y. Berry Cultivation; China Agriculture Press: Beijing, China, 2023; pp. 173–175. [Google Scholar]
  15. Li, Q.; Chen, L.; Ding, Q.; Lin, G. The stable isotope signatures of blackcurrant (Ribes nigrum L.) in main cultivation regions of China: Implications for tracing geographic origin. Eur. Food Res. Technol. 2013, 237, 109–116. [Google Scholar] [CrossRef]
  16. Zhang, W.; Tang, J.; Zhang, S.; Yu, W.; Liu, C.; Gao, H. A Blackcurrant (Ribes nigrum L.) Cultivar: Danjianghei. HortScience 2024, 59, 1065–1066. [Google Scholar] [CrossRef]
  17. Kumar, S.P.J.; Susmita, C.; Sripathy, K.V.; Agarwal, D.K.; Pal, G.; Singh, A.N.; Kumar, S.; Rai, A.K.; Simal-Gandara, J. Molecular characterization and genetic diversity studies of Indian soybean (Glycine max (L.) Merr.) cultivars using SSR markers. Mol. Biol. Rep. 2022, 49, 2129–2140. [Google Scholar] [CrossRef]
  18. Agarwal, M.; Shrivastava, N.; Padh, H. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep. 2008, 27, 617–631. [Google Scholar] [CrossRef]
  19. Lanham, P.; Brennan, R.; Hackett, C.; McNicol, R. RAPD fingerprinting of blackcurrant (Ribes nigrum L.) cultivars. Theor. Appl. Genet. 1995, 90, 166–172. [Google Scholar] [CrossRef] [PubMed]
  20. Lanham, P. Estimation of heterozygosity in Ribes nigrum L. using RAPD markers. Genetica 1996, 98, 193–197. [Google Scholar] [CrossRef]
  21. Ipek, A.; Barut, E.; Gulen, H.; Ipek, M. Genetic Diversity Among Some Currants (Ribes spp.) Cultivars As Assessed BY AFLP MARKERS. Pak. J. Bot. 2010, 42, 1009–1012. [Google Scholar]
  22. Mazeikiene, I.; Bendokas, V.; Baniulis, D.; Staniene, G.; Juskyte, D.A.; Sasnauskas, A.; Stanys, V.; Siksnianas, T. Genetic background of resistance to gall mite in Ribes species. Agric. Food Sci. 2017, 26, 111–117. [Google Scholar] [CrossRef][Green Version]
  23. Brennan, R.; Jorgensen, L.; Woodhead, M.; Russell, J. Development and characterization of SSR markers in Ribes species. Mol. Ecol. Notes 2002, 2, 327–330. [Google Scholar] [CrossRef]
  24. Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef]
  25. Taheri, S.; Lee Abdullah, T.; Yusop, M.R.; Hanafi, M.M.; Sahebi, M.; Azizi, P.; Shamshiri, R.R. Mining and development of novel SSR markers using next generation sequencing (NGS) data in plants. Molecules 2018, 23, 399. [Google Scholar] [CrossRef]
  26. Li, L.; Zhang, H.; Liu, Z.; Cui, X.; Zhang, T.; Li, Y.; Zhang, L. Comparative transcriptome sequencing and de novo analysis of Vaccinium corymbosum during fruit and color development. BMC Plant Biol. 2016, 16, 223. [Google Scholar] [CrossRef]
  27. Foster, T.M.; Bassil, N.V.; Dossett, M.; Leigh Worthington, M.; Graham, J. Genetic and genomic resources for Rubus breeding: A roadmap for the future. Hortic. Res. 2019, 6, 116. [Google Scholar] [CrossRef]
  28. Emanuelli, F.; Lorenzi, S.; Grzeskowiak, L.; Catalano, V.; Stefanini, M.; Troggio, M.; Myles, S.; Martinez-Zapater, J.M.; Zyprian, E.; Moreira, F.M.; et al. Genetic diversity and population structure assessed by SSR and SNP markers in a large germplasm collection of grape. BMC Plant Biol. 2013, 13, 39. [Google Scholar] [CrossRef]
  29. Gómez-Rodríguez, M.V.; Beuzon, C.; González-Plaza, J.J.; Fernández-Ocaña, A.M. Identification of an olive (Olea europaea L.) core collection with a new set of SSR markers. Genet. Resour. Crop Evol. 2021, 68, 117–133. [Google Scholar] [CrossRef]
  30. Wang, R.; Zhong, Y.; Hong, W.; Luo, H.; Li, D.; Zhao, L.; Zhang, H.; Wang, J. Genetic diversity evaluation and core collection construction of pomegranate (Punica granatum L.) using genomic SSR markers. Sci. Hortic. 2023, 319, 112192. [Google Scholar] [CrossRef]
  31. National Center for Biotechnology Information (NCBI). Normal RNA-seq of Ribes nigrum L. 2023. Available online: https://www.ncbi.nlm.nih.gov/bioproject/1021373 (accessed on 3 May 2023).
