D-Tryptophan Promotes Skin Wound Healing via Extracellular Matrix Remodeling in Normal and Diabetic Models
Abstract
1. Introduction
2. Results
2.1. D-Trp Promotes the Migration of HaCaT Cells
2.2. D-Trp Accelerates Wound Healing in a Non-Diabetic Model
2.3. D-Trp Modulates Key Protein Expression Involved in Non-Wound Healing
2.4. D-Trp Accelerates Wound Healing Diabetic Model
2.5. D-Trp Modulates Key Protein Expression Involved in Diabetic Wound Healing
2.6. D-Tryptophan Boosts Gene Expression to Promote Diabetic Wound Healing
3. Discussion
Limitation of This Study
4. Materials and Methods
4.1. In Vitro Wound Healing Assay
4.2. Hemolysis Analysis
4.3. Cytotoxicity Analysis
4.4. Binding Affinity
4.5. Molecular Docking
4.6. Ethical Considerations
4.7. Animal Subjects
4.8. Induction of Diabetes
4.9. Treatment Groups and Administrations
4.10. Wound Healing Assessment
4.11. Sample Collection for Histology, Western Blot, and RNA Analysis
4.12. Histological Analysis
4.13. Western Blot
4.14. RNA Extraction and Quantitative Real-Time PCR Analysis
4.15. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| DFUs | diabetic foot ulcers |
| PBS | phosphate-buffered Saline |
| VEGF | vascular endothelial growth factor |
| SMAD2 | mothers against decapentaplegic homolog 2 |
| MMP | matrix metalloproteinases |
| ECM | extracellular matrix |
| MAPK | mitogen-activated protein kinase |
| HIF-1α | hypoxia-inducible factor 1-alpha |
| RT-PCR | reverse transcription-polymerase chain reaction |
| GAPDH | glyceraldehyde 3-phosphate dehydrogenase |
| TNF-α | tumor necrosis factor-alpha |
| IL-1β | interleukin-1 beta |
| IL-6 | interleukin-6 |
| MCP-1 | monocyte chemoattractant protein-1 |
| TGF-β | transforming growth factor-beta |
| PDGF | platelet-derived growth factor |
| FGF 2 | fibroblast growth factor |
References
- Sorg, H.; Tilkorn, D.J.; Hager, S.; Hauser, J.; Mirastschijski, U. Skin Wound Healing: An Update on the Current Knowledge and Concepts. Eur. Surg. Res. 2017, 58, 81–94. [Google Scholar] [CrossRef]
- Fallah, N.; Rasouli, M.; Amini, M.R. The current and advanced therapeutic modalities for wound healing management. J. Diabetes Metab. Disord. 2021, 20, 1883–1899. [Google Scholar] [CrossRef] [PubMed]
- Landen, N.X.; Li, D.; Stahle, M. Transition from inflammation to proliferation: A critical step during wound healing. Cell Mol. Life Sci. 2016, 73, 3861–3885. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, S.; Yang, Y.; Zhao, S.; You, J.; Wang, J.; Cai, J.; Wang, H.; Wang, J.; Zhang, W.; et al. Scarless wound healing programmed by core-shell microneedles. Nat. Commun. 2023, 14, 3431. [Google Scholar] [CrossRef] [PubMed]
- Dangwal, S.; Stratmann, B.; Bang, C.; Lorenzen, J.M.; Kumarswamy, R.; Fiedler, J.; Falk, C.S.; Scholz, C.J.; Thum, T.; Tschoepe, D. Impairment of Wound Healing in Patients with Type 2 Diabetes Mellitus Influences Circulating MicroRNA Patterns via Inflammatory Cytokines. Arter. Thromb. Vasc. Biol. 2015, 35, 1480–1488. [Google Scholar] [CrossRef]
