Transforming Properties of E6/E7 Oncogenes from Beta-2 HPV80 in Primary Human Fibroblasts
Abstract
1. Introduction
2. Results
2.1. Integration and Expression of HPV80 E6/E7 Genes in Fibroblast Model
2.2. Proliferation Capability of FB-E6/E7 from HPV80 and HPV16
2.3. Effect of E6/E7 from HPV80 on Proliferation and Metabolic Activity
2.4. Migration Capacity of Primary Fibroblasts Expressing E6/E7
2.5. Transcriptomic Changes in FB-E6/E7-HPV80 and FB-E6/E7-HPV16 Cell Models
2.6. Enriched Pathways
2.7. Predicted Protein–Protein Interaction (PPI) Network Analysis
2.8. Validation of DEGs Regulated in E6/E7-HPV80 and E6/E7-HPV16 Models
3. Discussion
4. Materials and Methods
4.1. Cloning of E6/E7 Genes from HPV80
4.2. Lentiviral Particle Production, Quantification, and Viral RNA Isolation
4.3. Cell Culture
4.4. Fibroblast Transduction and E6/E7 Expression Evaluation
4.5. Evaluation of E6/E7 Integration in Genome of Transduced Fibroblasts
4.6. Immortalization Assay
4.7. WST-1 Metabolic Activity Assay
4.8. Cell Proliferation Assay
4.9. Cell Migration Assay
4.10. RNA-Seq
4.11. Protein–Protein Interaction (PPI) Network Analysis
4.12. qPCR Validation of PPI Network Analysis
4.13. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- American Association for Cancer Research. (s.f.). Cancer Today. Available online: https://gco.iarc.who.int/en (accessed on 6 February 2025).
- Zur Hausen, H. Papillomaviruses and cancer: From basic studies to clinical application. Nat. Rev. Cancer 2002, 2, 342–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- HPV Reference Clones. Available online: https://www.hpvcenter.se/human_reference_clones/ (accessed on 6 February 2025).
- Parvez, R.; Vijayachari, P.; Thiruvengadam, K.; Roy, A.; Saha, M.K.; Ramasamy, J.; Vins, A.; Biswas, L.; Vaz, A.; Kaur, H.; et al. A population based study on human papillomavirus infection and associated risk factors among women of the remote South Andaman Island, India. BMC Women’s Health 2024, 24, 139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Biological agents. Volume 100 B. A review of human carcinogens. IARC Monogr. Eval. Carcinog. Risks Hum. 2012, 100, 1. [Google Scholar]
- Tommasino, M. The human papillomavirus family and its role in carcinogenesis. Semin. Cancer Biol. 2014, 26, 13–21. [Google Scholar] [CrossRef] [Scilit]
- Tommasino, M. The biology of beta human papillomaviruses. Virus Res. 2017, 231, 128–138. [Google Scholar] [CrossRef] [Scilit]
- Skelin, J.; Tomaić, V. Comparative Analysis of Alpha and Beta HPV E6 Oncoproteins: Insights into Functional Distinctions and Divergent Mechanisms of Pathogenesis. Viruses 2023, 15, 2253. [Google Scholar] [CrossRef] [Scilit]
- Flores-Miramontes, M.G.; Olszewski, D.; Artaza-Irigaray, C.; Willemsen, A.; Bravo, I.G.; Vallejo-Ruiz, V.; Leal-Herrera, Y.A.; Piña-Sánchez, P.; Molina-Pineda, A.; Cantón-Romero, J.C.; et al. Detection of Alpha, Beta, Gamma, and Unclassified Human Papillomaviruses in Cervical Cancer Samples From Mexican Women. Front. Cell. Infect. Microbiol. 2020, 10, 234. [Google Scholar] [CrossRef] [Scilit]
- Castro-Amaya, A.M.; Fernández-Avila, L.; Barrón-Gallardo, C.A.; Moreno-Rios, C.E.; Guevara-Hernández, S.N.; Magaña-Torres, M.T.; Pelayo-Aguirre, C.J.; Jave-Suárez, L.F.; Aguilar-Lemarroy, A. E6/E7 from Beta-2-HPVs 122, 38b, and 107 possess transforming properties in a fibroblast model in vitro. Exp. Cell Res. 2022, 414, 113088. [Google Scholar] [CrossRef] [Scilit]
