Overview and Prospects of DNA Sequence Visualization
Abstract
1. Introduction
1.1. Background
1.2. Focus and Vision of This Paper
2. Two-Dimensional (2D) Visualization
2.1. Random Walk Visualization
2.2. Chaos Game Representation (CGR)
2.3. Double Vector and Double Nucleotide
2.4. Spectral Visualization
2.5. Worm Curves and Five-Color Map
3. Three-Dimensional (3D) Visualization
3.1. Z-Curve
3.2. L-Curve
3.3. DN-Curve 3D
3.4. C-Curve
4. Dynamic Visualization
4.1. Spectral Dynamic Visualization
4.2. Two-Dimensional Dynamic Visualization
4.3. Coded Mark Inversion (CMI) Encoding Dynamic Visualization
5. Four-Dimensional Numerical Representation
5.1. The Bandwidth Numerical Representation
5.2. Chemical and Physical Properties Numerical Representation
5.3. Bases Combinations Numerical Representation
6. Discussion and Prospect
6.1. Analysis of Different Sequence Visualizations
6.1.1. Two-Dimensional Representation
- (1)
- Intuitiveness: two-dimensional representation enables quick identification of base distribution patterns and probabilistic features.
- (2)
- Information richness: two-dimensional representation captures and conveys more information than one-dimensional methods, providing a richer display of data.
- (3)
- Handling large data volumes: Two-dimensional representation methods can effectively process large datasets. For example, DNA sequence visualization models based on grayscale images can handle extensive DNA sequences with minimal loss of information.
- (4)
- Low computational complexity: graphical representation methods provide a low computational complexity approach to describing gene sequences, significantly accelerating the research process compared to traditional approaches.
- (1)
- Information loss: some two-dimensional models may be unsuitable for representing long DNA sequences, potentially resulting in the loss of detailed information and increasing the risk of observers overlooking critical data.
- (2)
- Limited distinguishability: visualization based on grayscale images may have limited distinguishability, potentially hindering the effective extraction of useful information.
- (3)
- Localization ambiguity: when distribution differences arise in the graphical representation of gene sequences, pinpointing the exact locations of the differing sequences becomes challenging.
- (4)
- Technical limitations: Two-dimensional visualization models, such as spectral-based models, are effective in revealing the properties of shorter DNA sequences. However, they face challenges when applied to long DNA sequences due to limitations in resolution and clarity. In such cases, key structural and compositional features may become obscured or difficult to interpret within a two-dimensional framework.
6.1.2. Three-Dimensional and Higher-Dimensional Representation Approaches
- (1)
- Understanding spatial conformation mechanisms: three-dimensional genomics provides a clearer understanding of the mechanisms underlying changes in chromatin spatial conformation and gene transcriptional regulation.
- (2)
- Comprehensive mapping of intracellular chromatin interactions: three-dimensional genomics facilitates the comprehensive mapping of chromatin interactions within cells.
- (3)
- Revealing genome functional mechanisms: three-dimensional genomics, combined with 3C-based techniques and other derivative sequencing technologies, has provided scientists with an increasingly clear understanding of the spatial conformation of genomes in plants, animals, and microorganisms.
- (4)
6.1.3. Influence of DNA Sequence Representation on Machine Learning
- (1)
- Differences in feature extraction capability: DNA sequence representation methods convert sequence data into numerical features that can be processed by machine learning models. Different representation methods capture various local features (such as domains or motifs) and global features (such as information from entire coding regions), thereby influencing the performance of machine learning models.
- (2)
- Differences in computational complexity: two-dimensional and higher-dimensional sequence representation methods vary in data volume, storage requirements, and modeling mechanisms within machine learning models, resulting in differences in computational complexity.
- (3)
- Differences in machine model selection: model selection is often guided by the specific DNA sequence representation method used, as different models have varying requirements for DNA sequence representations.
- (4)
- Differences in model generalization ability: Different DNA sequence representation methods exhibit varying levels of generalization ability. Due to differences in the underlying mechanisms of these representations, machine learning models demonstrate different adaptability to sparse or imbalanced training data. Low-dimensional representations generally offer better generalization than higher-dimensional representations.
6.2. Application Fields of Sequence Visualization
6.2.1. Application Field Overview
- (1)
- Genome Analysis and Disease Decoding
- (2)
- Personalized Medicine
- (3)
- Gene Expression and Regulatory Prediction
- (4)
- Promoter Engineering Research
- (5)
- Genomics Research
6.2.2. Multidimensional Biological Data Integration and Analysis
- (1)
- Heterogeneous Integration and Standardization of Multi-Omics Data
- (2)
- Complex Feature Extraction from High-Dimensional Sequence Data
6.2.3. Disease-Associated Mutation Analysis and Personalized Therapy
- (1)
- Mutation Prediction in Personalized Medicine
- (2)
- Gene Editing and Targeted Therapy Design
6.3. Potential Research Directions
6.3.1. Construction of Knowledge Graph for DNA Sequence Big Data
- (1)
- General framework
- (2)
- Ontology Construction
- (3)
- Community structure fusion
- (4)
- Knowledge fusion
- (5)
- Named Entity Recognition (NER)
6.3.2. Machine Learning-Based DNA Sequence Image Generation
- (1)
- DNA sequence image generation framework
- (2)
- Machine Learning Algorithms in DNA Sequence Image Generation
7. Summary
Author Contributions
Funding
Data Availability Statements
Conflicts of Interest
Abbreviation
Abbreviation | Detail |
Attentional-CRF | Attentional CRF |
BERT | Bidirectional Encoder Representations from Transformers |
BiLSTM | Bidirectional Long Short-Term Memory |
BIRCH | Balanced Iterative Reducing and Clustering Using Hierarchies |
BN | Bayesian Network |
CGR | Chaos Game visualization |
CMI | Coded Mark Inversion |
CNN | Convolutional Neural Network |
CRF | Conditional Random Field |
DBN | Deep Belief Network |
DBSCAN | Density-Based Spatial Clustering of Applications with Noise |
DNA SV | DNA sequence visualization |
DN-curve | Double Nucleotide Curve |
DT | Decision Tree |
DV-Curve | Double Vector |
EA | Evolutionary Algorithm |
GANs | Generative Adversarial Networks |
HMM | Hidden Markov Model |
KG | Knowledge Graph |
LSR | Letter Sequence Representation |
LSTM | Long Short-Term Memory |
ME | Maximum Entropy |
MEMM | Maximum Entropy Markov Model |
NER | Named Entity Recognition |
NN | Neural Network |
PCA | Principal Component Analysis |
RL | Reinforcement Learning |
RNNs | Recurrent Neuron Networks |
SVM | Support Vector Machine |
Transformer-CRF | Transformer with Conditional Random Field |