- Spampinato, S.F.; Caruso, G.I.; De Pasquale, R.; Sortino, M.A.; Merlo, S. The Treatment of Impaired Wound Healing in Diabetes: Looking Among Old Drugs. Pharmaceuticals 2020, 13, 60. [Google Scholar] [CrossRef]
- Cai, Y.; Chen, K.; Liu, C.; Qu, X. Harnessing strategies for enhancing diabetic wound healing from the perspective of spatial inflammation patterns. Bioact. Mater. 2023, 28, 243–254. [Google Scholar] [CrossRef]
- Dasari, N.; Jiang, A.; Skochdopole, A.; Chung, J.; Reece, E.M.; Vorstenbosch, J.; Winocour, S. Updates in Diabetic Wound Healing, Inflammation, and Scarring. Semin. Plast. Surg. 2021, 35, 153–158. [Google Scholar] [CrossRef]
- Avishai, E.; Yeghiazaryan, K.; Golubnitschaja, O. Impaired wound healing: Facts and hypotheses for multi-professional considerations in predictive, preventive and personalised medicine. EPMA J. 2017, 8, 23–33. [Google Scholar] [CrossRef]
- Patel, S.; Srivastava, S.; Singh, M.R.; Singh, D. Mechanistic insight into diabetic wounds: Pathogenesis, molecular targets and treatment strategies to pace wound healing. Biomed. Pharmacother. 2019, 112, 108615. [Google Scholar] [CrossRef]
- Samarawickrama, P.N.; Zhang, G.; Zhu, E.; Dong, X.; Nisar, A.; Zhu, H.; Ma, Y.; Zhou, Z.; Yang, H.; Gui, L.; et al. Clearance of senescent cells enhances skin wound healing in type 2 diabetic mice. Theranostics 2024, 14, 5429–5442. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Mao, D.; Fu, Y.; Ju, R.; Wei, G. A self-assembled and H2O2-activatable hybrid nanoprodrug for lung infection and wound healing therapy. Theranostics 2025, 15, 5953–5968. [Google Scholar] [CrossRef] [PubMed]
- Ridiandries, A.; Tan, J.T.M.; Bursill, C.A. The Role of Chemokines in Wound Healing. Int. J. Mol. Sci. 2018, 19, 3217. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Zheng, J.; Li, J.; Liu, B.; Chen, K.; Xu, Y.; Deng, L.; Liu, H.; Liu, Y.N. NIR light-driven nanomotor with cascade photodynamic therapy for MRSA biofilm eradication and diabetic wound healing. Theranostics 2025, 15, 3474–3489. [Google Scholar] [CrossRef]
- Farabi, B.; Roster, K.; Hirani, R.; Tepper, K.; Atak, M.F.; Safai, B. The Efficacy of Stem Cells in Wound Healing: A Systematic Review. Int. J. Mol. Sci. 2024, 25, 3006. [Google Scholar] [CrossRef]
- Freedman, B.R.; Hwang, C.; Talbot, S.; Hibler, B.; Matoori, S.; Mooney, D.J. Breakthrough treatments for accelerated wound healing. Sci. Adv. 2023, 9, eade7007. [Google Scholar] [CrossRef]
- Challapalli, R.S.; Dwyer, R.M.; McInerney, N.; Kerin, M.J.; Lowery, A.J. Effect of Breast Cancer and Adjuvant Therapy on Adipose-Derived Stromal Cells: Implications for the Role of ADSCs in Regenerative Strategies for Breast Reconstruction. Stem Cell Rev. Rep. 2021, 17, 523–538. [Google Scholar] [CrossRef]
- Vogel, F.; Luth, A.; Charpentier, A. The impact of microbiological diagnostics on the antimicrobial treatment of hospitalised patients with infectious disease. Eur. J. Med. Res. 1996, 1, 312–314. [Google Scholar]
- Kolimi, P.; Narala, S.; Nyavanandi, D.; Youssef, A.A.A.; Dudhipala, N. Innovative Treatment Strategies to Accelerate Wound Healing: Trajectory and Recent Advancements. Cells 2022, 11, 2439. [Google Scholar] [CrossRef]