- Chahoud, J.; Semaan, A.; Chen, Y.; Cao, M.; Rieber, A.G.; Rady, P.; Tyring, S.K. Association Between β-Genus Human Papillomavirus and Cutaneous Squamous Cell Carcinoma in Immunocompetent Individuals-A Meta-analysis. JAMA Dermatol. 2016, 152, 1354–1364. [Google Scholar] [CrossRef] [Scilit]
- Giampieri, S.; Storey, A. Repair of UV-induced thymine dimers is compromised in cells expressing the E6 protein from human papillomaviruses types 5 and 18. Br. J. Cancer 2004, 90, 2203–2209. [Google Scholar] [CrossRef] [Scilit]
- Wallace, N.A.; Robinson, K.; Howie, H.L.; Galloway, D.A. HPV 5 and 8 E6 Abrogate ATR Activity Resulting in Increased Persistence of UVB Induced DNA Damage. PLoS Pathog. 2012, 8, e1002807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Institute of Allergy and Infectious Diseases. PaVE: The Papillomavirus Episteme. Available online: https://pave.niaid.nih.gov/search/search_database (accessed on 6 February 2025).
- Doorbar, J. Model systems of human papillomavirus-associated disease. J. Pathol. 2016, 238, 166–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, D.A.; Tayyar, Y.; Idris, A.; McMillan, N.A.J. A “hit-and-run” affair—A possible link for cancer progression in virally driven cancers. Biochim. Biophys. Acta BBA Rev. Cancer 2021, 1875, 188476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Münger, K.; Werness, B.A.; Dyson, N.; Phelps, W.C.; Harlow, E.; Howley, P.M. Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 1989, 8, 4099–4105. [Google Scholar] [CrossRef] [Scilit]
- Moody, C.A.; Laimins, L.A. Human papillomavirus oncoproteins: Pathways to transformation. Nat. Rev. Cancer 2010, 10, 550–560. [Google Scholar] [CrossRef] [Scilit]
- Kazem, S.; van der Meijden, E.; Struijk, L.; de Gruijl, F.R.; Feltkamp, M.C.W. Human papillomavirus 8 E6 disrupts terminal skin differentiation and prevents pro-Caspase-14 cleavage. Virus Res. 2012, 163, 609–616. [Google Scholar] [CrossRef] [Scilit]
- Pacini, L.; Savini, C.; Ghittoni, R.; Saidj, D.; Lamartine, J.; Hasan, U.A.; Accardi, R.; Tommasino, M. Downregulation of Toll-Like Receptor 9 Expression by Beta Human Papillomavirus 38 and Implications for Cell Cycle Control. J. Virol. 2015, 89, 11396–11405. [Google Scholar] [CrossRef] [Scilit]
- Cornet, I.; Bouvard, V.; Campo, M.S.; Thomas, M.; Banks, L.; Gissmann, L.; Lamartine, J.; Sylla, B.S.; Accardi, R.; Tommasino, M. Comparative Analysis of Transforming Properties of E6 and E7 from Different Beta Human Papillomavirus Types. J. Virol. 2012, 86, 2366–2370. [Google Scholar] [CrossRef] [Scilit]
- Gabet, A.-S.; Accardi, R.; Bellopede, A.; Popp, S.; Boukamp, P.; Sylla, B.S.; Londoño-Vallejo, J.A.; Tommasino, M. Impairment of the telomere/telomerase system and genomic instability are associated with keratinocyte immortalization induced by the skin human papillomavirus type 38. FASEB J. 2008, 22, 622–632. [Google Scholar] [CrossRef] [Scilit]
- Boxman, I.L.; Mulder, L.H.; Noya, F.; de Waard, V.; Gibbs, S.; Broker, T.R.; ten Kate, F.; Chow, L.T.; ter Schegget, J. Transduction of the E6 and E7 genes of epidermodysplasia-verruciformis-associated human papillomaviruses alters human keratinocyte growth and differentiation in organotypic cultures. J. Investig. Dermatol. 2001, 117, 1397–1404. [Google Scholar] [CrossRef] [Scilit]