δ1 | ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG |
δ2 | ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGG |
δ3 | ATGACTTTGCTGAGTGCTGAGGAGAATGCTCATGTCACCTCTCTGTGGGGCAAGGTGGATGTAGAGAAAGTTGGTGGCGAGGCCTTGGGCAG |
δ4 | ATGGTGCACCTGACTGATGCTGAGAAGTCTGCTGTCTCTTGCCTGTGGGCAAAGGTGAACCCCGATGAAGTTGGTGGTGAGGCCCTGGGCAGG |
δ5 | ATGGTGCACCTAACTGATGCTGAGAAGGCTACTGTTAGTGGCCTGTGGGGAAAGGTGAACCCTGATAATGTTGGCGCTGAGGCCCTGGGCAG |
δ6 | ATGCTGACTGCTGAGGAGAAGGCTGCCGTCACCGGCTTCTGGGGCAAGGTGAAAGTGGATGAAGTTGGTGCTGAGGCCCTGGGCAG |
δ7 | ATGGTGCACTTGACTTCTGAGGAGAAGAACTGCATCACTACCATCTGGTCTAAGGTGCAGGTTGACCAGACTGGTGGTGAGGCCCTTGGCAG |
ρ1 | ACATTTGCTTCTGACACAACTGTGTTCACTAGCACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGCAAGCTGCACGTGGATCCTGAGAACTTCAAGCTCCTGGGCAATGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAG |
ρ2 | ATGGTGCACTTGACTTCTGAGGAGAAGAACTGCATCACTACCATCTGGTCTAAGGTGCAGGTTGACCAGACTGGTGGTGAGGCCCTTGGCAGGATGCTCGTTGTCTACCCCTGGACCACCAGGTTTTTTGGGAGCTTTGGTGATCTGTCCTCTCCTGGCGCTGTCATGTCAAATTCTAAGGTTCAAGCCCATGGTGCTAAGGTGTTGACCTCCTTCGGTGAAGCAGTCAAGCATTTGGACAACCTGAAGGGTACTTATGCCAAGTTGAGTGAGCTCCACTGTGACAAGCTGCATGTGGACCCTGAGAACTTCAAGATGCTGGGGAATATCATTGTGATCTGCCTGGCTGAGCACTTTGGCAAGGATTTTACTCCTGAATGTCAGGTTGCTTGGCAGAAGCTCGTGGCTGGAGTTGCCCATGCCCTGGCCCACAAGTACCACTAA |
φ | CTAACTTTCCTCATTGCTAACCAGCATTCTCATGTCACCTCTCTGTCCTTCAAGCTTCATGTATATAAACTTTCTTTCCAGCCCTTGGGCAT |
ATGGTGCACC | |
′ | ATGGTGCACC |
″ | ATGCTGACTG |
γ | ATGGTGCACCTGACTCCTGA |
′ | ATGATGCACC |
TGTGCTGAGTGAGGTCAGAAACTT | |
ATGACTTTGCTGAGT |
References
- Pique-Regi, R.; Degner, J.F.; Pai, A.A.; Gaffney, D.J.; Gilad, Y.; Pritchard, J.K. Accurate inference of transcription factor binding from DNA sequence and chromatin accessibility data. Genome Res. 2011, 21, 447–455. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.X.; Zhang, B.; Li, H.Y.; Zhou, L.X.; Li, Z.X.; Long, Y.K.; Han, W.K.; Wang, M.R.; Cui, H.H.; Li, J.J.; et al. Annotating TSSs in Multiple Cell Types Based on DNA Sequence and RNA-seq Data via DeeReCT-TSS. Genom. Proteom. Bioinform. 2022, 20, 959–973. [Google Scholar] [CrossRef]
- Zullo, J.M.; Demarco, I.A.; Pique-Regi, R.; Gaffney, D.J.; Epstein, C.B.; Spooner, C.J.; Luperchio, T.R.; Bernstein, B.E.; Pritchard, J.K.; Reddy, K.L.; et al. DNA Sequence-Dependent Compartmentalization and Silencing of Chromatin at the Nuclear Lamina. Cell 2012, 149, 1474–1487. [Google Scholar] [CrossRef]
- Ao, C.Y.; Jiao, S.H.; Wang, Y.S.; Yu, L.; Zou, Q. Biological Sequence Classification: A Review on Data and General Methods. Research 2022, 2022, 11. [Google Scholar] [CrossRef] [PubMed]
- Butz, S.; Schmolka, N.; Karemaker, I.D.; Villasenor, R.; Schwarz, I.; Domcke, S.; Uijttewaal, E.C.H.; Jude, J.; Lienert, F.; Krebs, A.R.; et al. DNA sequence and chromatin modifiers cooperate to confer epigenetic bistability at imprinting control regions. Nat. Genet. 2022, 54, 1702. [Google Scholar] [CrossRef]
- Osama, S.; Shaban, H.; Ali, A.A. Gene reduction and machine learning algorithms for cancer classification based on microarray gene expression data: A comprehensive review. Expert Syst. Appl. 2023, 213, 118946. [Google Scholar] [CrossRef]
- Petti, S.; Eddy, S.R. Constructing Benchmark Test Sets for Biological Sequence Analysis Using Independent Set Algorithms. PLoS Comput. Biol. 2023, 19, e1010971. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.B.; Li, H.Q.; Luo, X.T.; Li, H.Y.; Gao, Q.Y.; Zhang, L.W.Y.; Teng, Y.Y.; Zhao, Q.; Zuo, Z.X.; Ren, J. IBS 2.0: An upgraded illustrator for the visualization of biological sequences. Nucleic Acids Res. 2022, 50, W420–W426. [Google Scholar] [CrossRef] [PubMed]
- Cangialosi, A.; Yoon, C.; Liu, J.; Huang, Q.; Guo, J.K.; Nguyen, T.D.; Gracias, D.H.; Schulman, R. DNA sequence-directed shape change of photopatterned hydrogels via high-degree swelling. Science 2017, 357, 1126–1129. [Google Scholar] [CrossRef] [PubMed]
- Blatnik, M.C.; Gallagher, T.L.; Amacher, S.L. Keeping development on time: Insights into post-transcriptional mechanisms driving oscillatory gene expression during vertebrate segmentation. Wiley Interdiscip. Rev.-RNA 2023, 14, e1751. [Google Scholar] [CrossRef] [PubMed]
- Allan, M.F.; Brivanlou, A.; Rouskin, S. RNA levers and switches controlling viral gene expression. Trends Biochem. Sci. 2023, 48, 391–406. [Google Scholar] [CrossRef] [PubMed]
- Nandy, A.; Basak, S.C.; Gute, B.D. Graphical representation and numerical characterization of H5N1 avian flu neuraminidase gene sequence. J. Chem. Inf. Model. 2007, 47, 945–951. [Google Scholar] [CrossRef] [PubMed]
- Miska, E.A.; Ferguson-Smith, A.C. Transgenerational inheritance: Models and mechanisms of non-DNA sequence-based inheritance. Science 2016, 354, 59–63. [Google Scholar] [CrossRef] [PubMed]
- Li, M.Y.; Wang, I.X.; Li, Y.; Bruzel, A.; Richards, A.L.; Toung, J.M.; Cheung, V.G. Widespread RNA and DNA Sequence Differences in the Human Transcriptome. Science 2011, 333, 53–58. [Google Scholar] [CrossRef] [PubMed]
- Rozas, J.; Ferrer-Mata, A.; Sanchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sanchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Jing, R.Y.; Xue, L.; Li, M.L.; Yu, L.Z.; Luo, J.S. layerUMAP: A tool for visualizing and understanding deep learning models in biological sequence classification using UMAP. Iscience 2022, 25, 105530. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.; Karchin, R.; Beer, M.A. Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011, 21, 2167–2180. [Google Scholar] [CrossRef] [PubMed]
- Qi, Z.; Redding, S.; Lee, J.Y.; Gibb, B.; Kwon, Y.; Niu, H.Y.; Gaines, W.A.; Sung, P.; Greene, E.C. DNA Sequence Alignment by Microhomology Sampling during Homologous Recombination. Cell 2015, 160, 856–869. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.Z.; Wu, F.X.; Zhang, W.J. Reverse engineering of gene regulatory networks from biological data. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2012, 2, 365–385. [Google Scholar] [CrossRef]
- Kaur, A.; Chauhan, A.P.S.; Aggarwal, A.K. Prediction of Enhancers in DNA Sequence Data using a Hybrid CNN-DLSTM Model. IEEE-ACM Trans. Comput. Biol. Bioinform. 2023, 20, 1327–1336. [Google Scholar] [CrossRef]
- Cui, X.; Lu, F.L.; Qiu, Q.; Zhou, B.; Gu, L.F.; Zhang, S.B.; Kang, Y.Y.; Cui, X.K.; Ma, X.; Yao, Q.Q.; et al. REF6 recognizes a specific DNA sequence to demethylate H3K27me3 and regulate organ boundary formation in Arabidopsis. Nat. Genet. 2016, 48, 694–699. [Google Scholar] [CrossRef]
- Bainbridge, M.N.; Wang, M.; Wu, Y.Q.; Newsham, I.; Muzny, D.M.; Jefferies, J.L.; Albert, T.J.; Burgess, D.L.; Gibbs, R.A. Targeted enrichment beyond the consensus coding DNA sequence exome reveals exons with higher variant densities. Genome Biol. 2011, 12, R68. [Google Scholar] [CrossRef] [PubMed]
- Naresh, V.S.; Thamarai, M. Privacy-preserving data mining and machine learning in healthcare: Applications, challenges, and solutions. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2023, 13, e1490. [Google Scholar] [CrossRef]
- Guo, Q.Y.; Zhuang, F.Z.; Qin, C.; Zhu, H.S.; Xie, X.; Xiong, H.; He, Q. A Survey on Knowledge Graph-Based Recommender Systems. IEEE Trans. Knowl. Data Eng. 2022, 34, 3549–3568. [Google Scholar] [CrossRef]