- Nourian Dehkordi, A.; Mirahmadi Babaheydari, F.; Chehelgerdi, M.; Raeisi Dehkordi, S. Skin tissue engineering: Wound healing based on stem-cell-based therapeutic strategies. Stem Cell Res. Ther. 2019, 10, 111. [Google Scholar] [CrossRef]
- Wang, C.; Shirzaei Sani, E.; Shih, C.D.; Lim, C.T.; Wang, J.; Armstrong, D.G.; Gao, W. Wound management materials and technologies from bench to bedside and beyond. Nat. Rev. Mater. 2024, 9, 550–566. [Google Scholar] [CrossRef]
- Liu, C.; Cheng, C.; Cheng, K.; Gao, A.S.; Li, Q.; Atala, A.; Zhang, Y. Precision exosome engineering for enhanced wound healing and scar revision. J. Transl. Med. 2025, 23, 578. [Google Scholar] [CrossRef]
- Fani, N.; Moradi, M.; Zavari, R.; Parvizpour, F.; Soltani, A.; Arabpour, Z.; Jafarian, A. Current Advances in Wound Healing and Regenerative Medicine. Curr. Stem Cell Res. Ther. 2024, 19, 277–291. [Google Scholar] [CrossRef]
- Sharma, Y.; Ghatak, S.; Sen, C.K.; Mohanty, S. Emerging technologies in regenerative medicine: The future of wound care and therapy. J. Mol. Med. 2024, 102, 1425–1450. [Google Scholar] [CrossRef]
- Zheng, R.; Geng, T.; Wu, D.Y.; Zhang, T.; He, H.N.; Du, H.N.; Zhang, D.; Miao, Y.L.; Jiang, W. Derivation of feeder-free human extended pluripotent stem cells. Stem Cell Rep. 2021, 16, 1686–1696. [Google Scholar] [CrossRef] [PubMed]
- Pollegioni, L.; Kustrimovic, N.; Piubelli, L.; Rosini, E.; Rabattoni, V.; Sacchi, S. d-amino acids: New functional insights. FEBS J. 2025. Epub ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Seki, N.; Kimizuka, T.; Gondo, M.; Yamaguchi, G.; Sugiura, Y.; Akiyama, M.; Yakabe, K.; Uchiyama, J.; Higashi, S.; Haneda, T.; et al. (D)-Tryptophan suppresses enteric pathogen and pathobionts and prevents colitis by modulating microbial tryptophan metabolism. iScience 2022, 25, 104838. [Google Scholar] [CrossRef]
- Moghimani, M.; Noori, S.M.A.; Afshari, A.; Hashemi, M. D-tryptophan, an eco-friendly natural, safe, and healthy compound with antimicrobial activity against food-borne pathogens: A systematic review. Food Sci. Nutr. 2024, 12, 3068–3079. [Google Scholar] [CrossRef]
- Elafify, M.; Darwish, W.S.; Al-Ashmawy, M.; Elsherbini, M.; Koseki, S.; Kawamura, S.; Abdelkhalek, A. Prevalence of Salmonella spp. in Egyptian dairy products: Molecular, antimicrobial profiles and a reduction trial using d-tryptophan. J. Consum. Prot. Food Saf. 2019, 14, 399–407. [Google Scholar] [CrossRef]
- Elafify, M.; Sadoma, N.M.; Abd El Aal, S.F.A.; Bayoumi, M.A.; Ahmed Ismail, T. Occurrence and D-Tryptophan Application for Controlling the Growth of Multidrug-Resistant Non-O157 Shiga Toxin-Producing Escherichia coli in Dairy Products. Animals 2022, 12, 922. [Google Scholar] [CrossRef]
- Gumede, D.B.; Abrahamse, H.; Houreld, N.N. Targeting Wnt/β-catenin signaling and its interplay with TGF-β and Notch signaling pathways for the treatment of chronic wounds. Cell Commun. Signal. 2024, 22, 244. [Google Scholar] [CrossRef]