- Antonsson, A.; Forslund, O.; Ekberg, H.; Sterner, G.; Hansson, B.G. The ubiquity and impressive genomic diversity of human skin papillomaviruses suggest a commensalic nature of these viruses. J. Virol. 2000, 74, 11636–11641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouwes Bavinck, J.N.; Neale, R.E.; Abeni, D.; Euvrard, S.; Green, A.C.; Harwood, C.A.; de Koning, M.N.; Naldi, L.; Nindl, I.; Pawlita, M.; et al. Multicenter study of the association between betapapillomavirus infection and cutaneous squamous cell carcinoma. Cancer Res. 2010, 70, 9777–9786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Dakic, A.; Chen, R.; Disbrow, G.L.; Zhang, Y.; Dai, Y.; Schlegel, R. Cell-Restricted Immortalization by Human Papillomavirus Correlates with Telomerase Activation and Engagement of the hTERT Promoter by Myc. J. Virol. 2008, 82, 11568–11576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mackintosh, L.J.; de Koning, M.N.; Quint, W.G.; Ter Schegget, J.; Morgan, I.M.; Herd, R.M.; Campo, M.S. Presence of beta human papillomaviruses in nonmelanoma skin cancer from organ transplant recipients and immunocompetent patients in the West of Scotland. Br. J. Dermatol. 2009, 161, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Nindl, I.; Kohler, A.; Gottschling, M.; Forschner, T.; Lehmann, M.; Meijer, C.J.; Snijders, P.J.; Stockfleth, E. Extension of the typing in a general-primer-PCR reverse-line-blotting system to detect all 25 cutaneous beta human papillomaviruses. J. Virol. Methods 2007, 146, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Sichero, L.; Pierce Campbell, C.M.; Ferreira, S.; Sobrinho, J.S.; Luiza Baggio, M.; Galan, L.; Silva, R.C.; Lazcano-Ponce, E.; Giuliano, A.R.; Villa, L.L.; et al. Broad HPV distribution in the genital region of men from the HPV infection in men (HIM) study. Virology 2013, 443, 214–217. [Google Scholar] [CrossRef] [Scilit]
- Minoni, L.; Romero-Medina, M.C.; Venuti, A.; Sirand, C.; Robitaille, A.; Altamura, G.; Le Calvez-Kelm, F.; Viarisio, D.; Zanier, K.; Müller, M.; et al. Transforming Properties of Beta-3 Human Papillomavirus E6 and E7 Proteins. mSphere 2020, 5, e00398-20. [Google Scholar] [CrossRef] [Scilit]
- Caldeira, S.; Zehbe, I.; Accardi, R.; Malanchi, I.; Dong, W.; Giarrè, M.; de Villiers, E.-M.; Filotico, R.; Boukamp, P.; Tommasino, M. The E6 and E7 Proteins of the Cutaneous Human Papillomavirus Type 38 Display Transforming Properties. J. Virol. 2003, 77, 2195–2206. [Google Scholar] [CrossRef] [Scilit]
- Overmiller, A.M.; Pierluissi, J.A.; Wermuth, P.J.; Sauma, S.; Martinez-Outschoorn, U.; Tuluc, M.; Luginbuhl, A.; Curry, J.; Harshyne, L.A.; Wahl Iii, J.K.; et al. Desmoglein 2 modulates extracellular vesicle release from squamous cell carcinoma keratinocytes. FASEB J. 2017, 31, 3412–3424. [Google Scholar] [CrossRef] [Scilit]
