Clove Essential Oil as a Source of Antitumoral Compounds Capable of Crossing the Blood–Brain Barrier: A Focus on the Effects of β-Caryophyllene and Eugenol in a Glioblastoma Cell Line
Abstract
1. Introduction
2. Results
2.1. Pharmacokinetics of BCA
2.1.1. Intravenous Administration
2.1.2. Oral Administration
2.2. Effect of EU and BCA Co-Administration on the Metabolic Activity of GB Cells
2.3. Effects of EU and BCA on Clonogenic Cell Survival Assay
2.4. Effects of EU and BCA on U87 Cell Viability
2.5. Effects of EU and BCA on the Mitochondrial Membrane Potential
2.6. Effects of EU and BCA on the mRNA Levels on Genes Related to Glioblastoma in U87 Cells
2.6.1. Intrinsic Apoptotic Pathway
2.6.2. TP53 Pathway
2.6.3. PI3K/AKT/mTOR Pathway
2.7. Cytokines Analysis
3. Discussion
3.1. EU and BCA Pharmacokinetics
3.2. EU and BCA Antitumor Activities
3.3. Activated Apoptotic Pathway
3.4. Anti-Angiogenic Effects
3.5. Anti-Inflammatory Effects
3.6. Limitations to the Study
4. Materials and Methods
4.1. Materials
4.2. BCA Pharmacokinetic in Rats
4.3. In Vitro Evaluation of EU and BCA Effects on GB and HMC3 Cells
4.3.1. Cell Cultures
4.3.2. Metabolic Activity Assay
4.3.3. Clonogenic Cell Survival Assay
4.3.4. Cell Cycle Analysis
4.3.5. Cell Death Assay
4.3.6. Mitochondrial Membrane Potential Evaluation
4.3.7. Quantitative Real-Time PCR
4.3.8. Determination of Inflammatory Cytokines on Conditioned Media
4.3.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A Summary. Neuro-Oncology 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [PubMed]
 - Ostrom, Q.T.; Patil, N.; Cioffi, G.; Waite, K.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2013–2017. Neuro-Oncology 2020, 22, iv1–iv96. [Google Scholar] [CrossRef] [PubMed]
 - Rabah, N.; Ait Mohand, F.-E.; Kravchenko-Balasha, N. Understanding Glioblastoma Signaling, Heterogeneity, Invasiveness, and Drug Delivery Barriers. Int. J. Mol. Sci. 2023, 24, 14256. [Google Scholar] [CrossRef]
 - Le Rhun, E.; Preusser, M.; Roth, P.; Reardon, D.A.; van den Bent, M.; Wen, P.; Reifenberger, G.; Weller, M. Molecular Targeted Therapy of Glioblastoma. Cancer Treat. Rev. 2019, 80, 101896. [Google Scholar] [CrossRef] [PubMed]
 - Waqar, M.; Roncaroli, F.; Lehrer, E.J.; Palmer, J.D.; Villanueva-Meyer, J.; Braunstein, S.; Hall, E.; Aznar, M.; De Witt Hamer, P.C.; D’Urso, P.I.; et al. Rapid Early Progression (REP) of Glioblastoma Is an Independent Negative Prognostic Factor: Results from a Systematic Review and Meta-Analysis. Neuro-Oncol. Adv. 2022, 4, vdac075. [Google Scholar] [CrossRef]
 - Jezierzański, M.; Nafalska, N.; Stopyra, M.; Furgoł, T.; Miciak, M.; Kabut, J.; Gisterek-Grocholska, I. Temozolomide (TMZ) in the Treatment of Glioblastoma Multiforme—A Literature Review and Clinical Outcomes. Curr. Oncol. 2024, 31, 3994–4002. [Google Scholar] [CrossRef] [PubMed]
 - Wang, Z.; Liu, F.; Liao, W.; Yu, L.; Hu, Z.; Li, M.; Xia, H. Curcumin Suppresses Glioblastoma Cell Proliferation by P-AKT/mTOR Pathway and Increases the PTEN Expression. Arch. Biochem. Biophys. 2020, 689, 108412. [Google Scholar] [CrossRef]