- Wani, M.A.; Sultan, B. Deep learning based image steganography: A review. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2022, 13, e1481. [Google Scholar] [CrossRef]
- Chakraborty, N.; Lukovnikov, D.; Maheshwari, G.; Trivedi, P.; Lehmann, J.; Fischer, A. Introduction to neural network-based question answering over knowledge graphs. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2021, 11, e1389. [Google Scholar] [CrossRef]
- Marcinkevics, R.; Vogt, J.E. Interpretable and explainable machine learning: A methods-centric overview with concrete examples. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2023, 13, e1493. [Google Scholar] [CrossRef]
- Gates, M.A. A simple way to look at DNA. J. Theor. Biol. 1986, 119, 319–328. [Google Scholar] [CrossRef]
- Cui, F.; Zhang, Z.; Zou, Q. Sequence representation approaches for sequence-based protein prediction tasks that use deep learning. Brief. Funct. Genom. 2021, 20, 61–73. [Google Scholar] [CrossRef] [PubMed]
- Li, C.C.; Dai, Q.; He, P.A. A time series representation of protein sequences for similarity comparison. J. Theor. Biol. 2022, 538, 111039. [Google Scholar] [CrossRef] [PubMed]
- Das, S.; Das, A.; Bhattacharya, D.K.; Tibarewala, D.N. A new graph-theoretic approach to determine the similarity of genome sequences based on nucleotide triplets. Genomics 2020, 112, 4701–4714. [Google Scholar] [CrossRef] [PubMed]
- Mu, Z.C.; Yu, T.; Liu, X.P.; Zheng, H.Y.; Wei, L.Y.; Liu, J.T. FEGS: A novel feature extraction model for protein sequences and its applications. BMC Bioinform. 2021, 22, 297. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Peng, Y. A Novel 2-D Graphical Representation for DNA Sequences Based on the Chemical Properties. J. Comput. Theor. Nanosci. 2013, 10, 2102–2105. [Google Scholar] [CrossRef]
- Mu, Z.C.; Yu, T.; Qi, E.F.; Liu, J.T.; Li, G.J. DCGR: Feature extractions from protein sequences based on CGR via remodeling multiple information. BMC Bioinform. 2019, 20, 351. [Google Scholar] [CrossRef]
- Zheng, K.; You, Z.H.; Li, J.Q.; Wang, L.; Guo, Z.H.; Huang, Y.A. iCDA-CGR: Identification of circRNA-disease associations based on Chaos Game Representation. PLoS Comput. Biol. 2020, 16, e1007872. [Google Scholar] [CrossRef]
- Lochel, H.F.; Heider, D. Chaos game representation and its applications in bioinformatics. Comput. Struct. Biotechnol. J. 2021, 19, 6263–6271. [Google Scholar] [CrossRef]
- Gupta, M.K.; Niyogi, R.; Misra, M. A new adjacent pair 2d graphical representation of DNA sequences. J. Biol. Syst. 2013, 21, 1350005. [Google Scholar] [CrossRef]
- Itaman, S.; Enikolopov, G.; Podgorny, O.V. Detection of De Novo Dividing Stem Cells In Situ through Double Nucleotide Analogue Labeling. Cells 2022, 11, 4001. [Google Scholar] [CrossRef] [PubMed]
- Xie, G.S.; Jin, X.B.; Yang, C.L.; Pu, J.X.; Mo, Z.X. Graphical Representation and Similarity Analysis of DNA Sequences Based on Trigonometric Functions. Acta Biotheor. 2018, 66, 113–133. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Liu, Z.J.; Sheng, Y.H. On Double Vector Bundles. Acta Math. Sin. 2014, 30, 1655–1673. [Google Scholar] [CrossRef]
- Meinrenken, E. Quotients of double vector bundles and multigraded bundles. J. Geom. Mech. 2022, 14, 307–329. [Google Scholar] [CrossRef]
- Waz, P.; Bielinska-Waz, D. Non-standard similarity/dissimilarity analysis of DNA sequences. Genomics 2014, 104, 464–471. [Google Scholar] [CrossRef] [PubMed]
- Quan, L.J.; Sun, X.Y.; Wu, J.; Mei, J.; Huang, L.Q.; He, R.J.; Nie, L.P.; Chen, Y.; Lyu, Q. Learning Useful Representations of DNA Sequences From ChIP-Seq Datasets for Exploring Transcription Factor Binding Specificities. IEEE-ACM Trans. Comput. Biol. Bioinform. 2022, 19, 998–1008. [Google Scholar] [CrossRef]
- Shu, H.; Zhou, J.; Lian, Q.; Li, H.; Zhao, D.; Zeng, J.; Ma, J. Modeling gene regulatory networks using neural network architectures. Nat. Comput. Sci. 2021, 1, 491–501. [Google Scholar] [CrossRef] [PubMed]
- Kania, A.; Sarapata, K. Multifarious aspects of the chaos game representation and its applications in biological sequence analysis. Comput. Biol. Med. 2022, 151, 106243. [Google Scholar] [CrossRef]
- Chen, X.L.; Xie, H.R.; Li, Z.X.; Cheng, G. Topic analysis and development in knowledge graph research: A bibliometric review on three decades. Neurocomputing 2021, 461, 497–515. [Google Scholar] [CrossRef]
- Rosnik, A.M.; Curutchet, C. Theoretical Characterization of the Spectral Density of the Water-Soluble Chlorophyll-Binding Protein from Combined Quantum Mechanics/Molecular Mechanics Molecular Dynamics Simulations. J. Chem. Theory Comput. 2015, 11, 5826–5837. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.L. A Joint Probabilistic Model in DNA Sequences. Curr. Bioinform. 2018, 13, 234–240. [Google Scholar] [CrossRef]
- Wu, R.X.; Liu, W.J.; Mao, Y.Y.; Zheng, J. 2D Graphical Representation of DNA Sequences Based on Variant Map. IEEE Access 2020, 8, 173755–173765. [Google Scholar] [CrossRef]
- Zhang, Z.J.; Zeng, X.X.; Song, T.; Chen, Z.H.; Wang, X.; Ye, Y.M. WormStep: An Improved Compact Graphical Representation of DNA Sequences Based on Worm Curve. J. Comput. Theor. Nanosci. 2013, 10, 189–193. [Google Scholar] [CrossRef]
- Zhang, R.; Zhang, C.T. Z curves, an intutive tool for visualizing and analyzing the DNA sequences. J. Biomol. Struct. Dyn. 1994, 11, 767–782. [Google Scholar] [CrossRef] [PubMed]
- Yan, M.; Lin, Z.S.; Zhang, C.T. A new fourier transform approach for protein coding measure based on the format of the Z curve. Bioinform. (Oxf. Engl.) 1998, 14, 685–690. [Google Scholar] [CrossRef]
- Zhang, C.-T.; Zhang, R.; Ou, H.-Y. The Z curve database: A graphic representation of genome sequences. Bioinformatics 2003, 19, 593–599. [Google Scholar] [CrossRef] [PubMed]
- Zheng, W.X.; Wang, S.X.; Liu, H. Highly Accurate Gene Essentiality Prediction with W-Nucleotide Z Curve Features and Feature Selection Technique in Saccharomyces cerevisiae. Curr. Bioinform. 2021, 16, 1081–1088. [Google Scholar] [CrossRef]
- Zhang, D.; Wang, Y.; Liu, Z.; Dai, S. Improving NoSQL Storage Schema Based on Z-Curve for Spatial Vector Data. IEEE Access 2019, 7, 78817–78829. [Google Scholar] [CrossRef]
- Wang, S.C.; Huang, S.X.; Lu, S.; Yan, B. 3-D Ionospheric Tomography Using Model Function in the Modified L-Curve Method. IEEE Trans. Geosci. Remote 2019, 57, 3135–3147. [Google Scholar] [CrossRef]
- Liu, J.; Xie, J.S.; Li, B.; Hu, B.B. Regularized Cubic B-Spline Collocation Method With Modified L-Curve Criterion for Impact Force Identification. IEEE Access 2020, 8, 36337–36349. [Google Scholar] [CrossRef]
- Paul, T.; Chi, P.W.; Wu, P.M.; Wu, M.K. Computation of distribution of relaxation times by Tikhonov regularization for Li ion batteries: Usage of L-curve method. Sci. Rep. 2021, 11, 12624. [Google Scholar] [CrossRef]
- Vujovic, M.; Marcatili, P.; Chain, B.; Kaplinsky, J.; Andresen, T.L. Signatures of T cell immunity revealed using sequence similarity with TCRDivER algorithm. Commun. Biol. 2023, 6, 357. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.J.; Huang, D.S. Graphical Representation for DNA Sequences via Joint Diagonalization of Matrix Pencil. IEEE J. Biomed. Health Inform. 2013, 17, 503–511. [Google Scholar] [CrossRef]