- Viehweger, F.; Azem, A.; Gorbokon, N.; Uhlig, R.; Lennartz, M.; Dwertmann Rico, S.; Kind, S.; Reiswich, V.; Kluth, M.; Hube-Magg, C.; et al. Desmoglein 3 (Dsg3) expression in cancer: A tissue microarray study on 15,869 tumors. Pathol. Res. Pract. 2022, 240, 154200. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Zhang, W.; Li, H.; Niu, C.; Ou, Y.; Song, L.; Zhang, Y. Stonin 2 Overexpression is Correlated with Unfavorable Prognosis and Tumor Invasion in Epithelial Ovarian Cancer. Int. J. Mol. Sci. 2017, 18, 1653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahapatra, K.K.; Mishra, S.R.; Dhiman, R.; Bhutia, S.K. Stonin 2 activates lysosomal-mTOR axis for cell survival in oral cancer. Toxicol. Vitr. 2023, 88, 105561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, D.; Li, Y.Q.; Liu, Q.X.; Deng, X.F.; Chen, L.; Li, M.Y.; Zhang, J.; Lu, X.; Zheng, H.; Dai, J.G. Integrated whole-exome and bulk transcriptome sequencing delineates the dynamic evolution from preneoplasia to invasive lung adenocarcinoma featured with ground-glass nodules. Cancer Med. 2024, 13, e7383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, Y.; Matsuo, A.; Kudoh, S.; Fang, L.; Hasegawa, K.; Shinmyo, Y.; Ito, T. Expression of Draxin in Lung Carcinomas. Acta Histochem. Cytochem. 2018, 51, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.; Liu, Z.; Cheng, X.; Liu, R.; Li, P.; Kong, D.; Liang, W.; Liu, B.; Wang, H.; Bu, X.; et al. DRAXIN as a Novel Diagnostic Marker to Predict the Poor Prognosis of Glioma Patients. J. Mol. Neurosci. 2022, 72, 2136–2149. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Shao, S.; Li, L. Characterization of Class-3 Semaphorin Receptors, Neuropilins and Plexins, as Therapeutic Targets in a Pan-Cancer Study. Cancers 2020, 12, 1816. [Google Scholar] [CrossRef] [Scilit]
- Kigel, B.; Rabinowicz, N.; Varshavsky, A.; Kessler, O.; Neufeld, G. Plexin-A4 promotes tumor progression and tumor angiogenesis by enhancement of VEGF and bFGF signaling. Blood 2011, 118, 4285–4296. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Yang, G. The role of ATP-binding cassette subfamily G member 1 in tumor progression. Cancer Med. 2024, 13, e7285. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Xiang, F.; Liu, X.; Ma, X.; Cai, X.; Yang, Y.; Shen, X.; Yuan, C.; Xiang, Y.; Xiao, H. HPV E7 affects the function of cervical cancer cells via the TAL1/lnc-EBIC/KLHDC7B axis. Oncol. Rep. 2021, 45, 51. [Google Scholar] [CrossRef] [Scilit]
- Guo, P.; Wang, D.; Wu, J.; Yang, J.; Ren, T.; Zhu, B.; Xiang, Y. The landscape of alternative splicing in cervical squamous cell carcinoma. Onco Targets Ther. 2015, 8, 73–79. [Google Scholar] [CrossRef] [Scilit]
- Mai, C.; Zhao, J.J.; Tang, X.F.; Wang, W.; Pan, K.; Pan, Q.Z.; Zhang, X.F.; Jiang, S.S.; Zhao, B.W.; Li, Y.F.; et al. Decreased ITIH5 expression is associated with poor prognosis in primary gastric cancer. Med. Oncol. 2014, 31, 53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veeck, J.; Chorovicer, M.; Naami, A.; Breuer, E.; Zafrakas, M.; Bektas, N.; Durst, M.; Kristiansen, G.; Wild, P.J.; Hartmann, A.; et al. The extracellular matrix protein ITIH5 is a novel prognostic marker in invasive node-negative breast cancer and its aberrant expression is caused by promoter hypermethylation. Oncogene 2008, 27, 865–876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rose, M.; Gaisa, N.T.; Antony, P.; Fiedler, D.; Heidenreich, A.; Otto, W.; Denzinger, S.; Bertz, S.; Hartmann, A.; Karl, A.; et al. Epigenetic inactivation of ITIH5 promotes bladder cancer progression and predicts early relapse of pT1 high-grade urothelial tumours. Carcinogenesis 2014, 35, 727–736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Cao, F.; Li, X.; Zhang, L.; Liu, Z.; Li, X.; Lin, J.; Han, C. ITIH5, a p53-responsive gene, inhibits the growth and metastasis of melanoma cells by downregulating the transcriptional activity of KLF4. Cell Death Dis. 2021, 12, 438. [Google Scholar] [CrossRef] [Scilit]