  32. Edwards, K.; Barker, J.; Daly, A.; Jones, C.; Karp, A. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 1996, 20, 758–760. [Google Scholar] [CrossRef] [PubMed]
  33. Russell, J.R.; Bayer, M.; Booth, C.; Cardle, L.; Hackett, C.A.; Hedley, P.E.; Jorgensen, L.; Morris, J.A.; Brennan, R.M. Identification, utilisation and mapping of novel transcriptome-based markers from blackcurrant (Ribes nigrum). BMC Plant Biol. 2011, 11, 147. [Google Scholar] [CrossRef]
  34. Pikunova, A.; Knyazev, S.; Bakhotskaya, A.Y.; Kochumova, A. Microsatellite loci polymorphism in russian black currant (Ribes nigrum L.) varieties from collection of All-Russian Research Institute of Breeding Fruit Crops. Sel’skokhozyaistvennaya Biol. 2015, 50, 46–54. [Google Scholar] [CrossRef]
  35. Pavlenko, A.; Dolzhikova, M.; Pikunova, A.; Bakhotskaya, A. Use of SSR markers to study genetic polymorphism in members of the Ribes L. genus from the VNIISPK collection. E3S Web Conf. 2021, 254, 02009. [Google Scholar] [CrossRef]
  36. Bushakra, J.; Alvarez, A.; King, R.; Green, J.; Nyberg, A.; Bassil, N. Developing a simple sequence repeat (SSR) fingerprinting set to characterize the NCGR Ribes collection. In Proceedings of the XIII International Rubus and Ribes Symposium 1388, Portland, OR, USA, 9 June 2023; pp. 107–114. [Google Scholar]
  37. Lācis, G.; Kārkliņa, K.; Kota-Dombrovska, I.; Strautiņa, S. Evaluation of blackcurrant (Ribes nigrum) germplasm structure by microsatellite-based fingerprinting for the diversification of the breeding material. J. Berry Res. 2021, 11, 497–510. [Google Scholar] [CrossRef]
  38. Reed, D.H.; Frankham, R. How Closely Correlated Are Molecular and Quantitative Measures of Genetic Variation? A Meta-Analysis. Evolution 2001, 55, 1095–1103. [Google Scholar] [CrossRef] [PubMed]
  39. Ellegren, H.; Galtier, N. Determinants of genetic diversity. Nat. Rev. Genet. 2016, 17, 422–433. [Google Scholar] [CrossRef] [PubMed]
  40. Pluta, S.; Mądry, W.; Sieczko, L. Phenotypic diversity for agronomic traits in a collection of blackcurrant (Ribes nigrum L.) cultivars evaluated in Poland. Sci. Hortic. 2012, 145, 136–144. [Google Scholar] [CrossRef]
  41. Gu, R.; Fan, S.; Wei, S.; Li, J.; Zheng, S.; Liu, G. Developments on Core Collections of Plant Genetic Resources: Do We Know Enough? Forests 2023, 14, 926. [Google Scholar] [CrossRef]
  42. Brown, A.H.D. Core collections: A practical approach to genetic resources management. Genome 1989, 31, 818–824. [Google Scholar] [CrossRef]
  43. Frankel, O.H. Genetic perspectives of germplasm conservation. Genet. Manip. Impact Man Soc. 1984, 161, 170. [Google Scholar]
  44. Guo, Q.; Liu, J.; Li, J.; Cao, S.; Zhang, Z.; Zhang, J.; Zhang, Y.; Deng, Y.; Niu, D.; Su, L.; et al. Genetic diversity and core collection extraction of Robinia pseudoacacia L. germplasm resources based on phenotype, physiology, and genotyping markers. Ind. Crops Prod. 2022, 178, 114627. [Google Scholar] [CrossRef]
