Silicon-Mitigated Effect on Zinc-Induced Stress Conditions: Epigenetic, Morphological, and Physiological Screening of Barley Plants
Abstract
1. Introduction
2. Results
2.1. The Effects of Zn and Si Application on the Biomass of Barley Plants
2.2. The Effects of Zn and Si Application on Plant Physiological Parameters
2.2.1. Chlorophyll Content
2.2.2. Chlorophyll Fluorescence
2.3. The Effects of Zn and Si Application on the Epigenetic Response of Plants
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.1.1. Hydroponic Cultivation
4.1.2. Growing Conditions
4.2. Morphological Analysis
4.3. Physiological Analysis
4.4. Epigenetic Analysis
4.5. Methylation Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abedi, T.; Gavanji, S.; Mojiri, A. Lead and zinc uptake and toxicity in maize and their management. Plants 2022, 11, 1922. [Google Scholar] [CrossRef]
- Ghosh, S.; Majee, M. Protein l-isoAspartyl Methyltransferase (PIMT) and antioxidants in plants. In Vitamins and Hormones; Litwack, G., Ed.; Academic Press: Cambridge, MA, USA, 2023; Volume 121. [Google Scholar] [CrossRef]
- Waqas, M.A.; Kaya, C.; Riaz, A.; Farooq, M.; Nawaz, I.; Wilkes, A.; Li, Y. Potential mechanisms of abiotic stress tolerance in crop plants induced by thiourea. Front. Plant Sci. 2019, 10, 1336. [Google Scholar] [CrossRef]
- Song, A.; Li, P.; Fan, F.; Li, Z.; Liang, Y. The effect of silicon on photosynthesis and expression of its relevant genes in rice (Oryza sativa L.) under high-zinc stress. PLoS ONE 2014, 9, e113782. [Google Scholar] [CrossRef]
- Van, H.T.; Nga, L.T.Q. Effects of Zn pollution on soil: Pollution sources, impacts and solutions. Results Surf. Interfaces 2024, 17, 100360. [Google Scholar] [CrossRef]
- Vardhan, K.H.; Kumar, P.S.; Panda, R.C. A review on heavy metal pollution, toxicity and remedial measures: Current trends and future perspectives. J. Mol. Liq. 2019, 290, 111197. [Google Scholar] [CrossRef]
- Subba, P.; Mukhopadhyay, M.; Mahato, S.K.; Bhutia, K.D.; Mondal, T.K.; Ghosh, S.K. Zinc stress induces physiological, ultra-structural and biochemical changes in mandarin orange (Citrus reticulata Blanco) seedlings. Physiol. Mol. Biol. Plants. 2014, 20, 461–473. [Google Scholar] [CrossRef]
- Rout, G.R.; Das, P. Effect of metal toxicity on plant growth and metabolism: I. Zinc. In Sustainable Agriculture; Lichtfouse, E., Navarrete, M., Debaeke, P., Véronique, S., Alberola, C., Eds.; Springer: Valmont, France, 2009; pp. 873–884. [Google Scholar] [CrossRef]
- Gonmei, G.; Deb, P.; Kumar, P.; Sinha, D.; Halder, A. Zinc nutrition in banana (cv. Grand Naine) at early growth stage. Int. J. Plant Soil Sci. 2022, 34, 1648–1654. [Google Scholar] [CrossRef]
- Mukhopadhyay, M.; Das, A.; Subba, P.; Bantawa, P.; Sarkar, B.; Ghosh, P.D.; Mondal, T.K. Structural, physiological and biochemical profiling of tea plants (Camellia sinensis (L.) O. Kuntze) under zinc stress. Biol. Plant. 2013, 57, 474–480. [Google Scholar] [CrossRef]
- Kalousek, P.; Holátko, J.; Schreiber, P.; Pluháček, T.; Širůčková Lónová, K.; Radziemska, M.; Tarkowski, P.; Vyhnánek, T.; Hammerschmiedt, T.; Brtnický, M. The effect of chelating agents on the Zn-phytoextraction potential of hemp and soil microbial activity. Chem. Biol. Technol. Agric. 2024, 11, 23. [Google Scholar] [CrossRef]
- Kaur, H.; Garg, N. Zinc toxicity in plants: A review. Planta 2021, 253, 129. [Google Scholar] [CrossRef] [PubMed]
- Islam, F.; Yasmeen, T.; Riaz, M.; Arif, M.S.; Ali, S.; Raza, S.H. Proteus mirabilis alleviates zinc toxicity by preventing oxidative stress in maize (Zea mays) plants. Ecotoxicol. Environ. Saf. 2014, 110, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yang, X.; Chen, S.; Li, Q.; Wang, W.; Hou, C.; Gao, X.; Wang, L.; Wang, S. Zinc oxide nanoparticles affect biomass accumulation and photosynthesis in Arabidopsis. Front. Plant Sci. 2016, 6, 1243. [Google Scholar] [CrossRef] [PubMed]
- Ghori, N.H.; Ghori, T.; Hayat, M.Q.; Imadi, S.R.; Gul, A.; Altay, V.; Ozturk, M. Heavy metal stress and responses in plants. Int. J. Environ. Sci. Technol. 2019, 16, 1807–1828. [Google Scholar] [CrossRef]
- Huang, X.H.; Zhu, F.; Yan, W.D.; Chen, X.Y.; Wang, G.J.; Wang, R.J. Effects of Pb and Zn toxicity on chlorophyll fluorescence and biomass production of Koelreuteria paniculata and Zelkova schneideriana young plants. Photosynthetica 2019, 57, 688–697. [Google Scholar] [CrossRef]
- Balafrej, H.; Bogusz, D.; Triqui, Z.E.A.; Guedira, A.; Bendaou, N.; Smouni, A.; Fahr, M. Zinc hyperaccumulation in plants: A review. Plants 2020, 9, 562. [Google Scholar] [CrossRef] [PubMed]
- Mandzhieva, S.; Chaplygin, V.; Chernikova, N.; Fedorenko, A.; Voloshina, M.; Minkina, T.; Rajput, V.D.; Elinson, M.; Wong, M.H. Responses of spring barley to Zn− and Cd− induced stress: Morphometric analysis and cytotoxicity assay. Plants 2022, 11, 3332. [Google Scholar] [CrossRef]
- Brune, A.; Urbach, W.; Dietz, K.J. Compartmentation and transport of zinc in barley primary leaves as basic mechanisms involved in zinc tolerance. Plant Cell Environ. 1994, 17, 153–162. [Google Scholar] [CrossRef]
- Saijo, Y.; Loo, E.P.I. Plant immunity in signal integration between biotic and abiotic stress responses. New Phytol. 2020, 225, 87–104. [Google Scholar] [CrossRef] [PubMed]
- Stadnik, B.; Tobiasz-Salach, R.; Mazurek, M. Physiological and epigenetic reaction of barley (Hordeum vulgare L.) to the foliar application of silicon under soil salinity conditions. Int. J. Mol. Sci. 2022, 23, 1149. [Google Scholar] [CrossRef]
- Tobiasz-Salach, R.; Mazurek, M.; Jacek, B. Physiological, biochemical, and epigenetic reaction of maize (Zea mays L.) to cultivation in conditions of varying soil salinity and foliar application of silicon. Int. J. Mol. Sci. 2023, 24, 1141. [Google Scholar] [CrossRef] [PubMed]
- Stadnik, B.; Tobiasz-Salach, R.; Mazurek, M. Effect of silicon on oat salinity tolerance: Analysis of the epigenetic and physiological response of plants. Agriculture 2023, 13, 81. [Google Scholar] [CrossRef]
- Bhat, J.A.; Shivaraj, S.M.; Singh, P.; Navadagi, D.B.; Tripathi, D.K.; Dash, P.K.; Solanke, A.U.; Sonah, H.; Deshmukh, R. Role of silicon in mitigation of heavy metal stresses in crop plants. Plants 2019, 8, 71. [Google Scholar] [CrossRef] [PubMed]
- Vaculík, M.; Lukačová, Z.; Bokor, B.; Martinka, M.; Tripathi, D.K.; Lux, A. Alleviation mechanisms of metal (loid) stress in plants by silicon: A review. J. Exp. Bot. 2020, 71, 6744–6757. [Google Scholar] [CrossRef] [PubMed]
- Emamverdian, A.; Ding, Y.; Xie, Y.; Sangari, S. Silicon mechanisms to ameliorate heavy metal stress in plants. Biomed Res. Int. 2018, 1, 8492898. [Google Scholar] [CrossRef] [PubMed]
- Yamaji, N.; Mitatni, N.; Ma, J.F. A transporter regulating silicon distribution in rice shoots. Plant Cell 2008, 20, 1381–1389. [Google Scholar] [CrossRef]
- Anwaar, S.A.; Ali, S.; Ali, S.; Ishaque, W.; Farid, M.; Farooq, M.A.; Najeeb, U.; Abbas, F.; Sharif, M. Silicon (Si) alleviates cotton (Gossypium hirsutum L.) from zinc (Zn) toxicity stress by limiting Zn uptake and oxidative damage. Environ. Sci. Pollut. Res. 2015, 22, 3441–3450. [Google Scholar] [CrossRef]
- Zargar, S.M.; Mahajan, R.; Bhat, J.A.; Nazir, M.; Deshmukh, R. Role of silicon in plant stress tolerance: Opportunities to achieve a sustainable cropping system. 3 Biotech 2019, 9, 73. [Google Scholar] [CrossRef]
- Manivannan, N.; Shekar, B.C.; Kumaran, C.K.S.; Sathyamoorthy, R. Effect of Gd doping on structural, surface and optical properties of ZnS prepared by chemical precipitation method. Optik 2017, 136, 259–264. [Google Scholar] [CrossRef]
- Evelin, H.; Devi, T.S.; Gupta, S.; Kapoor, R. Mitigation of salinity stress in plants by arbuscular mycorrhizal symbiosis: Current understanding and new challenges. Front. Plant Sci. 2019, 10, 470. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S.; Davis, R.J. Cell signaling and stress responses. Cold Spring Harb. Perspect. Biol. 2016, 8, a006072. [Google Scholar] [CrossRef] [PubMed]
- Turgut-Kara, N.; Arikan, B.; Celik, H. Epigenetic memory and priming in plants. Genetica. 2020, 148, 47–54. [Google Scholar] [CrossRef]
- Sun, M.; Yang, Z.; Liu, L.; Duan, L. DNA Methylation in plant responses and adaption to abiotic stresses. Int. J. Mol. Sci. 2022, 23, 6910. [Google Scholar] [CrossRef]
- Ost, C.; Cao, H.X.; Nguyen, T.L.; Himmelbach, A.; Mascher, M.; Stein, N.; Humbeck, K. Drought-Stress-Related Reprogramming of Gene Expression in Barley Involves Differential Histone Modifications at ABA-Related Genes. Int. J. Mol. Sci. 2023, 24, 12065. [Google Scholar] [CrossRef]
- Bernstein, B.E.; Meissner, A.; Lander, E.S. The mammalian epigenome. Cell 2007, 128, 669–681. [Google Scholar] [CrossRef] [PubMed]
- Thiebaut, F.; Hemerly, A.S.; Ferreira, P.C. A role for epigenetic regulation in the adaptation and stress responses of non-model Plants. Front. Plant Sci. 2019, 10, 413504. [Google Scholar] [CrossRef] [PubMed]
- Law, J.A.; Jacobsen, S.E. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat. Rev. Genet. 2010, 11, 204–220. [Google Scholar] [CrossRef]
- Ali, M.; Afzal, S.; Parveen, A.; Kamran, M.; Javed, M.R.; Abbasi, G.H.; Malik, Z.; Riaz, M.; Ahmad, S.; Chattha, M.S.; et al. Silicon mediated improvement in the growth and ion homeostasis by decreasing Na+ uptake in maize (Zea mays L.) cultivars exposed to salinity stress. Plant Physiol. Biochem. 2021, 158, 208–218. [Google Scholar] [CrossRef] [PubMed]
- Kaya, C.; Tuna, A.L.; Sonmez, O.; Ince, F.; Higgs, D. Mitigation effects of silicon on maize plants grown at high zinc. J. Plant Nutr. 2009, 32, 1788–1798. [Google Scholar] [CrossRef]
- Faraz, A.; Rahmatullah; Aziz, T.; Maqsood, M.A.; Tahir, M.A.; Kanwal, S. Effect of silicon application on wheat (Triticum aestivum L.) growth under water deficiency stress. Emir. J. Food Agric. 2007, 19, 01–07. [Google Scholar] [CrossRef]
- Mustafa, T.; Sattar, A.; Sher, A.; Ul-Allah, S.; Ijaz, M.; Butt, M.; Irfan, M.; Cheema, M. Exogenous application of silicon improves the performance of wheat under terminal heat stress by triggering physio-biochemical mechanisms. Sci. Rep. 2021, 11, 23170. [Google Scholar] [CrossRef]
- Badamasi, H.; Dagari, M.S. Responses of hydroponically grown sorghum (Sorghum bicolor LM) to zinc (Zn) stress. J. Sci. Res. 2019, 4, 111–120. [Google Scholar] [CrossRef]
- Jain, R.; Srivastava, S.; Solomon, S.; Shrivastava, A.K.; Chandra, A. Impact of excess zinc on growth parameters, cell division, nutrient accumulation, photosynthetic pigments and oxidative stress of sugarcane (Saccharum spp.). Acta Physiol. Plant. 2010, 32, 979–986. [Google Scholar] [CrossRef]
- Feigl, G.; Molnár, Á.; Szőllősi, R.; Ördög, A.; Törőcsik, K.; Oláh, D.; Bodor, A.; Perei, K.; Kolbert, Z. Zinc-induced root architectural changes of rhizotron-grown B. napus correlate with a differential nitro-oxidative response. Nitric Oxide 2019, 90, 55–65. [Google Scholar] [CrossRef]
- Rastogi, A.; Yadav, S.; Hussain, S.; Kataria, S.; Hajihashemi, S.; Kumari, P.; Yang, X.; Brestic, M. Does silicon really matter for the photosynthetic machinery in plants…? Plant Physiol. Biochem. 2021, 169, 40–48. [Google Scholar] [CrossRef] [PubMed]
- Ranjan, A.; Sinha, R.; Bala, M.; Pareek, A.; Singla-Pareek, S.L.; Singh, A.K. Silicon-mediated abiotic and biotic stress mitigation in plants: Underlying mechanisms and potential for stress resilient agriculture. Plant Physiol. Biochem. 2021, 163, 15–25. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.; Awan, S.A.; Rizwan, M.; Ali, S.; Hassan, M.J.; Brestic, M.; Zhang, X.; Huang, L. Effects of silicon on heavy metal uptake at the soil-plant interphase: A review. Ecotoxicol. Environ. Saf. 2021, 222, 112510. [Google Scholar] [CrossRef]
- Frazao, J.J.; Prado, R.D.M.; de Souza Júnior, J.P.; Rossatto, D.R. Silicon changes C:N:P stoichiometry of sugarcane and its consequences for photosynthesis, biomass partitioning and plant growth. Sci. Rep. 2020, 10, 12492. [Google Scholar] [CrossRef] [PubMed]
- Ramakrishna, B.; Rao, S.S.R. Foliar application of brassinosteroids alleviates adverse effects of zinc toxicity in radish (Raphanus sativus L.) plants. Protoplasma 2015, 252, 665–677. [Google Scholar] [CrossRef]
- Paunov, M.; Koleva, L.; Vassilev, A.; Vangronsveld, J.; Goltsev, V. Effects of different metals on photosynthesis: Cadmium and zinc affect chlorophyll fluorescence in durum wheat. Int. J. Mol. Sci. 2018, 19, 787. [Google Scholar] [CrossRef] [PubMed]
- Mehta, P.; Jajoo, A.; Mathur, S.; Bharti, S. Chlorophyll a fluorescence study revealing effects of high salt stress on Photosystem II in wheat leaves. Plant Physiol Biochem. 2010, 48, 16–20. [Google Scholar] [CrossRef] [PubMed]
- Dhir, B.; Sharmila, P.; Pardha Saradhi, P.; Nasim, S.A. Physiological and antioxidant responses of Salvinia natans exposed to chromium-rich wastewater. Ecotoxicol. Environ. Saf. 2009, 72, 1790–1797. [Google Scholar] [CrossRef] [PubMed]
- Dutta, S.; Mohanty, S.; Tripathy, B.C. Role of temperature stress on chloroplast biogenesis and protein import in pea. Plant Physiol. 2009, 150, 1050–1061. [Google Scholar] [CrossRef] [PubMed]
- Mathur, S.; Jajoo, A.; Mehta, P.; Bharti, S. Analysis of elevated temperature-induced inhibition of photosystem II using chlorophyll a fluorescence induction kinetics in wheat leaves (Triticum aestivum). Plant Biol. 2011, 13, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Kalaji, H.M.; Rastogi, A.; Živčák, M.; Brestic, M.; Daszkowska-Golec, A.; Sitko, K.; Alsharafa, K.Y.; Lotfi, R.; Stypiński, P.; Samborska, I.A.; et al. Prompt chlorophyll fluorescence as a tool for crop phenotyping: An example of barley landraces exposed to various abiotic stress factors. Photosynthetica 2018, 56, 953–961. [Google Scholar] [CrossRef]
- Szczepanek, M.; Nowak, R.; Błaszczyk, K. Physiological and agronomic characteristics of alternative black barley genotypes (Hordeum vulgare var. nigricans and H. v. var. rimpaui) under different hydrothermal conditions of the growing seasons. Agriculture 2023, 13, 2033. [Google Scholar] [CrossRef]
- Kuckenberg, J.; Tartachnyk, I.; Noga, G. Temporal and spatial changes of chlorophyll fluorescence as a basis for early and precise detection of leaf rust and powdery mildew infections in wheat leaves. Precision Agric. 2009, 10, 34–44. [Google Scholar] [CrossRef]
- Kalaji, H.M.; Jajoo, A.; Oukarroum, A.; Brestic, M.; Zivcak, M.; Samborska, I.A.; Cetner, M.D.; Łukasik, I.; Goltsev, V.; Ladle, R.J. Chlorophyll a fluorescence as a tool to monitor physiological status of plants under abiotic stress conditions. Acta Physiol. Plant. 2016, 38, 102. [Google Scholar] [CrossRef]
- Ramírez, D.A.; Yactayo, W.; Gutiérrez, R.; Mares, V.; De Mendiburu, F.; Posadas, A.; Quiroz, R. Chlorophyll concentration in leaves is an indicator of potato tuber yield in water-shortage conditions. Sci. Hortic. 2014, 168, 202–209. [Google Scholar] [CrossRef]
- Boucher, N.; Carpentier, R. Hg2+, Cu2+, and Pb2+ -induced changes in Photosystem II photochemical yield and energy storage in isolated thylakoid membranes: A study using simultaneous fluorescence and photoacoustic measurements. Photosynth. Res. 1999, 59, 167–174. [Google Scholar] [CrossRef]
- Mallick, N.; Mohn, F.H. Use of chlorophyll fluorescence in metal-stress research: A case study with the green microalga Scenedesmus. Ecotoxicol. Environ. Saf. 2003, 55, 64–69. [Google Scholar] [CrossRef]
- Sandalio, L.M.; Dalurzo, H.C.; Gómez, M.; Romero-Puertas, M.C.; del Río, L.A. Cadmium-induced changes in the growth and oxidative metabolism of pea plants. J. Exp. Bot. 2001, 52, 2115–2126. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Shi, Q.; Wang, X.; Wei, M.; Yang, F.; Xu, H. Silicon supplementation ameliorated the inhibition of photosynthesis and nitrate metabolism by cadmium (Cd) toxicity in Cucumissativus L. Sci. Hortic. 2010, 123, 521–530. [Google Scholar] [CrossRef]
- Vassilev, A.; Nikolova, A.; Koleva, L.; Lidon, F. Effects of excess Zn on growth and photosynthetic performance of young bean plants. J. Phytol. 2011, 3, 58–62. [Google Scholar]
- Huang, F.; Wen, X.-H.; Cai, Y.-X.; Cai, K.-Z. Silicon-mediated enhancement of heavy metal tolerance in rice at different growth stages. Int. J. Environ. Res. Public Health 2018, 15, 2193. [Google Scholar] [CrossRef] [PubMed]
- Al-Aghabary, K.; Zhu, Z.; Shi, Q. Influence of silicon supply on chlorophyll content, chlorophyll fluorescence, and antioxidative enzyme activities in tomato plants under salt stress. J. Plant Physiol. 2004, 27, 2101–2115. [Google Scholar] [CrossRef]
- Hattori, T.; Inanaga, S.; Araki, H.; An, P.; Morita, S.; Luxová, M.; Lux, A. Application of silicon enhanced drought tolerance in sorghum bicolor. Physiol. Plant. 2005, 123, 459–466. [Google Scholar] [CrossRef]
- Marichali, A.; Dallali, S.; Ouerghemmi, S.; Sebeia, H.; Hosni, K. Germination, morpho-physiological and biochemical responses of coriander (Coriandrum sativum L.) to zinc excess. Ind. Crop Prod. 2014, 55, 248–257. [Google Scholar] [CrossRef]
- Yahaghi, Z.; Shirvani, M.; Nourbakhsh, F.; Pueyo, J.J. Uptake and effects of lead and zinc on alfalfa (Medicago sativa L.) seed germination and seedling growth: Role of plant growth promoting bacteria. S. Afr. J. Bot. 2019, 124, 573–582. [Google Scholar] [CrossRef]
- Song, A.; Li, P.; Li, Z.; Fan, F.; Nikolic, M.; Liang, Y. The alleviation of zinc toxicity by silicon is related to zinc transport and antioxidative reactions in rice. Plant and Soil 2011, 344, 319–333. [Google Scholar] [CrossRef]
- Wang, W.; Pan, Y.; Zhao, X.; Dwivedi, D.K.; Zhu, L.; Ali, J.; Fu, B.; Li, Z. Drought-induced site-specific DNA methylation and its association with drought tolerance in rice (Oryza sativa L.). J. Exp. Bot. 2011, 62, 1951–1960. [Google Scholar] [CrossRef]
- Avramova, Z. Transcriptional ‘memory’ of a stress: Transient chromatin and memory (epigenetic) marks at stress-response genes. Plant J. 2015, 83, 149–159. [Google Scholar] [CrossRef] [PubMed]
- Dorts, J.; Falisse, E.; Schoofs, E.; Flamion, E.; Kestemont, P.; Silvestre, F. DNA methyltransferases and stress-related genes expression in zebrafish larvae after exposure to heat and copper during reprogramming of DNA methylation. Sci. Rep. 2016, 6, 34254. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Liu, Y.; Xu, J.; Liu, X.; Chi, Y.; Li, R.; Mo, L.; Shi, L.; Liang, S.; Yu, W.; et al. Recent progress of molecular mechanisms of DNA methylation in plant response to abiotic stress. Environ. Exp. Bot. 2023, 218, 105599. [Google Scholar] [CrossRef]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. In Circular. California Agricultural Experiment Station; CABI: Wallingford, UK, 1950; Volume 347. [Google Scholar]
- Huang, H.; Ran, J.; Ji, M.; Wang, Z.; Dong, L.; Hu, W.; Deng, Y.; Hou, C.; Niklas, K.J.; Deng, J. Water content quantitatively affects metabolic rates over the course of plant ontogeny. New Phytol. 2020, 228, 1524–1534. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Peraza-Echeverria, S.; Herrera-Valencia, A.V.; James-Kay, A. Detection of DNA methylation changes in micropropagated banana plants using methylation-sensitive amplification polymorphism. Plant Sci. 2001, 161, 359–367. [Google Scholar] [CrossRef] [PubMed]
- Xiong, L.Z.; Xu, C.G.; Saghai Maroof, M.A.; Zhang, Q. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique. Mol. Gen. Genet. 1999, 261, 439–446. [Google Scholar] [CrossRef]
- Bassam, B.J.; Gresshoff, P.M. Silver staining DNA in polyacrylamide gels. Nature Protocols 2007, 2, 2649–2654. [Google Scholar] [CrossRef]
- Xiangqian, L.; Mingliang, X.; Schuyler, S.K. DNA methylation profiles differ between field- andin vitro-grown leaves of apple. J. Plant Physiol. 2002, 159, 1229–1234. [Google Scholar] [CrossRef]
Parameters Analyzed: | Control | 50 µM Zn | 50 µM Zn + Si | 100 µM Zn | 100 µM Zn + Si | 200 µM Zn | 200 µM Zn + Si |
---|---|---|---|---|---|---|---|
Total band number | 307 | 330 | 328 | 328 | 329 | 337 | 329 |
Number of symmetric methylation bands | 56 | 54 | 53 | 54 | 52 | 52 | 53 |
Symmetric methylation (%) | 18.2 | 16.4 | 16.2 | 16.5 | 15.8 | 15.4 | 16.1 |
Number of hemimethylation bands | 75 | 84 | 85 | 86 | 87 | 85 | 82 |
Hemimethylation bands (%) | 24.4 | 25.5 | 25.9 | 26.2 | 26.4 | 25.2 | 24.9 |
% total methylation | 42.7 | 41.8 | 42.1 | 42.7 | 42.2 | 40.7 | 41 |
Primer Name | Sequence |
---|---|
EcoRI-ACT | 5′GACTGCGTACCAATTCACT3′ |
EcoRI-AC | 5′GACTGCGTACCAATTCAC3′ |
EcoRI-AT | 5′GACTGCGTACCAATTCAT3′ |
MspI/HpaII-ATG | 5′GATGAGTCCTGAGTCGGATG3′ |
MspI/HpaII-CTA | 5′GATGAGTCCTGAGTCGGCTA3′ |
MspI/HpaII -CTC | 5′GATGAGTCCTGAGTCGGCTC3′ |
MspI/HpaII- CT | 5′GATGAGTCCTGAGTCGGCT3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mazurek, M.; Tobiasz-Salach, R.; Stadnik, B.; Migut, D. Silicon-Mitigated Effect on Zinc-Induced Stress Conditions: Epigenetic, Morphological, and Physiological Screening of Barley Plants. Int. J. Mol. Sci. 2025, 26, 104. https://doi.org/10.3390/ijms26010104
Mazurek M, Tobiasz-Salach R, Stadnik B, Migut D. Silicon-Mitigated Effect on Zinc-Induced Stress Conditions: Epigenetic, Morphological, and Physiological Screening of Barley Plants. International Journal of Molecular Sciences. 2025; 26(1):104. https://doi.org/10.3390/ijms26010104
Chicago/Turabian StyleMazurek, Marzena, Renata Tobiasz-Salach, Barbara Stadnik, and Dagmara Migut. 2025. "Silicon-Mitigated Effect on Zinc-Induced Stress Conditions: Epigenetic, Morphological, and Physiological Screening of Barley Plants" International Journal of Molecular Sciences 26, no. 1: 104. https://doi.org/10.3390/ijms26010104
APA StyleMazurek, M., Tobiasz-Salach, R., Stadnik, B., & Migut, D. (2025). Silicon-Mitigated Effect on Zinc-Induced Stress Conditions: Epigenetic, Morphological, and Physiological Screening of Barley Plants. International Journal of Molecular Sciences, 26(1), 104. https://doi.org/10.3390/ijms26010104