- Dittmann, J.; Ziegfeld, A.; Jansen, L.; Gajda, M.; Kloten, V.; Dahl, E.; Runnebaum, I.B.; Durst, M.; Backsch, C. Gene expression analysis combined with functional genomics approach identifies ITIH5 as tumor suppressor gene in cervical carcinogenesis. Mol. Carcinog. 2017, 56, 1578–1589. [Google Scholar] [CrossRef] [Scilit]
- Sun, N.; Shen, J.; Shi, Y.; Liu, B.; Gao, S.; Chen, Y.; Sun, J. TRIM58 functions as a tumor suppressor in colorectal cancer by promoting RECQL4 ubiquitination to inhibit the AKT signaling pathway. World J. Surg. Oncol. 2023, 21, 231. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Long, Z.; Cai, H.; Yu, S.; Wu, J. TRIM58 suppresses the tumor growth in gastric cancer by inactivation of beta-catenin signaling via ubiquitination. Cancer Biol. Ther. 2020, 21, 203–212. [Google Scholar] [CrossRef] [Scilit]
- Trave, G.; Zanier, K. HPV-mediated inactivation of tumor suppressor p53. Cell Cycle 2016, 15, 2231–2232. [Google Scholar] [CrossRef] [Scilit]
- Abboodi, F.; Buckhaults, P.; Altomare, D.; Liu, C.; Hosseinipour, M.; Banister, C.E.; Creek, K.E.; Pirisi, L. HPV-inactive cell populations arise from HPV16-transformed human keratinocytes after p53 knockout. Virology 2021, 554, 9–16. [Google Scholar] [CrossRef] [Scilit]
- Cabeca, T.K.; de Mello Abreu, A.; Andrette, R.; de Souza Lino, V.; Morale, M.G.; Aguayo, F.; Termini, L.; Villa, L.L.; Lepique, A.P.; Boccardo, E. HPV-Mediated Resistance to TNF and TRAIL Is Characterized by Global Alterations in Apoptosis Regulatory Factors, Dysregulation of Death Receptors, and Induction of ROS/RNS. Int. J. Mol. Sci. 2019, 20, 198. [Google Scholar] [CrossRef] [Scilit]
- Boccardo, E.; Noya, F.; Broker, T.R.; Chow, L.T.; Villa, L.L. HPV-18 confers resistance to TNF-alpha in organotypic cultures of human keratinocytes. Virology 2004, 328, 233–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meuris, F.; Carthagena, L.; Jaracz-Ros, A.; Gaudin, F.; Cutolo, P.; Deback, C.; Xue, Y.; Thierry, F.; Doorbar, J.; Bachelerie, F. The CXCL12/CXCR4 Signaling Pathway: A New Susceptibility Factor in Human Papillomavirus Pathogenesis. PLoS Pathog. 2016, 12, e1006039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narisawa-Saito, M.; Kiyono, T. Basic mechanisms of high-risk human papillomavirus-induced carcinogenesis: Roles of E6 and E7 proteins. Cancer Sci. 2007, 98, 1505–1511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, Q.; Wang, L.; Zuo, L.; Gao, S.; Jiang, X.; Han, Y.; Lin, J.; Peng, M.; Wu, N.; Tang, Y.; et al. HPV E6/E7: Insights into their regulatory role and mechanism in signaling pathways in HPV-associated tumor. Cancer Gene Ther. 2024, 31, 9–17. [Google Scholar] [CrossRef] [Scilit]