- Peng, Y.; Liu, Y.W. An Improved Mathematical Object for Graphical Representation of DNA Sequences. Curr. Bioinform. 2015, 10, 332–336. [Google Scholar] [CrossRef]
- Liu, X.Q.; Dai, Q.; Xiu, Z.; Wang, T. Pnn-curve: A new 2d graphical representation of DNA sequences and its application. J Theor Biol 2006, 243, 555–561. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Liu, Y.W. A Novel Numerical Characterization for Graphical Representations of DNA Sequences. Mini-Rev. Org. Chem. 2015, 12, 534–539. [Google Scholar] [CrossRef]
- Jafarzadeh, N.; Iranmanesh, A. C-curve: A novel 3D graphical representation of DNA sequence based on codons. Math. Biosci. 2013, 241, 217–224. [Google Scholar] [CrossRef]
- Li, Y.S.; Liu, Q.; Zheng, X.Q. DUC-Curve, a highly compact 2D graphical representation of DNA sequences and its application in sequence alignment. Phys. A-Stat. Mech. Its Appl. 2016, 456, 256–270. [Google Scholar] [CrossRef]
- Qin, X.Y.; Zhang, L.; Liu, M.; Xu, Z.W.; Liu, G.Z. ASFold-DNN: Protein Fold Recognition Based on Evolutionary Features With Variable Parameters Using Full Connected Neural Network. IEEE-ACM Trans. Comput. Biol. Bioinform. 2022, 19, 2712–2722. [Google Scholar] [CrossRef] [PubMed]
- Bielinska-Waz, D.; Waz, P. Spectral-dynamic representation of DNA sequences. J. Biomed. Inform. 2017, 72, 1–7. [Google Scholar] [CrossRef]
- Li, X.L.; Zhou, R.Q.; Xu, Y.F.; Wei, X.; He, Y. Spectral unmixing combined with Raman imaging, a preferable analytic technique for molecule visualization. Appl. Spectrosc. Rev. 2017, 52, 417–438. [Google Scholar] [CrossRef]
- Vracko, M.; Basak, S.C.; Dey, T.; Nandy, A. Cluster Analysis of Coronavirus Sequences using Computational Sequence Descriptors: With Applications to SARS, MERS and SARS-CoV-2 (COVID-19). Curr. Comput-Aided Drug Des. 2021, 17, 936–945. [Google Scholar] [CrossRef]
- Paul, T.; Vainio, S.; Roning, J. Detection of intra-family coronavirus genome sequences through graphical representation and artificial neural network. Expert Syst. Appl. 2022, 194, 116559. [Google Scholar] [CrossRef]
- Bielinska-Waz, D.; Waz, P. Non-standard bioinformatics characterization of SARS-CoV-2. Comput. Biol. Med. 2021, 131, 104247. [Google Scholar] [CrossRef]
- Bielinska-Waz, D.; Waz, P.; Nandy, A. Graphical Representations of Biological Sequences. Comb. Chem. High Throughput Screen. 2022, 25, 347–348. [Google Scholar] [CrossRef] [PubMed]
- Martin, H.; Sébastien, O.; Christos, B.; Tom, V. Deep homography estimation in dynamic surgical scenes for laparoscopic camera motion extraction. Comput. Methods Biomech. Biomed. Eng. Imaging Vis. 2022, 10, 321–329. [Google Scholar]
- Yu, J.F.; Dou, X.H.; Wang, H.B.; Sun, X.; Zhao, H.Y.; Wang, J.H. A Novel Cylindrical Representation for Characterizing Intrinsic, Properties of Protein Sequences. J. Chem. Inf. Model. 2015, 55, 1261–1270. [Google Scholar] [CrossRef] [PubMed]
- Lichtblau, D. Alignment-free genomic sequence comparison using FCGR and signal processing. BMC Bioinform. 2019, 20, 742. [Google Scholar] [CrossRef]
- Ni, H.M.; Qi, D.W.; Mu, H.B. Applying MSSIM combined chaos game representation to genome sequences analysis. Genomics 2018, 110, 180–190. [Google Scholar] [CrossRef]
- Haghighatlari, M.; Vishwakarma, G.; Altarawy, D.; Subramanian, R.; Kota, B.U.; Sonpal, A.; Setlur, S.; Hachmann, J. ChemML: A machine learning and informatics program package for the analysis, mining, and modeling of chemical and materials data. Wiley Interdiscip. Rev.-Comput. Mol. Sci. 2020, 10, e1458. [Google Scholar] [CrossRef]
- Kumar, M.R.; Vaegae, N.K. A new numerical approach for DNA representation using modified Gabor wavelet transform for the identification of protein coding regions. Biocybern. Biomed. Eng. 2020, 40, 836–848. [Google Scholar] [CrossRef]
- Dey, S.; Das, S.; Bhattacharya, D.K. Biochemical Property Based Positional Matrix: A New Approach Towards Genome Sequence Comparison. J. Mol. Evol. 2023, 91, 93–131. [Google Scholar] [CrossRef]
- Das, S.; Das, A.; Mondal, B.; Dey, N.; Bhattacharya, D.K.; Tibarewala, D.N. Genome sequence comparison under a new form of tri-nucleotide representation based on bio-chemical properties of nucleotides. Gene 2020, 730, 144257. [Google Scholar] [CrossRef] [PubMed]
- Munteanu, C.R.; Aguiar-Pulido, V.; Freire, A.; Martinez-Romero, M.; Porto-Pazos, A.B.; Pereira, J.; Dorado, J. Graph-Based Processing of Macromolecular Information. Curr. Bioinform. 2015, 10, 606–631. [Google Scholar] [CrossRef]
- Sun, Z.J.; Pei, S.J.; He, R.L.; Yau, S.S.T. A novel numerical representation for proteins: Three-dimensional Chaos Game Representation and its Extended Natural Vector. Comput. Struct. Biotechnol. J. 2020, 18, 1904–1913. [Google Scholar] [CrossRef]
- Xiao, N.; Cao, D.S.; Zhu, M.F.; Xu, Q.S. protr/ProtrWeb: R package and web server for generating various numerical representation schemes of protein sequences. Bioinformatics 2015, 31, 1857–1859. [Google Scholar] [CrossRef] [PubMed]
- Sun, N.; Zhao, X.; Yau, S.S.T. An efficient numerical representation of genome sequence: Natural vector with covariance component. Peerj 2022, 10, e13544. [Google Scholar] [CrossRef] [PubMed]
- Bai, F.; Wang, T. On graphical and numerical representation of protein sequences. J. Biomol. Struct. Dyn. 2006, 23, 537–546. [Google Scholar] [CrossRef]
- Randic, M.; Vracko, M.; Nandy, A.; Basak, S.C. On 3-D graphical representation of DNA primary sequences and their numerical characterization. J. Chem. Inf. Comput. Sci. 2000, 40, 1235–1244. [Google Scholar] [CrossRef] [PubMed]
- Ma, R.M.; Liu, Z.Y.; Zhang, Q.W.; Luo, T.F. Evaluating Polymer Representations via Quantifying Structure-Property Relationships. J. Chem. Inf. Model. 2019, 59, 3110–3119. [Google Scholar] [CrossRef] [PubMed]
- Shankar, A.; Jagota, A.; Mittal, J. DNA Base Dimers Are Stabilized by Hydrogen-Bonding Interactions Including Non-Watson-Crick Pairing Near Graphite Surfaces. J. Phys. Chem. B 2012, 116, 12088–12094. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Sears, R.L.; Xing, X.Y.; Zhang, B.; Li, D.F.; Rockweiler, N.B.; Jang, H.S.; Choudhary, M.N.K.; Lee, H.J.; Lowdon, R.F.; et al. Tissue-specific DNA methylation is conserved across human, mouse, and rat, and driven by primary sequence conservation. BMC Genom. 2017, 18, 724. [Google Scholar] [CrossRef]
- Xie, G.S.; Mo, Z.X. Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications. J. Theor. Biol. 2011, 269, 123–130. [Google Scholar] [CrossRef]
- Qui, Y.H.; Yu, H.; Gong, X.J.; Xu, J.H.; Lee, H.S. On the prediction of DNA-binding proteins only from primary sequences: A deep learning approach. PLoS ONE 2017, 12, e0188129. [Google Scholar] [CrossRef]
- Lee, B.D. Squiggle: A user-friendly two-dimensional DNA sequence visualization tool. Bioinformatics 2019, 35, 1425–1426. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Liu, D.Y.; Yang, W.; Yang, L.; Zuo, Y.C. RaacLogo: A new sequence logo generator by using reduced amino acid clusters. Brief. Bioinform. 2021, 22, bbaa096. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Hong, S.P.; Lee, S.; Lee, W.; Lee, D.; Kim, R.; Park, Y.J.; Moon, S.; Park, K.; Cha, B.; et al. Multidimensional fragmentomic profiling of cell-free DNA released from patient-derived organoids. Hum. Genom. 2023, 17, 96. [Google Scholar] [CrossRef]