  45. Parra-Quijano, M.; Iriondo, J.M.; de la Cruz, M.; Torres, E. Strategies for the Development of Core Collections Based on Ecogeographical Data. Crop Sci. 2011, 51, 656–666. [Google Scholar] [CrossRef][Green Version]
  46. Karhu, S.; Antonius, K.; Kaldmäe, H.; Pluta, S.; Rumpunen, K.; Ryliškis, D.; Sasnauskas, A.; Schulte, E.; Strautina, S.; Grout, B. The core collection of the Northern European gene pool of Ribes created by RIBESCO project. Sodininkystė Daržininkystė 2007, 26, 179–186. [Google Scholar]
  47. Xukuerhan, G.; Ya-li, S.U.N.; Tiemuer, A.; Yeerjiang, H.; Ayoufu, B. Effects of low temperature stress on the content of penetration substance, membrane peroxidation and protective enzyme activity in Ribes rubrum. Xinjiang Agric. Sci. 2019, 56, 685. [Google Scholar]
  48. Kendir, G.; Süntar, I.; Çeribaşı, A.O.; Köroğlu, A. Activity evaluation on Ribes species, traditionally used to speed up healing of wounds: With special focus on Ribes nigrum. J. Ethnopharmacol. 2019, 237, 141–148. [Google Scholar] [CrossRef]
  49. Hummer, K.E.; Dale, A. Horticulture of Ribes. For. Pathol. 2010, 40, 251–263. [Google Scholar] [CrossRef]
  50. Da Silva Pinto, M.; Kwon, Y.-I.; Apostolidis, E.; Lajolo, F.M.; Genovese, M.I.; Shetty, K. Evaluation of Red Currants (Ribes rubrum L.), Black Currants (Ribes nigrum L.), Red and Green Gooseberries (Ribes uva-crispa) for Potential Managentment of Type 2 Diabetes and Hypertension Using in Vitro Models. J. Food Biochem. 2010, 34, 639–660. [Google Scholar] [CrossRef]
  51. Sun, X.; Zhan, Y.; Li, S.; Liu, Y.; Fu, Q.; Quan, X.; Xiong, J.; Gang, H.; Zhang, L.; Qi, H. Complete chloroplast genome assembly and phylogenetic analysis of blackcurrant (Ribes nigrum), red and white currant (Ribes rubrum), and gooseberry (Ribes uva-crispa) provide new insights into the phylogeny of Grossulariaceae. PeerJ 2023, 11, e16272. [Google Scholar] [CrossRef] [PubMed]
  52. Lācis, G.; Kārkliņa, K.; Bartulsons, T.; Stalažs, A.; Jundzis, M.; Baļķe, I.; Ruņģis, D.; Strautiņa, S. Genetic structure of a Ribes genetic resource collection: Inter-and intra-specific diversity revealed by chloroplast DNA simple sequence repeats (cpSSRs). Sci. Hortic. 2022, 304, 111285. [Google Scholar] [CrossRef]
  53. Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
  54. Lalitha, S. Primer Premier 5. Biotech Softw. Internet Rep. Comput. Softw. J. Sci. 2000, 1, 270–272. [Google Scholar] [CrossRef]
  55. Creste, S.; Neto, A.T.; Figueira, A. Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Mol. Biol. Report. 2001, 19, 299–306. [Google Scholar] [CrossRef]
  56. Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  57. Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
  58. Porras-Hurtado, L.; Ruiz, Y.; Santos, C.; Phillips, C.; Carracedo, Á.; Lareu, M.V. An overview of STRUCTURE: Applications, parameter settings, and supporting software. Front. Genet. 2013, 4, 98. [Google Scholar] [CrossRef] [PubMed]