- Alipour, A.H.; Hashemi, S.M.A.; Moattari, A.; Farhadi, A.; Sarvari, J. Epstein-Barr Virus Nuclear Antigen 1 Increases the Expression of Viral Oncogenes and Cellular Genes in the HeLa Cell Line. Int. J. Mol. Cell Med. 2022, 11, 346–356. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Gao, K.; Yao, D. Comprehensive analysis of autophagy associated genes and immune infiltrates in cervical cancer. Iran. J. Basic. Med. Sci. 2024, 27, 813–824. [Google Scholar] [CrossRef] [Scilit]
- Del Pino, M.; Svanholm-Barrie, C.; Torne, A.; Marimon, L.; Gaber, J.; Sagasta, A.; Persing, D.H.; Ordi, J. mRNA biomarker detection in liquid-based cytology: A new approach in the prevention of cervical cancer. Mod. Pathol. 2015, 28, 312–320. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Yuan, P.; Gui, L.; Wang, Z.; Yin, P.; Gao, W.Q.; Ma, B. CCL28 Downregulation Attenuates Pancreatic Cancer Progression Through Tumor Cell-Intrinsic and -Extrinsic Mechanisms. Technol. Cancer Res. Treat. 2021, 20, 15330338211068958. [Google Scholar] [CrossRef] [Scilit]
- Gong, D.H.; Chen, Y.Y.; Ma, D.; Chen, H.Y.; Ding, K.F.; Yu, K.D. Complicated prognostic values of CCL28 in breast cancer by subtype. J. Thorac. Dis. 2019, 11, 777–787. [Google Scholar] [CrossRef] [Scilit]
- Su, X.; Wang, G.; Zheng, S.; Ge, C.; Kong, F.; Wang, C. Comprehensive Explorations of CCL28 in Lung Adenocarcinoma Immunotherapy and Experimental Validation. J. Inflamm. Res. 2023, 16, 1325–1342. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Song, J.; Zhang, Y.; Wang, H.; Sun, H.; Feng, X.; Hou, M.; Chen, G.; Tang, Q.; Ji, M. ASF1B promotes cervical cancer progression through stabilization of CDK9. Cell Death Dis. 2020, 11, 705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, F.; Ou, D.; Tan, H.; Gao, Y.; Zi, D. The circCDK17/miR-122-5p/ASF1B axis regulates the progression of cervical cancer. Histol. Histopathol. 2023, 38, 359–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, H.; Chen, Q.; Wang, Z.; Qian, X.; Pan, Y. Pan-cancer and single-cell analysis reveals FAM83D expression as a cancer prognostic biomarker. Front. Genet. 2022, 13, 1009325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Yu, S.; Lok, S.I.S.; Wong, A.S.T.; Jiao, Y.; Lee, L.T.O. FAM83D promotes ovarian cancer progression and its potential application in diagnosis of invasive ovarian cancer. J. Cell Mol. Med. 2019, 23, 4569–4581. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhao, Y.; Zou, X.; Wang, L. Relationship of P16 and Ki67 in recurrence of HPV infection and cervical intraepithelial neoplasia. Int. J. Clin. Exp. Pathol. 2020, 13, 3174–3180. [Google Scholar]
- Jiang, P.; Shen, K.; Wang, X.; Song, H.; Yue, Y.; Liu, T. TPX2 regulates tumor growth in human cervical carcinoma cells. Mol. Med. Rep. 2014, 9, 2347–2351. [Google Scholar] [CrossRef] [Scilit]
- Chujan, S.; Kitkumthorn, N.; Siriangkul, S.; Mutirangura, A. CCNA1 promoter methylation: A potential marker for grading Papanicolaou smear cervical squamous intraepithelial lesions. Asian Pac. J. Cancer Prev. 2014, 15, 7971–7975. [Google Scholar] [CrossRef] [Scilit]