 - Zhang, Y.; Zhang, Z.; Mousavi, M.; Moliani, A.; Bahman, Y.; Bagheri, H. Resveratrol Inhibits Glioblastoma Cells and Chemoresistance Progression through Blockade P-Glycoprotein and Targeting AKT/PTEN Signaling Pathway. Chem.-Biol. Interact. 2023, 376, 110409. [Google Scholar] [CrossRef]
 - Chen, B.; Li, X.; Wu, L.; Zhou, D.; Song, Y.; Zhang, L.; Wu, Q.; He, Q.; Wang, G.; Liu, X.; et al. Quercetin Suppresses Human Glioblastoma Migration and Invasion via GSK3β/β-Catenin/ZEB1 Signaling Pathway. Front. Pharmacol. 2022, 13, 963614. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, Y.; Wang, S.-X.; Ma, J.-W.; Li, H.-Y.; Ye, J.-C.; Xie, S.-M.; Du, B.; Zhong, X.-Y. EGCG Inhibits Properties of Glioma Stem-like Cells and Synergizes with Temozolomide through Downregulation of P-Glycoprotein Inhibition. J. Neurooncol. 2015, 121, 41–52. [Google Scholar] [CrossRef]
 - Sun, Y.; Huang, H.; Zhan, Z.; Gao, H.; Zhang, C.; Lai, J.; Cao, J.; Li, C.; Chen, Y.; Liu, Z. Berberine Inhibits Glioma Cell Migration and Invasion by Suppressing TGF-Β1/COL11A1 Pathway. Biochem. Biophys. Res. Commun. 2022, 625, 38–45. [Google Scholar] [CrossRef]
 - Magalhães, M.; Domínguez-Martín, E.M.; Jorge, J.; Gonçalves, A.C.; Massenzio, F.; Spigarelli, R.; Ribeiro-Rodrigues, T.; Catarino, S.; Girão, H.; Monti, B.; et al. Unveiling the Antitumor Mechanism of 7α-Acetoxy-6β-Hydroxyroyleanone from Plectranthus Hadiensis in Glioblastoma. J. Ethnopharmacol. 2024, 335, 118689. [Google Scholar] [CrossRef] [PubMed]
 - Chunarkar-Patil, P.; Kaleem, M.; Mishra, R.; Ray, S.; Ahmad, A.; Verma, D.; Bhayye, S.; Dubey, R.; Singh, H.N.; Kumar, S. Anticancer Drug Discovery Based on Natural Products: From Computational Approaches to Clinical Studies. Biomedicines 2024, 12, 201. [Google Scholar] [CrossRef] [PubMed]
 - Blowman, K.; Magalhães, M.; Lemos, M.F.L.; Cabral, C.; Pires, I.M. Anticancer Properties of Essential Oils and Other Natural Products. Evid.-Based Complement. Altern. Med. 2018, 2018, 3149362. [Google Scholar] [CrossRef] [PubMed]
 - Saracino, I.M.; Foschi, C.; Pavoni, M.; Spigarelli, R.; Valerii, M.C.; Spisni, E. Antifungal Activity of Natural Compounds vs. Candida Spp.: A Mixture of Cinnamaldehyde and Eugenol Shows Promising In Vitro Results. Antibiotics 2022, 11, 73. [Google Scholar] [CrossRef]
 - Spisni, E.; Petrocelli, G.; Imbesi, V.; Spigarelli, R.; Azzinnari, D.; Donati Sarti, M.; Campieri, M.; Valerii, M.C. Antioxidant, Anti-Inflammatory, and Microbial-Modulating Activities of Essential Oils: Implications in Colonic Pathophysiology. Int. J. Mol. Sci. 2020, 21, 4152. [Google Scholar] [CrossRef]
 - Spisni, E.; Valerii, M.C.; Massimino, M.L. Essential Oil Molecules Can Break the Loop of Oxidative Stress in Neurodegenerative Diseases. Biology 2023, 12, 1504. [Google Scholar] [CrossRef]
 - Pavan, B.; Bianchi, A.; Botti, G.; Ferraro, L.; Valerii, M.C.; Spisni, E.; Dalpiaz, A. Pharmacokinetic and Permeation Studies in Rat Brain of Natural Compounds Led to Investigate Eugenol as Direct Activator of Dopamine Release in PC12 Cells. Int. J. Mol. Sci. 2023, 24, 1800. [Google Scholar] [CrossRef] [PubMed]