- Zhang, Y.K.; Lang, M.; Jiang, J.H.; Gao, Z.Q.; Xu, F.; Litfin, T.; Chen, K.; Singh, J.; Huang, X.S.; Song, G.L.; et al. Multiple sequence alignment-based RNA language model and its application to structural inference. Nucleic Acids Res. 2024, 52, e3. [Google Scholar] [CrossRef] [PubMed]
- Pal, M.; Satish, B.; Srinivas, K.; Rao, P.M.; Manimaran, P. Multifractal detrended cross-correlation analysis of coding and non-coding DNA sequences through chaos-game representation. Phys. A-Stat. Mech. Its Appl. 2015, 436, 596–603. [Google Scholar] [CrossRef]
- Lu, Y.; Zhao, L.; Li, Z.; Dong, X.J. Genetic Similarity Analysis Based on Positive and Negative Sequence Patterns of DNA. Symmetry 2020, 12, 2090. [Google Scholar] [CrossRef]
- Chen, M.J.; Liu, X.Y.; Liu, Q.Y.; Shi, D.S.; Li, H. 3D genomics and its applications in precision medicine. Cell. Mol. Biol. Lett. 2023, 28, 19. [Google Scholar] [CrossRef]
- Bernaola-Galván, P.; Carpena, P.; Gómez-Martín, C.; Oliver, J.L. Compositional Structure of the Genome: A Review. Biology 2023, 12, 849. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.X.; Saito, R.; Matsukawa, N.; Hishinuma, E.; Saigusa, D.; Liu, H.; Yamamoto, M.; Uruno, A. Nrf2 deficiency deteriorates diabetic kidney disease in Akita model mice. Redox Biol. 2022, 58, 102525. [Google Scholar] [CrossRef] [PubMed]
- Schwessinger, R.; Gosden, M.; Downes, D.; Brown, R.C.; Oudelaar, A.M.; Telenius, J.; Teh, Y.W.; Lunter, G.; Hughes, J.R. DeepC: Predicting 3D genome folding using megabase-scale transfer learning. Nat. Methods 2020, 17, 1118–1124. [Google Scholar] [CrossRef]
- Mu, Z.C.; Tan, Y.L.; Liu, J.; Zhang, B.G.; Shi, Y.Z. Computational Modeling of DNA 3D Structures: From Dynamics and Mechanics to Folding. Molecules 2023, 28, 4833. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; Zhang, C.Y.; Wang, Y.Y.; Chen, G.F. Research progress of whole-cell-SELEX selection and the application of cell-targeting aptamer. Mol. Biol. Rep. 2022, 49, 7979–7993. [Google Scholar] [CrossRef] [PubMed]
- Tompkins, J.D. Transgenerational Epigenetic DNA Methylation Editing and Human Disease. Biomolecules 2023, 13, 1684. [Google Scholar] [CrossRef]
- Kim, K.D.; Lieberman, P.M. Viral remodeling of the 4D nucleome. Exp. Mol. Med. 2024, 56, 799–808. [Google Scholar] [CrossRef] [PubMed]
- Mokoatle, M.; Marivate, V.; Mapiye, D.; Bornman, R.; Hayes, V.M. A review and comparative study of cancer detection using machine learning: SBERT and SimCSE application. BMC Bioinform. 2023, 24, 112. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Venkatachalapathy, S.; Paysan, D.; Schaerer, P.; Tripodo, C.; Uhler, C.; Shivashankar, G.V. Unsupervised representation learning of chromatin images identifies changes in cell state and tissue organization in DCIS. Nat. Commun. 2024, 15, 6112. [Google Scholar] [CrossRef]
- Bohnsack, K.S.; Kaden, M.; Abel, J.; Villmann, T. Alignment-Free Sequence Comparison: A Systematic Survey From a Machine Learning Perspective. IEEE-ACM Trans. Comput. Biol. Bioinform. 2023, 20, 119–135. [Google Scholar] [CrossRef] [PubMed]
- Asim, M.N.; Ibrahim, M.A.; Fazeel, A.; Dengel, A.; Ahmed, S. DNA-MP: A generalized DNA modifications predictor for multiple species based on powerful sequence encoding method. Brief. Bioinform. 2023, 24, bbac546. [Google Scholar] [CrossRef]
- Freschlin, C.R.; Fahlberg, S.A.; Romero, P.A. Machine learning to navigate fitness landscapes for protein engineering. Curr. Opin. Biotechnol. 2022, 75, 102713. [Google Scholar] [CrossRef]
- Lee, B.D.; Timony, M.A.; Ruiz, P. DNAvisualization.org: A serverless web tool for DNA sequence visualization. Nucleic Acids Res. 2019, 47, W20–W25. [Google Scholar] [CrossRef] [PubMed]
- Fang, M.H.; Fang, J.W.; Luo, S.W.; Liu, K.; Yu, Q.N.; Yang, J.X.; Zhou, Y.Y.; Li, Z.K.; Sun, R.M.; Guo, C.; et al. eccDNA-pipe: An integrated pipeline for identification, analysis and visualization of extrachromosomal circular DNA from high-throughput sequencing data. Brief. Bioinform. 2024, 25, bbae034. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Zou, Y.R.; Li, X.H.; Wong, T.K.F.; Rodrigo, A.G. Mugen-UMAP: UMAP visualization and clustering of mutated genes in single-cell DNA sequencing data. BMC Bioinform. 2024, 25, 308. [Google Scholar] [CrossRef] [PubMed]
- Silva, J.M.; Qi, W.; Pinho, A.J.; Pratas, D. AlcoR: Alignment-free simulation, mapping, and visualization of low-complexity regions in biological data. GigaScience 2023, 12, giad101. [Google Scholar] [CrossRef]
- Józwik, I.K.; Li, W.; Zhang, D.W.; Wong, D.; Grawenhoff, J.; Ballandras-Colas, A.; Aiyer, S.; Cherepanov, P.; Engelman, A.N.; Lyumkis, D. B-to-A transition in target DNA during retroviral integration. Nucleic Acids Res. 2022, 50, 8898–8918. [Google Scholar] [CrossRef] [PubMed]
- Abdennur, N.; Fudenberg, G.; Flyamer, I.M.; Galitsyna, A.A.; Goloborodko, A.; Imakaev, M.; Venev, S.V.; Ma, J.; Ay, F. Pairtools: From sequencing data to chromosome contacts. PLoS Comput. Biol. 2024, 20, e1012164. [Google Scholar] [CrossRef]
- Filatov, D.A. ProSeq4: A user-friendly multiplatform program for preparation and analysis of large-scale DNA polymorphism datasets. Mol. Ecol. Resour. 2024, 24, 13962. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Gomez-Blanco, J.; Petassi, M.T.; Peters, J.E.; Ortega, J.; Guarné, A. Structural basis for DNA targeting by the Tn7 transposon. Nat. Struct. Mol. Biol. 2022, 29, 143–151. [Google Scholar] [CrossRef]
- Ruprecht, N.A.; Kennedy, J.D.; Bansal, B.; Singhal, S.; Sens, D.; Maggio, A.; Doe, V.; Hawkins, D.; Campbel, R.; O’Connell, K.; et al. Transcriptomics and epigenetic data integration learning module on Google Cloud. Brief. Bioinform. 2024, 25, bbae352. [Google Scholar] [CrossRef]
- Cochetel, N.; Minio, A.; Guarracino, A.; Garcia, J.F.; Figueroa-Balderas, R.; Massonnet, M.; Kasuga, T.; Londo, J.P.; Garrison, E.; Gaut, B.S.; et al. A super-pangenome of the North American wild grape species. Genome Biol. 2023, 24, 290. [Google Scholar] [CrossRef] [PubMed]
- Kanafi, M.M.; Tavallaei, M. Overview of advances in CRISPR/deadCas9 technology and its applications in human diseases. Gene 2022, 830, 146518. [Google Scholar] [CrossRef] [PubMed]
- Lake, N.J.; Zhou, L.; Xu, J.; Lek, M. MitoVisualize: A resource for analysis of variants in human mitochondrial RNAs and DNA. Bioinformatics 2022, 38, 2967–2969. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.Y.; Liu, L.Q.; Feng, Y.; Zhang, Z.Q.; Hou, R.; Xu, Q.; Shi, J.T. mHapBrowser: A comprehensive database for visualization and analysis of DNA methylation haplotypes. Nucleic Acids Res. 2024, 52, D929–D937. [Google Scholar] [CrossRef]
- Pessoa, J.; Carvalho, C. Human RNA Polymerase II Segregates from Genes and Nascent RNA and Transcribes in the Presence of DNA-Bound dCas9. Int. J. Mol. Sci. 2024, 25, 8411. [Google Scholar] [CrossRef] [PubMed]
- Martinez, J.; Ant, T.H.; Murdochy, S.M.; Tong, L.; Filipe, A.D.; Sinkins, S.P. Genome sequencing and comparative analysis of Wolbachia strain wAlbA reveals Wolbachia-associated plasmids are common. PLoS Genet. 2022, 18, e1010406. [Google Scholar] [CrossRef] [PubMed]