- Qiu, J.J.; Sun, S.G.; Tang, X.Y.; Lin, Y.Y.; Hua, K.Q. Extracellular vesicular Wnt7b mediates HPV E6-induced cervical cancer angiogenesis by activating the beta-catenin signaling pathway. J. Exp. Clin. Cancer Res. 2020, 39, 260. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Ding, H.; Wang, K.; Guo, K. Inhibition of Wnt7b reduces the proliferation, invasion, and migration of colorectal cancer cells. Mol. Biol. Rep. 2023, 50, 1415–1424. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Huang, L.; Hu, Q.; Zheng, K.; Yan, Y.; Lan, T.; Zheng, D.; Lu, Y. WNT7B promotes cancer progression via WNT/beta-catenin signaling pathway and predicts a poor prognosis in oral squamous cell carcinoma. BMC Oral. Health 2024, 24, 1335. [Google Scholar] [CrossRef] [Scilit]
- Oladipo, K.H.; Parish, J.L. De-regulation of aurora kinases by oncogenic HPV; implications in cancer development and treatment. Tumour Virus Res. 2025, 19, 200314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Twu, N.F.; Yuan, C.C.; Yen, M.S.; Lai, C.R.; Chao, K.C.; Wang, P.H.; Wu, H.H.; Chen, Y.J. Expression of Aurora kinase A and B in normal and malignant cervical tissue: High Aurora A kinase expression in squamous cervical cancer. Eur. J. Obs. Gynecol. Reprod. Biol. 2009, 142, 57–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pannone, G.; Hindi, S.A.; Santoro, A.; Sanguedolce, F.; Rubini, C.; Cincione, R.I.; De Maria, S.; Tortorella, S.; Rocchetti, R.; Cagiano, S.; et al. Aurora B expression as a prognostic indicator and possible therapeutic target in oral squamous cell carcinoma. Int. J. Immunopathol. Pharmacol. 2011, 24, 79–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boon, S.S.; Lee, Y.C.; Yip, K.L.; Luk, H.Y.; Xiao, C.; Yim, M.K.; Chen, Z.; Chan, P.K.S. Interaction between Human Papillomavirus-Encoded E6 Protein and AurB Induces Cell Immortalization and Proliferation-A Potential Target of Intervention. Cancers 2023, 15, 2465. [Google Scholar] [CrossRef] [Scilit]
- Qiu, H.Z.; Huang, J.; Xiang, C.C.; Li, R.; Zuo, E.D.; Zhang, Y.; Shan, L.; Cheng, X. Screening and Discovery of New Potential Biomarkers and Small Molecule Drugs for Cervical Cancer: A Bioinformatics Analysis. Technol. Cancer Res. Treat. 2020, 19, 1533033820980112. [Google Scholar] [CrossRef] [Scilit]
- Chiarini, A.; Liu, D.; Rassu, M.; Armato, U.; Eccher, C.; Dal Pra, I. Over Expressed TKTL1, CIP-2A, and B-MYB Proteins in Uterine Cervix Epithelium Scrapings as Potential Risk Predictive Biomarkers in HR-HPV-Infected LSIL/ASCUS Patients. Front. Oncol. 2019, 9, 213. [Google Scholar] [CrossRef] [Scilit]
- Bermudez-Morales, V.H.; Gutierrez, L.X.; Alcocer-Gonzalez, J.M.; Burguete, A.; Madrid-Marina, V. Correlation between IL-10 gene expression and HPV infection in cervical cancer: A mechanism for immune response escape. Cancer Investig. 2008, 26, 1037–1043. [Google Scholar] [CrossRef] [Scilit]
- Rose, R.; Golosova, O.; Sukhomlinov, D.; Tiunov, A.; Prosperi, M. Flexible design of multiple metagenomics classification pipelines with UGENE. Bioinformatics 2019, 35, 1963–1965. [Google Scholar] [CrossRef] [Scilit]
- Barde, I.; Salmon, P.; Trono, D. Production and titration of lentiviral vectors. Curr. Protoc. Neurosci. 2010, 53, 21. [Google Scholar] [CrossRef] [Scilit]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [Scilit]