 - Ojha, S.; Javed, H.; Azimullah, S.; Haque, M.E. β-Caryophyllene, a Phytocannabinoid Attenuates Oxidative Stress, Neuroinflammation, Glial Activation, and Salvages Dopaminergic Neurons in a Rat Model of Parkinson Disease. Mol. Cell Biochem. 2016, 418, 59–70. [Google Scholar] [CrossRef]
 - Zhang, Y.; Huang, Q.; Wang, S.; Liao, Z.; Jin, H.; Huang, S.; Hong, X.; Liu, Y.; Pang, J.; Shen, Q.; et al. The Food Additive β-Caryophyllene Exerts Its Neuroprotective Effects Through the JAK2-STAT3-BACE1 Pathway. Front. Aging Neurosci. 2022, 14, 814432. [Google Scholar] [CrossRef]
 - Askari, V.R.; Shafiee-Nick, R. The Protective Effects of β-Caryophyllene on LPS-Induced Primary Microglia M1/M2 Imbalance: A Mechanistic Evaluation. Life Sci. 2019, 219, 40–73. [Google Scholar] [CrossRef] [PubMed]
 - Baradaran Rahimi, V.; Askari, V.R. A Mechanistic Review on Immunomodulatory Effects of Selective Type Two Cannabinoid Receptor β-Caryophyllene. BioFactors 2022, 48, 857–882. [Google Scholar] [CrossRef]
 - Lehman-McKeeman, L.D.; Rodriguez, P.A.; Takigiku, R.; Caudill, D.; Fey, M.L. D-Limonene-Induced Male Rat-Specific Nephrotoxicity: Evaluation of the Association between d-Limonene and α2u-Globulin. Toxicol. Appl. Pharmacol. 1989, 99, 250–259. [Google Scholar] [CrossRef]
 - Yuan, J.H.; Dieter, M.P.; Bucher, J.R.; Jameson, C.W. Toxicokinetics of Cinnamaldehyde in F344 Rats. Food Chem. Toxicol. 1992, 30, 997–1004. [Google Scholar] [CrossRef] [PubMed]
 - Schmitt, D.; Levy, R.; Carroll, B. Toxicological Evaluation of β-Caryophyllene Oil: Subchronic Toxicity in Rats. Int. J. Toxicol. 2016, 35, 558–567. [Google Scholar] [CrossRef] [PubMed]
 - Pavan, B.; Dalpiaz, A.; Marani, L.; Beggiato, S.; Ferraro, L.; Canistro, D.; Paolini, M.; Vivarelli, F.; Valerii, M.C.; Comparone, A.; et al. Geraniol Pharmacokinetics, Bioavailability and Its Multiple Effects on the Liver Antioxidant and Xenobiotic-Metabolizing Enzymes. Front Pharmacol. 2018, 9, 18. [Google Scholar] [CrossRef]
 - Di Sotto, A.; Paolicelli, P.; Nardoni, M.; Abete, L.; Garzoli, S.; Di Giacomo, S.; Mazzanti, G.; Casadei, M.A.; Petralito, S. SPC Liposomes as Possible Delivery Systems for Improving Bioavailability of the Natural Sesquiterpene β-Caryophyllene: Lamellarity and Drug-Loading as Key Features for a Rational Drug Delivery Design. Pharmaceutics 2018, 10, 274. [Google Scholar] [CrossRef] [PubMed]
 - Mödinger, Y.; Knaub, K.; Dharsono, T.; Wacker, R.; Meyrat, R.; Land, M.H.; Petraglia, A.L.; Schön, C. Enhanced Oral Bioavailability of β-Caryophyllene in Healthy Subjects Using the VESIsorb® Formulation Technology, a Novel Self-Emulsifying Drug Delivery System (SEDDS). Molecules 2022, 27, 2860. [Google Scholar] [CrossRef]
 - Marques, M.P.; Neves, B.G.; Varela, C.; Zuzarte, M.; Gonçalves, A.C.; Dias, M.I.; Amaral, J.S.; Barros, L.; Magalhães, M.; Cabral, C. Essential Oils from Côa Valley Lamiaceae Species: Cytotoxicity and Antiproliferative Effect on Glioblastoma Cells. Pharmaceutics 2023, 15, 341. [Google Scholar] [CrossRef] [PubMed]
 - CFR-Code of Federal Regulations Title 21. Available online: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/CFRSearch.cfm?FR=182.20 (accessed on 2 December 2024).