- Glady, A.; Vandebroek, A.; Yasui, M. Human keratinocyte-derived extracellular vesicles activate the MAPKinase pathway and promote cell migration and proliferation in vitro. Inflamm. Regen. 2021, 41, 4. [Google Scholar] [CrossRef]
- Peña, O.A.; Martin, P. Cellular and molecular mechanisms of skin wound healing. Nat. Rev. Mol. Cell Biol. 2024, 25, 599–616. [Google Scholar] [CrossRef]
- Wilkinson, H.N.; Hardman, M.J. Wound healing: Cellular mechanisms and pathological outcomes. Open Biol. 2020, 10, 200223. [Google Scholar] [CrossRef]
- Sorgdrager, F.J.H.; Naude, P.J.W.; Kema, I.P.; Nollen, E.A.; Deyn, P.P. Tryptophan Metabolism in Inflammaging: From Biomarker to Therapeutic Target. Front. Immunol. 2019, 10, 2565. [Google Scholar] [CrossRef]
- Duran-Padilla, M.; Serrano-Loyola, R.; Perez-Garcia, A.; Carrillo-Betancourt, R.; Campos-García Rojas, C.; Reyes-Alberto, M.; Franco, W.; Hernandez-Ruiz, J.; Gutierrez-Herrera, E. Tryptophan intrinsic fluorescence from wound healing correlates with re-epithelialization in a rabbit model. Skin. Res. Technol. 2024, 30, e13834. [Google Scholar] [CrossRef]
- Barouti, N.; Mainetti, C.; Fontao, L.; Sorg, O. L-Tryptophan as a Novel Potential Pharmacological Treatment for Wound Healing via Aryl Hydrocarbon Receptor Activation. Dermatology 2015, 230, 332–339. [Google Scholar] [CrossRef]
- Krishnaswamy, V.R.; Benbenishty, A.; Blinder, P.; Sagi, I. Demystifying the extracellular matrix and its proteolytic remodeling in the brain: Structural and functional insights. Cell. Mol. Life Sci. 2019, 76, 3229–3248. [Google Scholar] [CrossRef]
- Sarapultsev, A.; Gusev, E.; Komelkova, M.; Utepova, I.; Luo, S.; Hu, D. JAK-STAT signaling in inflammation and stress-related diseases: Implications for therapeutic interventions. Mol. Biomed. 2023, 4, 40. [Google Scholar] [CrossRef]
- Das, A.; Ganesh, K.; Khanna, S.; Sen, C.K.; Roy, S. Engulfment of Apoptotic Cells by Macrophages: A Role of MicroRNA-21 in the Resolution of Wound Inflammation. J. Immunol. 2014, 192, 1120–1129. [Google Scholar] [CrossRef]
- Poormasjedi-Meibod, M.-S.; Hartwell, R.; Taghi Kilani, R.; Ghahary, A. Anti-Scarring Properties of Different Tryptophan Derivatives. PLoS ONE 2014, 9, e91955. [Google Scholar] [CrossRef]
- Arribas-Lopez, E.; Zand, N.; Ojo, O.; Snowden, M.J.; Kochhar, T. The Effect of Amino Acids on Wound Healing: A Systematic Review and Meta-Analysis on Arginine and Glutamine. Nutrients 2021, 13, 2498. [Google Scholar] [CrossRef]
- Md Fadilah, N.I.; Shahabudin, N.A.; Mohd Razif, R.A.; Sanyal, A.; Ghosh, A.; Baharin, K.I.; Ahmad, H.; Maarof, M.; Motta, A.; Fauzi, M.B. Discovery of bioactive peptides as therapeutic agents for skin wound repair. J. Tissue Eng. 2024, 15, 20417314241280359. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Liu, H.T. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res. 2002, 12, 9–18. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Liu, B.; Li, L.; Zhou, X.; Li, Q. Effects of Resveratrol on Pulmonary Fibrosis via TGF-β/Smad/ERK Signaling Pathway. Am. J. Chin. Med. 2023, 51, 651–676. [Google Scholar] [CrossRef]