  59. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  60. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
  61. Kim, K.-W.; Chung, H.-K.; Cho, G.-T.; Ma, K.-H.; Chandrabalan, D.; Gwag, J.-G.; Kim, T.-S.; Cho, E.-G.; Park, Y.-J. PowerCore: A program applying the advanced M strategy with a heuristic search for establishing core sets. Bioinformatics 2007, 23, 2155–2162. [Google Scholar] [CrossRef]
  62. Ji, X.; Tang, J.; Zhang, J. Effects of salt stress on the morphology, growth and physiological parameters of Juglans microcarpa L. seedlings. Plants 2022, 11, 2381. [Google Scholar] [CrossRef]
Figure 1. The statistical chart for the distribution of EST-SSR loci. (A) The distribution of EST-SSR loci with different motif types; (B) the distribution of EST-SSR loci in different repetitive sequences.
Figure 1. The statistical chart for the distribution of EST-SSR loci. (A) The distribution of EST-SSR loci with different motif types; (B) the distribution of EST-SSR loci in different repetitive sequences.
Ijms 26 02346 g001
Figure 2. The genetic relationships of blackcurrant cultivars (A) and Ribes accessions (B) determined with 31 EST-SSR markers using the neighbor-joining approach.
Figure 2. The genetic relationships of blackcurrant cultivars (A) and Ribes accessions (B) determined with 31 EST-SSR markers using the neighbor-joining approach.
Ijms 26 02346 g002
Figure 3. Population structure analysis of 95 blackcurrant cultivars based on 31 EST-SSR markers. (A) Delta K calculation was performed for each K value according to Evanno method; (B) population structure analysis (K = 3); (C) population structure analysis (K = 5).
Figure 3. Population structure analysis of 95 blackcurrant cultivars based on 31 EST-SSR markers. (A) Delta K calculation was performed for each K value according to Evanno method; (B) population structure analysis (K = 3); (C) population structure analysis (K = 5).
Ijms 26 02346 g003
Figure 4. The number of cultivars in the two core germplasm sets generated by Power Core (PC) and Core Hunter (CH), and the principal coordinate analysis (PCoA) of blackcurrant gene pool based on Nei’s gene diversity index. The IC set was created by combining the PC set and CH set. (A) Venn diagrams of germplasm resources within the PC and CH sets; (BD) PCoA comparison of the PC, CH, and IC sets with the initial collection.
Figure 4. The number of cultivars in the two core germplasm sets generated by Power Core (PC) and Core Hunter (CH), and the principal coordinate analysis (PCoA) of blackcurrant gene pool based on Nei’s gene diversity index. The IC set was created by combining the PC set and CH set. (A) Venn diagrams of germplasm resources within the PC and CH sets; (BD) PCoA comparison of the PC, CH, and IC sets with the initial collection.
Ijms 26 02346 g004
Table 1. Repeat motif, primer sequence, Tm, and polymorphism information for 31 EST-SSR markers.
Table 1. Repeat motif, primer sequence, Tm, and polymorphism information for 31 EST-SSR markers.