- Barshai, M.; Engel, B.; Haim, I.; Orenstein, Y. G4mismatch: Deep neural networks to predict G-quadruplex propensity based on G4-seq data. PLoS Comput. Biol. 2023, 19, e1010948. [Google Scholar] [CrossRef]
- Trajkovski, M.; Pastore, A.; Plavec, J. Dimeric structures of DNA ATTTC repeats promoted by divalent cations. Nucleic Acids Res. 2024, 52, 1591–1601. [Google Scholar] [CrossRef]
- Zhang, T.; Li, L.; Sun, H.; Xu, D.; Wang, G. DeepICSH: A complex deep learning framework for identifying cell-specific silencers and their strength from the human genome. Brief. Bioinform. 2023, 24, bbad316. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Wu, C.K.; Yang, Z.L.; Guo, Y.J.; Jiang, R. Knowledge graph-enabled adaptive work packaging approach in modular construction. Knowl.-Based Syst. 2023, 260, 110115. [Google Scholar] [CrossRef]
- Mohamed, S.K.; Nounu, A.; Novacek, V. Biological applications of knowledge graph embedding models. Brief. Bioinform. 2021, 22, 1679–1693. [Google Scholar] [CrossRef] [PubMed]
- Khan, N.; Ma, Z.M.; Ullah, A.; Polat, K. Categorization of knowledge graph based recommendation methods and benchmark datasets from the perspectives of application scenarios: A comprehensive survey. Expert Syst. Appl. 2022, 206, 117737. [Google Scholar] [CrossRef]
- Liu, Y.S.Y.; Gu, F.; Wu, Y.J.; Gu, X.J.; Guo, J.F. A metrics-based meta-learning model with meta-pretraining for industrial knowledge graph construction. Comput. Ind. 2022, 143, 103753. [Google Scholar] [CrossRef]
- Deng, J.F.; Chen, C.; Huang, X.Y.; Chen, W.Y.; Cheng, L.L. Research on the construction of event logic knowledge graph of supply chain management. Adv. Eng. Inform. 2023, 56, 101921. [Google Scholar] [CrossRef]
- Nicholson, D.N.; Greene, C.S. Constructing knowledge graphs and their biomedical applications. Comput. Struct. Biotechnol. J. 2020, 18, 1414–1428. [Google Scholar] [CrossRef]
- Fei, H.; Ren, Y.F.; Zhang, Y.; Ji, D.H.; Liang, X.H. Enriching contextualized language model from knowledge graph for biomedical information extraction. Brief. Bioinform. 2021, 22, bbaa110. [Google Scholar] [CrossRef]
- Lan, Y.Y.; He, S.Z.; Liu, K.; Zeng, X.R.; Liu, S.P.; Zhao, J. Path-based knowledge reasoning with textual semantic information for medical knowledge graph completion. BMC Med. Inf. Decis. Mak. 2021, 21, 335. [Google Scholar] [CrossRef]
- Bonner, S.; Barrett, I.P.; Ye, C.; Swiers, R.; Engkvist, O.; Bender, A.; Hoyt, C.T.; Hamilton, W.L. A review of biomedical datasets relating to drug discovery: A knowledge graph perspective. Brief. Bioinform. 2022, 23, bbac404. [Google Scholar] [CrossRef] [PubMed]
- Opdahl, A.L.; Al-Moslmi, T.; Dang-Nguyen, D.T.; Ocana, M.G.; Tessem, B.; Veres, C. Semantic Knowledge Graphs for the News: A Review. Acm. Comput. Surv. 2023, 55, 1–38. [Google Scholar] [CrossRef]
- Ali, M.; Hoyt, C.T.; Domingo-Fernandez, D.; Lehmann, J.; Jabeen, H. BioKEEN: A library for learning and evaluating biological knowledge graph embeddings. Bioinformatics 2019, 35, 3538–3540. [Google Scholar] [CrossRef]
- Cai, X.J.; Xie, L.J.; Tian, R.; Cui, Z.H. Explicable recommendation based on knowledge graph. Expert Syst. Appl. 2022, 200, 117035. [Google Scholar] [CrossRef]
- Su, X.R.; Hu, L.; You, Z.H.; Hu, P.W.; Zhao, B.W. Attention-based Knowledge Graph Representation Learning for Predicting Drug-drug Interactions. Brief. Bioinform. 2022, 23, bbac140. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.M.; Ross, K.E.; Gavali, S.; Cowart, J.E.; Wu, C.H. COVID-19 Knowledge Graph from semantic integration of biomedical literature and databases. Bioinformatics 2021, 37, 4597–4598. [Google Scholar] [CrossRef] [PubMed]
- Domingo-Fernandez, D.; Baksi, S.; Schultz, B.; Gadiya, Y.; Karki, R.; Raschka, T.; Ebeling, C.; Hofmann-Apitius, M.; Kodamullil, A.T. COVID-19 Knowledge Graph: A computable, multi-modal, cause-and-effect knowledge model of COVID-19 pathophysiology. Bioinformatics 2021, 37, 1332–1334. [Google Scholar] [CrossRef]
- Dogan, T.; Atas, H.; Joshi, V.; Atakan, A.; Rifaioglu, A.S.; Nalbat, E.; Nightingale, A.; Saidi, R.; Volynkin, V.; Zellner, H.; et al. CROssBAR: Comprehensive resource of biomedical relations with knowledge graph representations. Nucleic Acids Res. 2021, 49, gkab543. [Google Scholar] [CrossRef] [PubMed]
- Shao, B.L.; Li, X.J.; Bian, G.Q. A survey of research hotspots and frontier trends of recommendation systems from the perspective of knowledge graph. Expert Syst. Appl. 2021, 165, 113764. [Google Scholar] [CrossRef]
- Li, Z.R.; Zhong, Q.; Yang, J.; Duan, Y.J.; Wang, W.J.; Wu, C.K.; He, K.L. DeepKG: An end-to-end deep learning-based workflow for biomedical knowledge graph extraction, optimization and applications. Bioinformatics 2022, 38, 1477–1479. [Google Scholar] [CrossRef]
- Hu, J.J.; Lepore, R.; Dobson, R.J.B.; Al-Chalabi, A.; Bean, D.M.; Iacoangeli, A. DGLinker: Flexible knowledge-graph prediction of disease-gene associations. Nucleic Acids Res. 2021, 49, W153–W161. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.J.; Jia, S.B.; Xiang, Y. A review: Knowledge reasoning over knowledge graph. Expert Syst. Appl. 2020, 141, 112948. [Google Scholar] [CrossRef]
- Morris, J.H.; Soman, K.; Akbas, R.E.; Zhou, X.Y.; Smith, B.; Meng, E.C.; Huang, C.C.; Cerono, G.; Schenk, G.; Rizk-Jackson, A.; et al. The scalable precision medicine open knowledge engine (SPOKE): A massive knowledge graph of biomedical information. Bioinformatics 2023, 39, btad080. [Google Scholar] [CrossRef]
- Waagmeester, A.; Stupp, G.; Burgstaller-Muehlbacher, S.; Good, B.M.; Griffith, M.; Griffith, O.L.; Hanspers, K.; Hermjakob, H.N.; Hudson, T.S.; Hybiske, K.; et al. SCIENCE FORUM Wikidata as a knowledge graph for the life sciences. eLife 2020, 9, e52614. [Google Scholar] [CrossRef] [PubMed]
- Al-Aswadi, F.N.; Chan, H.Y.; Gan, K.H. Automatic ontology construction from text: A review from shallow to deep learning trend. Artif. Intell. Rev. 2020, 53, 3901–3928. [Google Scholar] [CrossRef]
- Geng, Q.; Deng, S.Y.; Jia, D.P.; Jin, J. Cross-domain ontology construction and alignment from online customer product reviews. Inf. Sci. 2020, 531, 47–67. [Google Scholar] [CrossRef]
- Fionda, V.; Gutierrez, C.; Pirro, G. Building knowledge maps of Web graphs. Artif. Intell. 2016, 239, 143–167. [Google Scholar] [CrossRef]
- Chen, Y.; Mensah, S.; Ma, F.; Wang, H.; Jiang, Z.A. Collaborative filtering grounded on knowledge graphs. Pattern Recognit. Lett. 2021, 151, 55–61. [Google Scholar] [CrossRef]
- Liang, S.; Shao, J.; Zhang, D.Y.; Zhang, J.S.; Cui, B. DRGI: Deep Relational Graph Infomax for Knowledge Graph Completion. IEEE Trans. Knowl. Data Eng. 2023, 35, 2486–2499. [Google Scholar] [CrossRef]
- Song, X.Y.; Li, J.X.; Tang, Y.F.; Zhao, T.G.; Chen, Y.L.; Guan, Z.Y. JKT: A joint graph convolutional network based Deep Knowledge Tracing. Inf. Sci. 2021, 580, 510–523. [Google Scholar] [CrossRef]
- Wang, S.K.; Xu, F.; Li, Y.Y.; Wang, J.; Zhang, K.; Liu, Y.; Wu, M.; Zheng, J. KG4SL: Knowledge graph neural network for synthetic lethality prediction in human cancers. Bioinformatics 2021, 37, I418–I425. [Google Scholar] [CrossRef]
- Guan, N.N.; Song, D.D.; Liao, L.J. Knowledge graph embedding with concepts. Knowl.-Based Syst. 2019, 164, 38–44. [Google Scholar] [CrossRef]