- Tothova, Z.; Semelakova, M.; Solarova, Z.; Tomc, J.; Debeljak, N.; Solar, P. The Role of PI3K/AKT and MAPK Signaling Pathways in Erythropoietin Signalization. Int. J. Mol. Sci. 2021, 22, 7682. [Google Scholar] [CrossRef]
- Zheng, D.; Liwinski, T.; Elinav, E. Inflammasome activation and regulation: Toward a better understanding of complex mechanisms. Cell Discov. 2020, 6, 36. [Google Scholar] [CrossRef]
- Winkler, J.; Abisoye-Ogunniyan, A.; Metcalf, K.J.; Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat. Commun. 2020, 11, 5120. [Google Scholar] [CrossRef]
- Pérez-Gutiérrez, L.; Ferrara, N. Biology and therapeutic targeting of vascular endothelial growth factor A. Nat. Rev. Mol. Cell Biol. 2023, 24, 816–834. [Google Scholar] [CrossRef]
- Zhou, P.; Zhang, S.; Li, L.; Zhang, R.; Guo, G.; Zhang, Y.; Wang, R.; Liu, M.; Wang, Z.; Zhao, H.; et al. Targeted degradation of VEGF with bispecific aptamer-based LYTACs ameliorates pathological retinal angiogenesis. Theranostics 2024, 14, 4983–5000. [Google Scholar] [CrossRef]
- Diller, R.B.; Tabor, A.J. The Role of the Extracellular Matrix (ECM) in Wound Healing: A Review. Biomimetics 2022, 7, 87. [Google Scholar] [CrossRef]
- Kusindarta, D.L.; Wihadmadyatami, H. The Role of Extracellular Matrix in Tissue Regeneration. In Tissue Regeneration; Essayed Kaoud, H.A., Ed.; IntechOpen: Rijeka, Croatia, 2018. [Google Scholar]
- Xu, M.; Pang, Q.; Xu, S.; Ye, C.; Lei, R.; Shen, Y.; Xu, J. Hypoxia-inducible factor-1α activates transforming growth factor-β1/Smad signaling and increases collagen deposition in dermal fibroblasts. Oncotarget 2017, 9, 3188–3197. [Google Scholar]
- Shi, Y.H.; Fang, W.G. Hypoxia-inducible factor-1 in tumour angiogenesis. World J. Gastroenterol. 2004, 10, 1082–1087. [Google Scholar] [CrossRef] [PubMed]
- Pitsouli, C.; Tamamouna, V. The Hypoxia-Inducible Factor-1α in Angiogenesis and Cancer: Insights from the Drosophila Model. In Gene Expression and Regulation in Mammalian Cells-Transcription Toward the Establishment of Novel Therapeutics; Uchiumi, F., Ed.; IntechOpen: Rijeka, Croatia, 2018. [Google Scholar]
- Ding, X.; Yang, C.; Li, Y.; He, T.; Xu, Y.; Cheng, X.; Song, J.; Xue, N.; Min, W.; Feng, W.; et al. Reshaped commensal wound microbiome via topical application of Calvatia gigantea extract contributes to faster diabetic wound healing. Burns Trauma 2024, 12, tkae037. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Xu, M.; Lu, F.; He, Y. Development of Matrix Metalloproteinases-Mediated Extracellular Matrix Remodeling in Regenerative Medicine: A Mini Review. Tissue Eng. Regen. Med. 2023, 20, 661–670. [Google Scholar] [CrossRef]
- Fernandez-Guarino, M.; Bacci, S.; Perez Gonzalez, L.A.; Bermejo-Martinez, M.; Cecilia-Matilla, A.; Hernandez-Bule, M.L. The Role of Physical Therapies in Wound Healing and Assisted Scarring. Int. J. Mol. Sci. 2023, 24, 7487. [Google Scholar] [CrossRef]
- Laronha, H.; Caldeira, J. Structure and Function of Human Matrix Metalloproteinases. Cells 2020, 9, 1076. [Google Scholar] [CrossRef]