PrimerReportPrimer 5′-3′Tm/°CNaNeIHoHePIC
S-3(CCG)8GCGAAGAAGAAGTTGATCCG
GGAGGGTTCTTCGATTCACA
56.0031.300.460.210.230.21
S-18(TC)8AAGAAGCCTTTCTTGCCTCC
ATGAACCATCATGGGGAAAA
59.0053.121.320.710.680.67
S-24(TC)8TGATGAAAATGGAGGGAAGC
GGATCGAGTCCAAAATCGAA
58.0031.130.270.100.110.20
S-43(CT)9TGATTGCGATAAATCCGACA
TGTGAGGCTCGTGTTTCAAG
57.0032.821.100.590.650.57
S-73(ACA)6AGCTGCCAGTTAGCCATGTT
CCGGAAACTGAGTCATGGAT
58.0031.580.590.460.370.31
S-77(GCA)7CAGAGCCATTGAAGCTCTCC
ACACCAGACCTCTCACGACC
57.0042.130.920.440.530.45
S-78(GAA)6AAACATGAACCTCCCATTCG
CTGCCATGCTTGATACTGGA
57.0031.990.810.260.500.60
S-84(TCA)6CTTTTCCAAGGGTCCAGTGA
TCCTGAATCCCTATTCGTGC
57.0031.610.700.310.380.35
S-92(CAA)6TGTAGGCATTTGTGGCAAGA
TGTTTCAAATGCCAAGCAAA
57.0031.960.850.550.490.49
S-94(GAC)6TTTGAGAGATGGGGGAACAC
GAACAGGCTTTACAACCCCA
57.0021.380.450.120.280.25
S-97(ACC)6GAATCGAAACTTTCCACCGA
GCTCATTGCAACTACTGCCA
57.0021.530.530.390.350.40
S-116(TCA)7ACCACATTCCCAAATTCCAA
CTGTCAAATCGAGTGGCTCA
57.0042.100.950.430.520.47
S-120(GCA)6AGGTGAACACGGTTCTTTGG
TCCTCCCTATTTCTGGGCTT
57.0041.260.400.130.210.19
S-132(TCC)6TCCTAAGCTCTGGTGGTGCT
TGTGGGTCATAATGGTGGTG
57.0031.590.720.290.370.34
S-135(CTG)6GGGAGAATCCTGAATCGACA
CAACACTACCAAATGCCACG
56.0031.260.430.170.210.19
S-155(AG)8CCCTCTTTGCTGTCATGGAT
CAAAGGCAAACAAAAAGCGT
57.0021.480.510.390.330.41
S-160(AT)9AAATTTGCCTATTCACCCCC
AGACCGAGATTTGGTTCGTG
57.0022.180.840.210.540.58
S-163(CA)7GCTGCAGTTTTACCAGAGCC
AGGTGTGGGCATGTAGGAAG
57.0041.540.720.250.350.36
S-165(CA)8AAGCTCACGATGGTGGTGAT
ACGTCAAGCTGAGCAAGGTT
57.0031.540.710.150.350.33
S-172(CT)6TCCTTGACTGGGAAATTCAAA
TCAGCCAATCAATTCAATACCA
57.0021.130.230.090.120.14
S-174(CT)7CCGACTTAAAACCCACTTCC
CAAGCTATGCCAAGTGCGTA
57.0022.000.690.190.500.57
S-179(GA)10GCAAAGCAACACATCAGCAT
AGTTGAGGTATGGGGTGGTG
57.0032.651.060.520.620.55
S-184(AAG)6ATGATGATGACGACGACGAA
CGACAACAGCTCCAGAATCA
57.0031.560.660.420.360.33
S-187(ACA)5GCCTCCCTTAAAACACTCCC
CTAGCCTTTGCCCCTTCTCT
57.0032.871.090.530.650.60
S-188(ACA)5ATGGAAACATGTGACCACCA
AAACAGGGTCGATGGTTCTG
57.0021.370.440.300.270.25
S-189(ACC)5TGCTGATGGCATGTAAGGAG
CCGCACGAGGATAATTTTGT
57.0021.280.460.070.220.21
S-210(CAA)5AGGGTTTGAAGGGTTGCTCT
TGCAGTGAAAGCAACTGTGA
57.0021.500.510.290.330.30
S-224(AC)8AAGCATCCATTGAAGAACCG
CTCAGCACACACAGAGGGAA
57.0021.150.250.100.130.22
S-239(CGA)7TCTGAAAGCACTGACCCTCC
TGAAGCCATCATTCACAACC
57.0042.651.130.530.620.56
S-286(AG)7CTTTCGTCTATGCAGCTCCC
GGGTTGACCCACATCCCTAT
57.0032.571.020.470.610.61
S-288(TGT)5GTTGCTCGCTTTTCGAAGTC
AGCCAAGATGAAGAAAGGCA
57.0042.501.130.430.600.57
Mean 1.830.710.330.400.40
Note: Tm, annealing temperature; Na, the number of alleles observed; Ne, the effective alleles; Ho, the observed heterozygosity; He, the expected heterozygosity; I, the Shannon’s information index; PIC, the polymorphic information content.