- Wang, Q.; Mao, Z.D.; Wang, B.; Guo, L. Knowledge Graph Embedding: A Survey of Approaches and Applications. IEEE Trans. Knowl. Data Eng. 2017, 29, 2724–2743. [Google Scholar] [CrossRef]
- Li, Z.F.; Liu, H.; Zhang, Z.L.; Liu, T.T.; Xiong, N.N. Learning Knowledge Graph Embedding With Heterogeneous Relation Attention Networks. IEEE Trans. Neural Netw. Learn. Syst. 2022, 33, 3961–3973. [Google Scholar] [CrossRef] [PubMed]
- Ott, S.; Barbosa-Silva, A.; Samwald, M. LinkExplorer: Predicting, explaining and exploring links in large biomedical knowledge graphs. Bioinformatics 2022, 38, 2371–2373. [Google Scholar] [CrossRef]
- Zhu, C.Y.; Yang, Z.H.; Xia, X.Q.; Li, N.; Zhong, F.; Liu, L. Multimodal reasoning based on knowledge graph embedding for specific diseases. Bioinformatics 2022, 38, 2235–2245. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.F.; Zhao, Y.; Zhang, Y.; Zhang, Z.L. Multi-relational graph attention networks for knowledge graph completion. Knowl.-Based Syst. 2022, 251, 109262. [Google Scholar] [CrossRef]
- Alshahrani, M.; Khan, M.A.; Maddouri, O.; Kinjo, A.R.; Queralt-Rosinach, N.; Hoehndorf, R. Neuro-symbolic representation learning on biological knowledge graphs. Bioinformatics 2017, 33, 2723–2730. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.Q.; Su, J.; Zhang, W. scGCN is a graph convolutional networks algorithm for knowledge transfer in single cell omics. Nat. Commun. 2021, 12, 3826. [Google Scholar] [CrossRef]
- Balabin, H.; Hoyt, C.T.; Birkenbihl, C.; Gyori, B.M.; Bachman, J.; Kodamullil, A.T.; Ploger, P.G.; Hofmann-Apitius, M.; Domingo-Fernandez, D. STonKGs: A sophisticated transformer trained on biomedical text and knowledge graphs. Bioinformatics 2022, 38, 1648–1656. [Google Scholar] [CrossRef] [PubMed]
- Smirnov, A.; Levashova, T. Knowledge fusion patterns: A survey. Inf. Fusion 2019, 52, 31–40. [Google Scholar] [CrossRef]
- Mao, W.T.; Liu, J.; Chen, J.X.; Liang, X.H. An Interpretable Deep Transfer Learning-Based Remaining Useful Life Prediction Approach for Bearings With Selective Degradation Knowledge Fusion. IEEE Trans. Instrum. Meas. 2022, 71, 3159010. [Google Scholar] [CrossRef]
- Yang, J.; Yang, L.T.; Wang, H.; Gao, Y.; Zhao, Y.L.; Xie, X.; Lu, Y. Representation learning for knowledge fusion and reasoning in Cyber-Physical-Social Systems: Survey and perspectives. Inf. Fusion 2023, 90, 59–73. [Google Scholar] [CrossRef]
- Yu, Y.; Huang, K.X.; Zhang, C.; Glass, L.M.; Sun, J.M.; Xiao, C. SumGNN: Multi-typed drug interaction prediction via efficient knowledge graph summarization. Bioinformatics 2021, 37, 2988–2995. [Google Scholar] [CrossRef]
- Sun, Y.; Li, Y.S.; Yang, Y.Y.; Yue, H.D. Differential evolution algorithm with population knowledge fusion strategy for image registration. Complex Intell. Syst. 2022, 8, 835–850. [Google Scholar] [CrossRef]
- Yang, L.Y.; Wang, X.; Dai, Y.X.; Xin, K.J.; Zheng, X.L.; Ding, W.P.; Zhang, J.; Wang, F.Y. HackRL: Reinforcement learning with hierarchical attention for cross-graph knowledge fusion and collaborative reasoning. Knowl.-Based Syst. 2021, 233, 107498. [Google Scholar] [CrossRef]
- Ji, S.X.; Pan, S.R.; Cambria, E.; Marttinen, P.; Yu, P.S. A Survey on Knowledge Graphs: Representation, Acquisition, and Applications. IEEE Trans. Neural Netw. Learn. Syst. 2022, 33, 494–514. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Wang, W.J.; Zhou, X.Y.; Zhao, J.; Wang, Y.; Xiao, S.Y.; Xu, M.Y. Artificial bee colony algorithm based on knowledge fusion. Complex Intell. Syst. 2021, 7, 1139–1152. [Google Scholar] [CrossRef]
- Huang, M.S.; Lai, P.T.; Lin, P.Y.; You, Y.T.; Tsai, R.T.H.; Hsu, W.L. Biomedical named entity recognition and linking datasets: Survey and our recent development. Brief. Bioinform. 2020, 21, 2219–2238. [Google Scholar] [CrossRef]
- Mi, B.G.; Fan, Y. A review: Development of named entity recognition (NER) technology for aeronautical information intelligence. Artif. Intell. Rev. 2023, 56, 1515–1542. [Google Scholar] [CrossRef]
- Mao, Y.R.; Hao, Y.; Liu, W.W.; Lin, X.M.; Cao, X. Class-Imbalanced-Aware Distantly Supervised Named Entity Recognition. IEEE Trans. Neural Netw. Learn. Syst. 2023, 35, 12117–12129. [Google Scholar] [CrossRef] [PubMed]
- Song, B.S.; Li, F.; Liu, Y.S.; Zeng, X.X. Deep learning methods for biomedical named entity recognition: A survey and qualitative comparison. Brief. Bioinform. 2021, 22, bbab282. [Google Scholar] [CrossRef]
- Perera, N.; Dehmer, M.; Emmert-Streib, F. Named Entity Recognition and Relation Detection for Biomedical Information Extraction. Front. Cell Dev. Biol. 2020, 8, 673. [Google Scholar] [CrossRef]
- Geng, R.S.; Chen, Y.P.; Huang, R.Z.; Qin, Y.B.; Zheng, Q.H. Planarized sentence representation for nested named entity recognition. Inf. Process. Manag. 2023, 60, 103352. [Google Scholar] [CrossRef]
- Ye, Q.; Hsieh, C.Y.; Yang, Z.Y.; Kang, Y.; Chen, J.M.; Cao, D.S.; He, S.B.; Hou, T.J. A unified drug-target interaction prediction framework based on knowledge graph and recommendation system. Nat. Commun. 2021, 12, 6775. [Google Scholar] [CrossRef] [PubMed]
- Charlier, J.; Nadon, R.; Makarenkov, V. Accurate deep learning off-target prediction with novel sgRNA-DNA sequence encoding in CRISPR-Cas9 gene editing. Bioinformatics 2021, 37, 2299–2307. [Google Scholar] [CrossRef] [PubMed]
- Muntoni, A.P.; Pagnani, A.; Weigt, M.; Zamponi, F. adabmDCA: Adaptive Boltzmann machine learning for biological sequences. BMC Bioinform. 2021, 22, 528. [Google Scholar] [CrossRef]
- Danilevsky, A.; Polsky, A.L.; Shomron, N. Adaptive sequencing using nanopores and deep learning of mitochondrial DNA. Brief. Bioinform. 2022, 23, bbac251. [Google Scholar] [CrossRef] [PubMed]
- Kurian, N.C.; Sethi, A.; Konduru, A.R.; Mahajan, A.; Rane, S.U. A 2021 update on cancer image analytics with deep learning. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2021, 11, e1410. [Google Scholar] [CrossRef]
- Jing, R.Y.; Li, Y.Z.; Xue, L.; Liu, F.J.; Li, M.L.; Luo, J.S. autoBioSeqpy: A Deep Learning Tool for the Classification of Biological Sequences. J. Chem. Inf. Model. 2020, 60, 3755–3764. [Google Scholar] [CrossRef]
- Liu, B.; Gao, X.; Zhang, H.Y. BioSeq-Analysis2.0: An updated platform for analyzing DNA, RNA and protein sequences at sequence level and residue level based on machine learning approaches. Nucleic Acids Res. 2019, 47, e127. [Google Scholar] [CrossRef] [PubMed]
- Liu, B. BioSeq-Analysis: A platform for DNA, RNA and protein sequence analysis based on machine learning approaches. Brief. Bioinform. 2019, 20, 1280–1294. [Google Scholar] [CrossRef]
- Cao, F.; Zhang, Y.; Cai, Y.C.; Animesh, S.; Akincilar, S.C.; Loh, Y.P.; Li, X.Y.; Chng, W.J.; Tergaonkar, V.; Kwoh, C.K.; et al. Chromatin interaction neural network (ChINN): A machine learning-based method for predicting chromatin interactions from DNA sequences. Genome Biol. 2021, 22, 226. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.X.; Yordanov, B.; Gaunt, A.; Wang, M.X.; Dai, P.; Chen, Y.J.; Zhang, K.; Fang, J.Z.; Dalchau, N.; Li, J.M.; et al. A deep learning model for predicting next-generation sequencing depth from DNA sequence. Nat. Commun. 2021, 12, 4387. [Google Scholar] [CrossRef]
- Manco, G.; Ritacco, E.; Rullo, A.; Sacca, D.; Serra, E. Machine learning methods for generating high dimensional discrete datasets. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2022, 12, e1450. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, T.; Lei, Y.; Roper, J.; Bradley, J.; Liu, T.; Yang, X. Synthetic Contrast MR Image Generation Using Deep Learning. Med. Phys. 2021, 48, TI9WO. [Google Scholar]
- Yu, C.; Li, K.; Zhang, Y.X.; Xiao, J.; Cui, C.Z.; Tao, Y.H.; Tang, S.J.; Sun, C.; Bi, C.K. A survey on machine learning based light curve analysis for variable astronomical sources. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2021, 11, e1425. [Google Scholar] [CrossRef]
- Gao, M.Q.; Zheng, F.; Yu, J.J.Q.; Shan, C.F.; Ding, G.G.; Han, J.G. Deep learning for video object segmentation: A review. Artif. Intell. Rev. 2023, 56, 457–531. [Google Scholar] [CrossRef]
- Schaefferkoetter, J.; Yan, J.H.; Moon, S.; Chan, R.; Ortega, C.; Metser, U.; Berlin, A.; Veit-Haibach, P. Deep learning for whole-body medical image generation. Eur. J. Nucl. Med. Mol. Imaging 2021, 48, 3817–3826. [Google Scholar] [CrossRef] [PubMed]
- Kauffman, C.; Karypis, G. Computational tools for protein-DNA interactions. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2012, 2, 14–28. [Google Scholar] [CrossRef]
- Huang, H.M.; Lin, C. A kernel-based image denoising method for improving parametric image generation. Med. Image Anal. 2019, 55, 41–48. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, F.M.; Moraes, M.C.; Furuie, S.S. Realistic ivus image generation in different intraluminal pressures. Ultrasound Med. Biol. 2012, 38, 2104–2119. [Google Scholar] [CrossRef] [PubMed]
- Li, W.Y.; Li, J.Y.; Polson, J.; Wang, Z.C.; Speier, W.; Arnold, C. High resolution histopathology image generation and segmentation through adversarial training. Med. Image Anal. 2022, 75, 102251. [Google Scholar] [CrossRef] [PubMed]
- Deserno, T.M.; Handels, H.; Meinzer, H.P.; Tolxdorff, T. Recent Advances in 3D Medical Image Generation and Analysis. Curr. Med. Imaging Rev. 2013, 9, 77–78. [Google Scholar]
- Zeleznikow, J. The benefits and dangers of using machine learning to support making legal predictions. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2023, 13, e1505. [Google Scholar] [CrossRef]
- Askr, H.; Elgeldawi, E.; Ella, H.A.; Elshaier, Y.; Gomaa, M.M.; Hassanien, A.E. Deep learning in drug discovery: An integrative review and future challenges. Artif. Intell. Rev. 2022, 56, 5975–6037. [Google Scholar] [CrossRef]
- Wang, R.H.; Jiang, Y.; Jin, J.R.; Yin, C.L.; Yu, H.Q.; Wang, F.S.; Feng, J.X.; Su, R.; Nakai, K.; Zou, Q.; et al. DeepBIO: An automated and interpretable deep-learning platform for high-throughput biological sequence prediction, functional annotation and visualization analysis. Nucleic Acids Res. 2023, 51, 3017–3029. [Google Scholar] [CrossRef]
- Bonet, J.; Chen, M.D.; Dabad, M.; Heath, S.; Gonzalez-Perez, A.; Lopez-Bigas, N.; Lagergren, J. DeepMP: A deep learning tool to detect DNA base modifications on Nanopore sequencing data. Bioinformatics 2022, 38, 1235–1243. [Google Scholar] [CrossRef] [PubMed]
- Li, J.Q.; Wei, L.; Zhang, X.L.; Zhang, W.; Wang, H.C.; Zhong, B.X.; Xie, Z.; Lv, H.R.; Wang, X.W. DISMIR: Deep learning-based noninvasive cancer detection by integrating DNA sequence and methylation information of individual cell-free DNA reads. Brief. Bioinform. 2021, 22, bbab250. [Google Scholar] [CrossRef]
- Kim, P.; Tan, H.; Liu, J.J.; Yang, M.Y.; Zhou, X.B. FusionAI: Predicting fusion breakpoint from DNA sequence with deep learning. Iscience 2021, 24, 103164. [Google Scholar] [CrossRef] [PubMed]
- Phan, N.N.; Chattopadhyay, A.; Lee, T.T.; Yin, H.I.; Lu, T.P.; Lai, L.C.; Hwa, H.L.; Tsai, M.H.; Chuang, E.Y. High-performance deep learning pipeline predicts individuals in mixtures of DNA using sequencing data. Brief. Bioinform. 2021, 22, bbab283. [Google Scholar] [CrossRef]
- Li, Y.; Quan, L.J.; Zhou, Y.T.; Jiang, Y.L.; Li, K.L.; Wu, T.F.; Lyu, Q. Identifying modifications on DNA-bound histones with joint deep learning of multiple binding sites in DNA sequence. Bioinformatics 2022, 38, 4070–4077. [Google Scholar] [CrossRef]
- Chen, Z.; Zhao, P.; Li, F.Y.; Marquez-Lago, T.T.; Leier, A.; Revote, J.; Zhu, Y.; Powell, D.R.; Akutsu, T.; Webb, G.I.; et al. iLearn: An integrated platform and meta-learner for feature engineering, machine-learning analysis and modeling of DNA, RNA and protein sequence data. Brief. Bioinform. 2020, 21, 1047–1057. [Google Scholar] [CrossRef] [PubMed]
- Hollerer, S.; Papaxanthos, L.; Gumpinger, A.C.; Fischer, K.; Beisel, C.; Borgwardt, K.; Benenson, Y.; Jeschek, M. Large-scale DNA-based phenotypic recording and deep learning enable highly accurate sequence-function mapping. Nat. Commun. 2020, 11, 3551. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.R.; Alangari, M.; Hihath, J.; Das, A.K.; Anantram, M.P. A machine learning approach for accurate and real-time DNA sequence identification. BMC Genom. 2021, 22, 525. [Google Scholar] [CrossRef]
- Piecyk, R.S.; Schlegel, L.; Johannes, F. Predicting 3D chromatin interactions from DNA sequence using Deep Learning. Comput. Struct. Biotechnol. J. 2022, 20, 3439–3448. [Google Scholar] [CrossRef]
- Hasan, Z.; Roy, N. Trending machine learning models in cyber-physical building environment: A survey. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2021, 11, e1422. [Google Scholar] [CrossRef]
- Emmert-Streib, F.; Dehmer, M. Taxonomy of machine learning paradigms: A data-centric perspective. Wiley Interdiscip. Rev.-Data Min. Knowl. Discov. 2022, 12, e1470. [Google Scholar] [CrossRef]
- Rehman, A.; Khan, A.; Fatima, G.; Naz, S.; Razzak, I. Review on chest pathogies detection systems using deep learning techniques. Artif. Intell. Rev. 2023, 56, 12607–12653. [Google Scholar] [CrossRef] [PubMed]
Single Nucleotide | Base Combinations | Triplet Bases | 4D Coordinates | ||||
---|---|---|---|---|---|---|---|
A | 3 | AT | 2 | ATG | −2 | 1 | (3,2,−2,1) |
T | 2 | TG | 7 | TGG | 1 | 1 | (2,7,1,1) |
G | 1 | GG | 11 | GGT | 0 | 1 | (1,11,0,1) |
G | 1 | GT | 10 | GTG | −2 | 2 | (1,10,−2,2) |
T | 2 | TG | 7 | TGC | 0 | 2 | (2,7,0,2) |
G | 1 | GC | 12 | GCA | −2 | 3 | (1,12,2,3) |
C | 0 | CA | 13 | CAC (ACA + ACG + ACU + ACC) | 2 | 1 | (0,13,2,1) |
A | 3 | AC (CA + CU + CC + CG) | 4 | ACC | 1 | 2 | (3,4,1,2) |
C | 0 | CC | 16 | CC_ | 0 | 2 | (0,16,0,2) |
C | 0 | C_ | 14.5 | C__ | 0 | 3 | (0,14.5,0,3) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Xie, X.; Zhu, J.; Guan, L.; Li, M. Overview and Prospects of DNA Sequence Visualization. Int. J. Mol. Sci. 2025, 26, 477. https://doi.org/10.3390/ijms26020477
Wu Y, Xie X, Zhu J, Guan L, Li M. Overview and Prospects of DNA Sequence Visualization. International Journal of Molecular Sciences. 2025; 26(2):477. https://doi.org/10.3390/ijms26020477
Chicago/Turabian StyleWu, Yan, Xiaojun Xie, Jihong Zhu, Lixin Guan, and Mengshan Li. 2025. "Overview and Prospects of DNA Sequence Visualization" International Journal of Molecular Sciences 26, no. 2: 477. https://doi.org/10.3390/ijms26020477
APA StyleWu, Y., Xie, X., Zhu, J., Guan, L., & Li, M. (2025). Overview and Prospects of DNA Sequence Visualization. International Journal of Molecular Sciences, 26(2), 477. https://doi.org/10.3390/ijms26020477