- Levi, N.; Papismadov, N.; Solomonov, I.; Sagi, I.; Krizhanovsky, V. The ECM path of senescence in aging: Components and modifiers. FEBS J. 2020, 287, 2636–2646. [Google Scholar] [CrossRef]
- Tzavlaki, K.; Moustakas, A. TGF-beta Signaling. Biomolecules 2020, 10, 487. [Google Scholar] [CrossRef]
- Nichani, K.; Li, J.; Suzuki, M.; Houston, J.P. Evaluation of Caspase-3 Activity During Apoptosis with Fluorescence Lifetime-Based Cytometry Measurements and Phasor Analyses. Cytom. A 2020, 97, 1265–1275. [Google Scholar] [CrossRef]
- Yu, X.; Zhou, J.; Ye, W.; Xu, J.; Li, R.; Huang, L.; Chai, Y.; Wen, M.; Xu, S.; Zhou, Y. Time-course swRNA-seq uncovers a hierarchical gene regulatory network in controlling the response-repair-remodeling after wounding. Commun. Biol. 2024, 7, 694. [Google Scholar] [CrossRef]
- Pinto, B.I.; Cruz, N.D.; Lujan, O.R.; Propper, C.R.; Kellar, R.S. In Vitro Scratch Assay to Demonstrate Effects of Arsenic on Skin Cell Migration. J. Vis. Exp. 2019, e58838. [Google Scholar] [CrossRef]






| Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| GAPDH | GAAGGTCGGTGTGAACGGAT | AATCTCCACTTTGCCACTGC |
| TNF-α | TCTTCTCATTCCTGCTTGTGG | GGTCTGGGCCATAGAACTGA |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| MCP-1 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
| MMP-9 | CGTCGTGATCCCCACTTACT | AACACACAGGGTTTGCCTTC |
| VEGF | GCACATAGAGAGAATGAGCTTCC | CTCCGCTCTGAACAAGGCT |
| TGF-β | CTCCCGTGGCTTCTAGTGC | GCCTTAGTTTGGACAGGATCTG |
| PDGF | CGGCCTGTGACTAGAAGAGG | GGGTCACTTCACACTTGCAT |
| FGF 2 | CACCCTCACATCAAGCTACAACTTCA | TCAGCTCTTAGCAGACATTGGAAGA |
| Collagen I | GCTCCTCTTAGGGGCCACT | CCACGTCTCACCATTGGGG |
| Collagen III | CTGTAACATGGAAACTGGGGAAA | CCATAGCTGAACTGAAAACCACC |
| Elastin | TGCCTGGAGACATTTCCCTAG | GGTGCTCCAACATTTCCCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tadese, D.A.; Mwangi, J.; Michira, B.B.; Wang, Y.; Cao, K.; Yang, M.; Khalid, M.; Wang, Z.; Lu, Q.; Lai, R. D-Tryptophan Promotes Skin Wound Healing via Extracellular Matrix Remodeling in Normal and Diabetic Models. Int. J. Mol. Sci. 2025, 26, 7158. https://doi.org/10.3390/ijms26157158
Tadese DA, Mwangi J, Michira BB, Wang Y, Cao K, Yang M, Khalid M, Wang Z, Lu Q, Lai R. D-Tryptophan Promotes Skin Wound Healing via Extracellular Matrix Remodeling in Normal and Diabetic Models. International Journal of Molecular Sciences. 2025; 26(15):7158. https://doi.org/10.3390/ijms26157158
Chicago/Turabian StyleTadese, Dawit Adisu, James Mwangi, Brenda B. Michira, Yi Wang, Kaixun Cao, Min Yang, Mehwish Khalid, Ziyi Wang, Qiumin Lu, and Ren Lai. 2025. "D-Tryptophan Promotes Skin Wound Healing via Extracellular Matrix Remodeling in Normal and Diabetic Models" International Journal of Molecular Sciences 26, no. 15: 7158. https://doi.org/10.3390/ijms26157158
APA StyleTadese, D. A., Mwangi, J., Michira, B. B., Wang, Y., Cao, K., Yang, M., Khalid, M., Wang, Z., Lu, Q., & Lai, R. (2025). D-Tryptophan Promotes Skin Wound Healing via Extracellular Matrix Remodeling in Normal and Diabetic Models. International Journal of Molecular Sciences, 26(15), 7158. https://doi.org/10.3390/ijms26157158