Table 2. Analysis of molecular variance (AMOVA) of 95 blackcurrant accessions based on population structure analysis results (K = 3).
Table 2. Analysis of molecular variance (AMOVA) of 95 blackcurrant accessions based on population structure analysis results (K = 3).
SourceDegrees of FreedomSum of SquareMean of SquareEst. Var.%
Among clusters250.72825.3640.2935%
Between blackcurrant cultivars within clusters92629.1936.8390.87714%
Between cultivars within blackcurrant cultivars95483.0005.0845.08481%
Total1891162.921 6.254100%
Table 3. Comparison of genetic diversity among core sets and initial collection.
Table 3. Comparison of genetic diversity among core sets and initial collection.
Collection TypeNNaA%NeIHoHePIC
Initial
collection
952.935 1.7490.6520.3350.3740.354
PC212.83996.7%1.7560.6640.3350.3810.361
CH192.83969.7%1.7700.6560.3360.3780.361
IC272.90398.9%1.7710.6650.3360.3810.370
Note: PC, core germplasm set extracted by Power Core; CH, core germplasm set extracted by Core Hunter; IC, integrated core collection; A%, allele retention rate.
Table 4. Ribes accessions collected from eight different origins.
Table 4. Ribes accessions collected from eight different origins.
NO.Accessions NameSpeciesOrigin
1Ben NevisRibes nigrumBritain
2BaldwinRibes nigrumBritain
3Mendip CrossRibes nigrumBritain
4Big BenRibes nigrumBritain
5Ben GairnRibes nigrumBritain
6Ben TirranRibes nigrumBritain
7Ben LomondRibes nigrumBritain
8OjebynRibes nigrumSweden
9LiangyehoupiRibes nigrumRussia
10ZushaRibes nigrumRussia
11ExoticRibes nigrumRussia
12XielieqinayaRibes nigrumRussia
13VologdaRibes nigrumRussia
14GlobusRibes nigrumRussia
15GejinzigeRibes nigrumRussia
16AdeliniaRibes nigrumRussia
17SophiaRibes nigrumRussia
18LamaRibes nigrumRussia
19BelaruskajaRibes nigrumRussia
20BagiraRibes nigrumRussia
21ZwiezdaRibes nigrumRussia
22GezishisengRibes nigrumRussia
23KantataRibes nigrumRussia
24NailorRibes nigrumRussia
25Primorskij pearlRibes nigrumRussia
26E-14Ribes nigrumRussia
27E-15Ribes nigrumRussia
28BaopifengchanRibes nigrumRussia
29FertodiRibes nigrumPoland
30OrvilleRibes nigrumPoland
31BagadaRibes nigrumPoland
32BonaRibes nigrumPoland
33RoodknopRibes nigrumNetherland
34RisagerRibes nigrumDenmark
35Black smithRibes nigrumCanada
36C17Ribes nigrumChina
37C19Ribes nigrumChina
38C28Ribes nigrumChina
39C11Ribes nigrumChina
4094-4-13Ribes nigrumChina
4117-29Ribes nigrumChina
42W1-2Ribes nigrumChina
43E16Ribes nigrumChina
4416ARibes nigrumChina
4514(17-5)Ribes nigrumChina
46A16Ribes nigrumChina
47HanfengRibes nigrumChina
4819CRibes nigrumChina
4918CRibes nigrumChina
5017BRibes nigrumChina
5113CRibes nigrumChina
5214CRibes nigrumChina
5315CRibes nigrumChina
5416CRibes nigrumChina