- Suarez-Arnedo, A.; Torres Figueroa, F.; Clavijo, C.; Arbeláez, P.; Cruz, J.C.; Muñoz-Camargo, C. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS ONE 2020, 15, e0232565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, Y.; Smyth, G.K.; Shi, W. The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res. 2019, 47, e47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ulgen, E.; Ozisik, O.; Sezerman, O.U. pathfindR: An R Package for Comprehensive Identification of Enriched Pathways in Omics Data Through Active Subnetworks. Front. Genet. 2019, 10, 858. [Google Scholar] [CrossRef] [Scilit] [PubMed]











| Cellular Model | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Amplicon Size |
|---|---|---|---|
| HPV80 | TTGAGGTAGTTGAGCGAAAAG | TGCTGCTGGTTGTAACAAAT | 109 bp |
| HPV16 | TAGAGAAACCCAGCTGTAATCA | AGGATCAGCCATGGTAGATTAT | 336 bp |
| pLVX-Puro | GCCCGCCTTCCTGGAGACCTC | TGATTGTTCCAGACGCGGTCA | 150 bp |
| Actin | TCCGCAAAGACCTGTACG | AAGAAAGGGTGTAACGCAACTA | 410 bp |
| Gene | Forward Primer (5′-3′) | Reverse Primer (3′-5′) | Amplicon Size |
|---|---|---|---|
| IL-10 | GCTACGGCGCTGTCATCGATT | CAGAGCCCCAGATCCGATTTTG | 244 bp |
| BIRC5 | GCTGGGAGCCAGATGACGACC | CGATGGCACGGCGCACTTT | 279 bp |
| CCL28 | AGCTGTTGCACGGAGGTTT | TTCTTGGCAGCTTGCACTTTC | 191 bp |
| ASF1B | ACAGGAGTTCATCCGAGTGG | GCCTGTCCATGTTGTTGTCC | 170 bp |
| FAM83D | GACAGTTCGGACTATCACAGGA | CAACCACTTGGCCAGACAGA | 185 bp |
| MKI67 | GAAAGGGAAAGGAGAAGCAGGA | TCTTGACACACACATTGTCCTCA | 173 bp |
| TPX2 | GGCCAGACTACAGGAAG | ACAGCTGAGTTTAGCAGTGGA | 182 bp |
| CCNA1 | TGACAGTACCAACCACCAACC | TGCAGCTATCAGTGAAGGAAGA | 152 bp |
| WNT7B | GCGTTACGGCATCGACTTCT | TGTCTCCATGGGCTTCTGATAG | 331 bp |
| MYBL2 | CCGAAGCCACTTCACGACA | ACCCTCAACACCTCAGGACA | 169 bp |
| AURKB | TGTGGTGCATTGGAGTGCTT | AGGGGTTATGCCTGAGCAGT | 171 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Renteria-Flores, F.I.; Molina-Pineda, A.; Piña-Cruz, R.; Vizcarra-Ramos, S.; Vega-Magaña, A.N.; García-Chagollán, M.; Magaña-Torres, M.T.; Hernández-Gutiérrez, R.; Aguilar-Lemarroy, A.; Jave-Suárez, L.F. Transforming Properties of E6/E7 Oncogenes from Beta-2 HPV80 in Primary Human Fibroblasts. Int. J. Mol. Sci. 2025, 26, 5347. https://doi.org/10.3390/ijms26115347
Renteria-Flores FI, Molina-Pineda A, Piña-Cruz R, Vizcarra-Ramos S, Vega-Magaña AN, García-Chagollán M, Magaña-Torres MT, Hernández-Gutiérrez R, Aguilar-Lemarroy A, Jave-Suárez LF. Transforming Properties of E6/E7 Oncogenes from Beta-2 HPV80 in Primary Human Fibroblasts. International Journal of Molecular Sciences. 2025; 26(11):5347. https://doi.org/10.3390/ijms26115347
Chicago/Turabian StyleRenteria-Flores, Francisco Israel, Andrea Molina-Pineda, Ruben Piña-Cruz, Sayma Vizcarra-Ramos, Alejandra Natali Vega-Magaña, Mariel García-Chagollán, María Teresa Magaña-Torres, Rodolfo Hernández-Gutiérrez, Adriana Aguilar-Lemarroy, and Luis Felipe Jave-Suárez. 2025. "Transforming Properties of E6/E7 Oncogenes from Beta-2 HPV80 in Primary Human Fibroblasts" International Journal of Molecular Sciences 26, no. 11: 5347. https://doi.org/10.3390/ijms26115347
APA StyleRenteria-Flores, F. I., Molina-Pineda, A., Piña-Cruz, R., Vizcarra-Ramos, S., Vega-Magaña, A. N., García-Chagollán, M., Magaña-Torres, M. T., Hernández-Gutiérrez, R., Aguilar-Lemarroy, A., & Jave-Suárez, L. F. (2025). Transforming Properties of E6/E7 Oncogenes from Beta-2 HPV80 in Primary Human Fibroblasts. International Journal of Molecular Sciences, 26(11), 5347. https://doi.org/10.3390/ijms26115347