 - Olmez, I.; Brenneman, B.; Xiao, A.; Serbulea, V.; Benamar, M.; Zhang, Y.; Manigat, L.; Abbas, T.; Lee, J.; Nakano, I.; et al. Combined CDK4/6 and mTOR Inhibition Is Synergistic against Glioblastoma via Multiple Mechanisms. Clin. Cancer Res. 2017, 23, 6958–6968. [Google Scholar] [CrossRef] [PubMed]
 - Lu, Y.-J.; Chang, Y.-J.; Cheng, L.; Wei, K.-C.; Ozawa, T.; Kim, J.-S.; Waldman, T.; James, C.D. MTR-07 Glioblastoma Adaptation to Sustained Cdk4/6 Inhibition Involves Suppression of Rb Expression Through Histone H3K4 Modification. Neuro-Oncology 2015, 17, v125. [Google Scholar] [CrossRef][Green Version]
 - Schröder, L.B.W.; McDonald, K.L. CDK4/6 Inhibitor PD0332991 in Glioblastoma Treatment: Does It Have a Future? Front. Oncol. 2015, 5, 259. [Google Scholar] [CrossRef]
 - Adon, T.; Shanmugarajan, D.; Kumar, H.Y. CDK4/6 Inhibitors: A Brief Overview and Prospective Research Directions. RSC Adv. 2021, 11, 29227–29246. [Google Scholar] [CrossRef] [PubMed]
 - Hume, S.; Dianov, G.L.; Ramadan, K. A Unified Model for the G1/S Cell Cycle Transition. Nucleic Acids Res. 2020, 48, 12483–12501. [Google Scholar] [CrossRef] [PubMed]
 - Wiecek, A.J.; Cutty, S.J.; Kornai, D.; Parreno-Centeno, M.; Gourmet, L.E.; Tagliazucchi, G.M.; Jacobson, D.H.; Zhang, P.; Xiong, L.; Bond, G.L.; et al. Genomic Hallmarks and Therapeutic Implications of G0 Cell Cycle Arrest in Cancer. Genome Biol. 2023, 24, 128. [Google Scholar] [CrossRef] [PubMed]
 - Hientz, K.; Mohr, A.; Bhakta-Guha, D.; Efferth, T. The Role of P53 in Cancer Drug Resistance and Targeted Chemotherapy. Oncotarget 2016, 8, 8921–8946. [Google Scholar] [CrossRef]
 - Ahir, B.K.; Engelhard, H.H.; Lakka, S.S. Tumor Development and Angiogenesis in Adult Brain Tumor: Glioblastoma. Mol. Neurobiol. 2020, 57, 2461–2478. [Google Scholar] [CrossRef]
 - Qian, S.; Wei, Z.; Yang, W.; Huang, J.; Yang, Y.; Wang, J. The Role of BCL-2 Family Proteins in Regulating Apoptosis and Cancer Therapy. Front. Oncol. 2022, 12, 985363. [Google Scholar] [CrossRef]
 - Pellot Ortiz, K.I.; Rechberger, J.S.; Nonnenbroich, L.F.; Daniels, D.J.; Sarkaria, J.N. MDM2 Inhibition in the Treatment of Glioblastoma: From Concept to Clinical Investigation. Biomedicines 2023, 11, 1879. [Google Scholar] [CrossRef] [PubMed]
 - Tian, Y.; Gao, X.; Yang, X.; Chen, S.; Ren, Y. VEGFA Contributes to Tumor Property of Glioblastoma Cells by Promoting Differentiation of Myeloid-Derived Suppressor Cells. BMC Cancer 2024, 24, 1040. [Google Scholar] [CrossRef]
 - Singh, R.; Letai, A.; Sarosiek, K. Regulation of Apoptosis in Health and Disease: The Balancing Act of BCL-2 Family Proteins. Nat. Rev. Mol. Cell Biol. 2019, 20, 175–193. [Google Scholar] [CrossRef]
 - Weiler, M.; Bähr, O.; Hohlweg, U.; Naumann, U.; Rieger, J.; Huang, H.; Tabatabai, G.; Krell, H.W.; Ohgaki, H.; Weller, M.; et al. BCL-xL: Time-Dependent Dissociation between Modulation of Apoptosis and Invasiveness in Human Malignant Glioma Cells. Cell Death Differ. 2006, 13, 1156–1169. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Warren, C.F.A.; Wong-Brown, M.W.; Bowden, N.A. BCL-2 Family Isoforms in Apoptosis and Cancer. Cell Death Dis. 2019, 10, 1–12. [Google Scholar] [CrossRef] [PubMed]
 - Liu, H.; Li, Z.; Huo, S.; Wei, Q.; Ge, L. Induction of G0/G1 Phase Arrest and Apoptosis by CRISPR/Cas9-mediated Knockout of CDK2 in A375 Melanocytes. Mol. Clin. Oncol. 2020, 12, 9–14. [Google Scholar] [CrossRef] [PubMed]
 - Sovilj, D.; Kelemen, C.D.; Dvorakova, S.; Zobalova, R.; Raabova, H.; Kriska, J.; Hermanova, Z.; Knotek, T.; Anderova, M.; Klener, P.; et al. Cell-Specific Modulation of Mitochondrial Respiration and Metabolism by the pro-Apoptotic Bcl-2 Family Members Bax and Bak. Apoptosis 2024, 29, 424–438. [Google Scholar] [CrossRef]
 - Mohammadpour, Z.J.; Mohammadzadeh, R.; Javadrashid, D.; Baghbanzadeh, A.; Doustvandi, M.A.; Barpour, N.; Baradaran, B. Combination of SIX4-siRNA and Temozolomide Inhibits the Growth and Migration of A-172 Glioblastoma Cancer Cells. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2023, 396, 2741–2751. [Google Scholar] [CrossRef]
 - Han, M.; Kakar, M.; Li, W.; Iqbal, I.; Hu, X.; Liu, Y.; Tang, Q.; Sun, L.; Shakir, Y.; Liu, T. Targeting MDM2-P53 Interaction in Glioblastoma: Transcriptomic Analysis and Peptide-Based Inhibition Strategy. Bioorganic Chem. 2024, 150, 107620. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, Y.; Dube, C.; Gibert, M.; Cruickshanks, N.; Wang, B.; Coughlan, M.; Yang, Y.; Setiady, I.; Deveau, C.; Saoud, K.; et al. The P53 Pathway in Glioblastoma. Cancers 2018, 10, 297. [Google Scholar] [CrossRef]
 - Ludwig, K.; Kornblum, H.I. Molecular Markers in Glioma. J. Neurooncol. 2017, 134, 505–512. [Google Scholar] [CrossRef] [PubMed]
 - Laplante, M.; Sabatini, D.M. mTOR Signaling in Growth Control and Disease. Cell 2012, 149, 274–293. [Google Scholar] [CrossRef]
 - Saxton, R.A.; Sabatini, D.M. mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef] [PubMed]
 - Manning, B.D.; Toker, A. AKT/PKB Signaling: Navigating the Network. Cell 2017, 169, 381–405. [Google Scholar] [CrossRef] [PubMed]
 - Hashemi, M.; Etemad, S.; Rezaei, S.; Ziaolhagh, S.; Rajabi, R.; Rahmanian, P.; Abdi, S.; Koohpar, Z.K.; Rafiei, R.; Raei, B.; et al. Progress in Targeting PTEN/PI3K/Akt Axis in Glioblastoma Therapy: Revisiting Molecular Interactions. Biomed. Pharmacother. 2023, 158, 114204. [Google Scholar] [CrossRef] [PubMed]
 - Pearson, J.R.D.; Regad, T. Targeting Cellular Pathways in Glioblastoma Multiforme. Sig. Transduct. Target Ther. 2017, 2, 1–11. [Google Scholar] [CrossRef]
 - Mathew-Schmitt, S.; Peindl, M.; Neundorf, P.; Dandekar, G.; Metzger, M.; Nickl, V.; Appelt-Menzel, A. Blood-Tumor Barrier in Focus—Investigation of Glioblastoma-Induced Effects on the Blood-Brain Barrier. J. Neurooncol. 2024, 170, 67–77. [Google Scholar] [CrossRef] [PubMed]
 - Wang, D.; Li, H.; Zeng, T.; Chen, Q.; Huang, W.; Huang, Y.; Liao, Y.; Jiang, Q. Exosome-Transmitted ANGPTL1 Suppresses Angiogenesis in Glioblastoma by Inhibiting the VEGFA/VEGFR2/Akt/eNOS Pathway. J. Neuroimmunol. 2024, 387, 578266. [Google Scholar] [CrossRef] [PubMed]
 - Treps, L.; Perret, R.; Edmond, S.; Ricard, D.; Gavard, J. Glioblastoma Stem-like Cells Secrete the pro-Angiogenic VEGF-A Factor in Extracellular Vesicles. J. Extracell. Vesicles 2017, 6, 1359479. [Google Scholar] [CrossRef]
 - Dello Russo, C.; Cappoli, N.; Coletta, I.; Mezzogori, D.; Paciello, F.; Pozzoli, G.; Navarra, P.; Battaglia, A. The Human Microglial HMC3 Cell Line: Where Do We Stand? A Systematic Literature Review. J. Neuroinflammation 2018, 15, 259. [Google Scholar] [CrossRef]
 - Wagner, A.; Yan, Z.; Kulka, M. A Human Microglial Cell Line Expresses γ-Aminobutyric Acid (GABA) Receptors and Responds to GABA and Muscimol by Increasing Production of IL-8. Neuroglia 2023, 4, 172–187. [Google Scholar] [CrossRef]
 - Razavi, S.-M.; Lee, K.E.; Jin, B.E.; Aujla, P.S.; Gholamin, S.; Li, G. Immune Evasion Strategies of Glioblastoma. Front. Surg. 2016, 3, 11. [Google Scholar] [CrossRef]
 - Kaur, G.; Roy, B. Decoding Tumor Angiogenesis for Therapeutic Advancements: Mechanistic Insights. Biomedicines 2024, 12, 827. [Google Scholar] [CrossRef] [PubMed]
 - Celik, M.Ö.; Labuz, D.; Keye, J.; Glauben, R.; Machelska, H. IL-4 Induces M2 Macrophages to Produce Sustained Analgesia via Opioids. JCI Insight 2020, 5, e133093. [Google Scholar] [CrossRef] [PubMed]
 - Khan, F.; Pang, L.; Dunterman, M.; Lesniak, M.S.; Heimberger, A.B.; Chen, P. Macrophages and Microglia in Glioblastoma: Heterogeneity, Plasticity, and Therapy. J. Clin. Investig. 2023, 133, e163446. [Google Scholar] [CrossRef]
 - Rahaman, S.O.; Vogelbaum, M.A.; Haque, S.J. Aberrant Stat3 Signaling by Interleukin-4 in Malignant Glioma Cells: Involvement of IL-13Rα2. Cancer Res. 2005, 65, 2956–2963. [Google Scholar] [CrossRef] [PubMed]
 - Hou, M.-Z.; Chen, L.-L.; Chang, C.; Zan, J.-F.; Du, S.-M. Pharmacokinetic and Tissue Distribution Study of Eight Volatile Constituents in Rats Orally Administrated with the Essential Oil of Artemisiae Argyi Folium by GC–MS/MS. J. Chromatogr. B 2021, 1181, 122904. [Google Scholar] [CrossRef]
 - van den Berg, M.P.; Romeijn, S.G.; Verhoef, J.C.; Merkus, F.W.H.M. Serial Cerebrospinal Fluid Sampling in a Rat Model to Study Drug Uptake from the Nasal Cavity. J. Neurosci. Methods 2002, 116, 99–107. [Google Scholar] [CrossRef] [PubMed]
 - Dalpiaz, A.; Ferraro, L.; Perrone, D.; Leo, E.; Iannuccelli, V.; Pavan, B.; Paganetto, G.; Beggiato, S.; Scalia, S. Brain Uptake of a Zidovudine Prodrug after Nasal Administration of Solid Lipid Microparticles. Mol. Pharm. 2014, 11, 1550–1561. [Google Scholar] [CrossRef]
 - de Oliveira Junior, E.R.; Truzzi, E.; Ferraro, L.; Fogagnolo, M.; Pavan, B.; Beggiato, S.; Rustichelli, C.; Maretti, E.; Lima, E.M.; Leo, E.; et al. Nasal Administration of Nanoencapsulated Geraniol/Ursodeoxycholic Acid Conjugate: Towards a New Approach for the Management of Parkinson’s Disease. J. Control Release 2020, 321, 540–552. [Google Scholar] [CrossRef]
 - Felgenhauer, K. Protein Size and Cerebrospinal Fluid Composition. Klin Wochenschr. 1974, 52, 1158–1164. [Google Scholar] [CrossRef]
 - Madu, A.; Cioffe, C.; Mian, U.; Burroughs, M.; Tuomanen, E.; Mayers, M.; Schwartz, E.; Miller, M. Pharmacokinetics of Fluconazole in Cerebrospinal Fluid and Serum of Rabbits: Validation of an Animal Model Used to Measure Drug Concentrations in Cerebrospinal Fluid. Antimicrob. Agents Chemother. 1994, 38, 2111–2115. [Google Scholar] [CrossRef] [PubMed]
 - Simovic, S.; Heard, P.; Hui, H.; Song, Y.; Peddie, F.; Davey, A.K.; Lewis, A.; Rades, T.; Prestidge, C.A. Dry Hybrid Lipid−Silica Microcapsules Engineered from Submicron Lipid Droplets and Nanoparticles as a Novel Delivery System for Poorly Soluble Drugs. Mol. Pharm. 2009, 6, 861–872. [Google Scholar] [CrossRef] [PubMed]
 - Oraiopoulou, M.E.; Tzamali, E.; Tzedakis, G.; Vakis, A.; Papamatheakis, J.; Sakkalis, V. In Vitro/In Silico Study on the Role of Doubling Time Heterogeneity among Primary Glioblastoma Cell Lines. BioMed Res. Int. 2017, 2017, 8569328. [Google Scholar] [CrossRef] [PubMed]
 - Magalhães, M.; Farinha, D.; de Lima, M.C.P.; Faneca, H. Increased Gene Delivery Efficiency and Specificity of a Lipid-Based Nanosystem Incorporating a Glycolipid. Int. J. Nanomed. 2014, 9, 4979–4989. [Google Scholar] [CrossRef]
 - Franken, N.A.P.; Rodermond, H.M.; Stap, J.; Haveman, J.; van Bree, C. Clonogenic Assay of Cells in Vitro. Nat. Protoc. 2006, 1, 2315–2319. [Google Scholar] [CrossRef]
 - Magalhães, M.; Jorge, J.; Gonçalves, A.C.; Sarmento-Ribeiro, A.B.; Carvalho, R.; Figueiras, A.; Santos, A.C.; Veiga, F. miR-29b and Retinoic Acid Co-Delivery: A Promising Tool to Induce a Synergistic Antitumoral Effect in Non-Small Cell Lung Cancer Cells. Drug Deliv. Transl. Res. 2020, 10, 1367–1380. [Google Scholar] [CrossRef] [PubMed]
 - Magalhães, M.; Domínguez-Martín, E.M.; Jorge, J.; Gonçalves, A.C.; Díaz-Lanza, A.M.; Manadas, B.; Efferth, T.; Rijo, P.; Cabral, C. Parvifloron D-Based Potential Therapy for Glioblastoma: Inducing Apoptosis via the Mitochondria Dependent Pathway. Front. Pharmacol. 2022, 13, 1006832. [Google Scholar] [CrossRef] [PubMed]
 - Gonçalves, A.C.; Alves, V.; Silva, T.; Carvalho, C.; de Oliveira, C.R.; Sarmento-Ribeiro, A.B. Oxidative Stress Mediates Apoptotic Effects of Ascorbate and Dehydroascorbate in Human Myelodysplasia Cells in Vitro. Toxicol. Vitr. 2013, 27, 1542–1549. [Google Scholar] [CrossRef]
 - Ianevski, A.; Giri, A.K.; Aittokallio, T. SynergyFinder 2.0: Visual Analytics of Multi-Drug Combination Synergies. Nucleic Acids Res. 2020, 48, W488–W493. [Google Scholar] [CrossRef]
 















| Intravenous administration | Oral administration | |
| Dose (mg/kg) | 2 | 50 | 
| Bloodstream | ||
| C0 (µg/mL) | 116.7 ± 1.7 | - | 
| Cmax (µg/mL) | - | 22.53 ± 0.09 | 
| t1/2 (min) | 49.7 ± 2.0 | - | 
| Tmax (min) | - | 60 | 
| AUC (µg/mL∙min) | 6451 ± 188 | 3410 ± 59 | 
| F (%) | - | 2.14 ± 0.07 | 
| Cerebrospinal fluid (CSF) | ||
| Cmax (µg/mL) | 8.0 ± 0.8 | 0.42 ± 0.04 | 
| Tmax (min) | 30 | 90 | 
| AUC (µg/mL∙min) | 377.2 ± 30.5 | 18.8 ± 1.1 | 
| R | 0.13 ± 0.01 | 0.019 ± 0.002 | 
| Gene | Forward (5′-3′) | Reverse (5′-3′) | 
|---|---|---|
| CDK4 | AGCCGAAACGATCAAGGAT | GCTTGACTGTTCCACCACTTG | 
| BCL2 | GAGGATTGTGGCCTTCTTTGAG | AGCCTCCGTTATCCTGGATC | 
| BCL2L1 | GCCACTTACCTGAATGACCACC | AACCAGCGGTTGAAGCGTTCCT | 
| BAK1 | TTACCGCCATCAGCAGGAACAG | GGAACTCTGAGTCATAGCGTCG | 
| BAX | TCAGGATGCGTCCACCAAGAAG | TGTGTCCACGGCGGCAATCATC | 
| PTEN | TGAGTTCCCTCAGCCGTTACCT | GAGGTTTCCTCTGGTCCTGGTA | 
| TP53 | CAGCACATGACGGAGGTTGT | TCATCCAAATACTCCACACGC | 
| MDM2 | TGTTTGGCGTGCCAAGCTTCTC | CACAGATGTACCTGAGTCCGATG | 
| CASP9 | GTTTGAGGACCTTCGACCAGCT | CAACGTACCAGGAGCCACTCTT | 
| VEGFA | TGCAGATTATGCGGATCAAACC | TGCATTCACATTTGTTGTGCTGTAG | 
| GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Spigarelli, R.; Spisni, E.; Magalhães, M.; Cabral, C.; Gonçalves, A.C.; Saracino, I.M.; Botti, G.; Dalpiaz, A.; Beggiato, S.; Valerii, M.C. Clove Essential Oil as a Source of Antitumoral Compounds Capable of Crossing the Blood–Brain Barrier: A Focus on the Effects of β-Caryophyllene and Eugenol in a Glioblastoma Cell Line. Int. J. Mol. Sci. 2025, 26, 238. https://doi.org/10.3390/ijms26010238
Spigarelli R, Spisni E, Magalhães M, Cabral C, Gonçalves AC, Saracino IM, Botti G, Dalpiaz A, Beggiato S, Valerii MC. Clove Essential Oil as a Source of Antitumoral Compounds Capable of Crossing the Blood–Brain Barrier: A Focus on the Effects of β-Caryophyllene and Eugenol in a Glioblastoma Cell Line. International Journal of Molecular Sciences. 2025; 26(1):238. https://doi.org/10.3390/ijms26010238
Chicago/Turabian StyleSpigarelli, Renato, Enzo Spisni, Mariana Magalhães, Célia Cabral, Ana Cristina Gonçalves, Ilaria Maria Saracino, Giada Botti, Alessandro Dalpiaz, Sarah Beggiato, and Maria Chiara Valerii. 2025. "Clove Essential Oil as a Source of Antitumoral Compounds Capable of Crossing the Blood–Brain Barrier: A Focus on the Effects of β-Caryophyllene and Eugenol in a Glioblastoma Cell Line" International Journal of Molecular Sciences 26, no. 1: 238. https://doi.org/10.3390/ijms26010238
APA StyleSpigarelli, R., Spisni, E., Magalhães, M., Cabral, C., Gonçalves, A. C., Saracino, I. M., Botti, G., Dalpiaz, A., Beggiato, S., & Valerii, M. C. (2025). Clove Essential Oil as a Source of Antitumoral Compounds Capable of Crossing the Blood–Brain Barrier: A Focus on the Effects of β-Caryophyllene and Eugenol in a Glioblastoma Cell Line. International Journal of Molecular Sciences, 26(1), 238. https://doi.org/10.3390/ijms26010238
        