5517CRibes nigrumChina
56Aw-2Ribes nigrumChina
5715-3Ribes nigrumChina
5817-29-1Ribes nigrumChina
5915-4Ribes nigrumChina
60BW-2Ribes nigrumChina
6115-2Ribes nigrumChina
6215-1Ribes nigrumChina
63Aw-4Ribes nigrumChina
64Aw-3Ribes nigrumChina
65Yade-3Ribes nigrumChina
6617-29-3Ribes nigrumChina
6715-8Ribes nigrumChina
68Aw-1Ribes nigrumChina
6915-10Ribes nigrumChina
7017-29-2Ribes nigrumChina
7117-29-5Ribes nigrumChina
7215-6Ribes nigrumChina
73BW-3Ribes nigrumChina
74Yade-1Ribes nigrumChina
75Yade-2Ribes nigrumChina
7615-5Ribes nigrumChina
77Bw-1Ribes nigrumChina
78Lw-1Ribes nigrumChina
7915-9Ribes nigrumChina
8017-29-4Ribes nigrumChina
81Yade-4Ribes nigrumChina
820A14Ribes nigrumChina
83Bw-4Ribes nigrumChina
8415-7Ribes nigrumChina
85SU-3Ribes nigrumChina
86SuiyanyihaoRibes nigrumChina
87SuiyanerhaoRibes nigrumChina
88DanjiangheiRibes nigrumChina
89SuanpanziRibes nigrumChina
90Muxuan 2008-6Ribes nigrumChina
91Muxuan 2012-6Ribes nigrumChina
92Muxuan 2015-10Ribes nigrumChina
93Muxuan 2011-14Ribes nigrumChina
94Muxuan 2013-10Ribes nigrumChina
95Muxuan 2015-13Ribes nigrumChina
96CrusaderRibes rubrumRussia
97ER-1Ribes rubrumRussia
98MaerRibes rubrumRussia
99Red SpringRibes rubrumRussia
100E-REDRibes rubrumRussia
101CherryRibes rubrumPoland
102Witte ParelRibes rubrumFrench
103UssuriRibes ussuriensisRussia
104PixwellRibes uva-crispaRussia
105HongyeheidouRibes americanumAmerica
106XiangchabiaoziRibes odoratumChina
107XinganchabiaoRibes panciflorumChina
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, X.; Fu, Q.; Qin, D.; Xiong, J.; Quan, X.; Guo, H.; Tang, J.; Huo, J.; Zhu, C. Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers. Int. J. Mol. Sci. 2025, 26, 2346. https://doi.org/10.3390/ijms26052346

AMA Style

Sun X, Fu Q, Qin D, Xiong J, Quan X, Guo H, Tang J, Huo J, Zhu C. Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers. International Journal of Molecular Sciences. 2025; 26(5):2346. https://doi.org/10.3390/ijms26052346

Chicago/Turabian Style

Sun, Xinyu, Qiang Fu, Dong Qin, Jinyu Xiong, Xin Quan, Hao Guo, Jiahan Tang, Junwei Huo, and Chenqiao Zhu. 2025. "Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers" International Journal of Molecular Sciences 26, no. 5: 2346. https://doi.org/10.3390/ijms26052346

APA Style

Sun, X., Fu, Q., Qin, D., Xiong, J., Quan, X., Guo, H., Tang, J., Huo, J., & Zhu, C. (2025). Genetic Diversity Assessment and Core Germplasm Screening of Blackcurrant (Ribes nigrum) in China via Expressed Sequence Tag–Simple Sequence Repeat Markers. International Journal of Molecular Sciences, 26(5), 2346. https://doi.org/10.3390/ijms26052346

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop