Fermented Corn–Soybean Meal Improved Growth Performance and Reduced Diarrhea Incidence by Modulating Intestinal Barrier Function and Gut Microbiota in Weaned Piglets
Abstract
1. Introduction
2. Results
2.1. Analysis of Substrates before and after Fermentation
2.2. Effects of Fermented Mixed Feed on Growth Performance and Nutrient Digestibility in Weaned Piglets
2.3. Effect of Fermented Mixed Feed on Intestinal Morphology in Weaned Piglets
2.4. Effects of Fermented Mixed Feed on Expression of Genes Related to Tight Junction Proteins and Inflammation in Weaned Piglets
2.5. Effects of Fermented Mixed Feed on the Short-Chain Fatty acid Levels in the Colon of Weaned Piglets
2.6. Effects of Fermented Mixed Feed on the Composition of the Colonic Microbiota in Weaned Piglets
3. Discussion
4. Materials and Methods
4.1. Preparation of Fermented Feed and Laboratory Analysis
4.2. Microbial Determinations
4.3. Animals and Experimental Design
4.4. Determination of Apparent Total-Tract Nutrient Digestibility
4.5. Sample Collection
4.6. Intestinal Morphology Analysis
4.7. Quantitative Real-Time PCR (qPCR)
4.8. Western Blot Analysis
4.9. Measurement of pH Value in the Stomach, Duodenum, Jejunum, Ileum and Colon, and Colonic SCFA Concentration Analysis
4.10. Gut microbiota Determination
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, J.; Zeng, L.; Tan, B.; Li, G.; Huang, B.; Xiong, X.; Li, F.; Kong, X.; Liu, G.; Yin, Y. Developmental changes in intercellular junctions and kv channels in the intestine of piglets during the suckling and post-weaning periods. J. Anim. Sci. Biotechnol. 2016, 7, 4. [Google Scholar] [CrossRef]
 - Pié, S.; Lallès, J.P.; Blazy, F.; Laffitte, J.; Sève, B.; Oswald, I.P. Weaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets. J. Nutr. 2004, 134, 641–647. [Google Scholar] [PubMed]
 - Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef] [PubMed]
 - Shi, C.; Zhang, Y.; Lu, Z.; Wang, Y. Solid-state fermentation of corn-soybean meal mixed feed with Bacillus subtilis and Enterococcus faecium for degrading antinutritional factors and enhancing nutritional value. J. Anim. Sci. Biotechnol. 2017, 8, 50. [Google Scholar] [CrossRef] [PubMed]
 - Yan, H.; Jin, J.Q.; Yang, P.; Yu, B.; He, J.; Mao, X.B.; Yu, J.; Chen, D.W. Fermented soybean meal increases nutrient digestibility via the improvement of intestinal function.; anti-oxidative capacity and immune function of weaned pigs. Animal 2022, 16, 100557. [Google Scholar] [CrossRef] [PubMed]
 - Yao, Y.; Li, H.; Li, J.; Zhu, B.; Gao, T. Anaerobic Solid-State Fermentation of Soybean Meal with Bacillus sp. to Improve Nutritional Quality. Front. Nutr. 2021, 8, 706977. [Google Scholar] [CrossRef]
 - Shi, C.; Zhang, Y.; Yin, Y.; Wang, C.; Lu, Z.; Wang, F.; Huang, Z.; Chen, D. Amino acid and phosphorus digestibility of fermented corn-soybean meal mixed feed with Bacillus subtilis and Enterococcus faecium fed to pigs. J. Anim. Sci. 2017, 95, 3996–4004. [Google Scholar] [CrossRef] [PubMed]
 - Le, M.H.A.; Galle, S.; Yang, Y.; Landero, J.L.; Beltranena, E.; Gänzle, M.G.; Sun, H.; Shi, B. Effects of feeding fermented wheat with Lactobacillus reuteri on gut morphology, intestinal fermentation, nutrient digestibility, and growth performance in weaned pigs. J. Anim. Sci. 2016, 94, 4677–4687. [Google Scholar] [CrossRef]
 - Hui, Y.; Tamez-Hidalgo, P.; Cieplak, T.; Satessa, G.D.; Kot, W.; Kjærulff, S.; Nielsen, M.O.; Nielsen, D.S.; Krych, L. Supplementation of a lacto-fermented rapeseed-seaweed blend promotes gut microbial- and gut immune-modulation in weaner piglets. J. Anim. Sci. Biotechnol. 2021, 12, 85. [Google Scholar] [CrossRef]
 - Yuan, L.; Chang, J.; Yin, Q.; Lu, M.; Di, Y.; Wang, P.; Wang, Z.; Wang, E.; Lu, F. Fermented soybean meal improves the growth performance, nutrient digestibility, and microbial flora in piglets. Anim. Nutr. 2017, 3, 19–24. [Google Scholar] [CrossRef]
 - Hung, D.Y.; Cheng, Y.H.; Chen, W.J.; Hua, K.F.; Pietruszka, A.; Dybus, A.; Lin, C.S.; Yu, Y.H. Bacillus licheniformis-Fermented Products Reduce Diarrhea Incidence and Alter the Fecal Microbiota Community in Weaning Piglets. Animals 2019, 9, 1145. [Google Scholar] [CrossRef]
 - Zhu, J.; Gao, M.; Zhang, R.; Sun, Z.; Wang, C.; Yang, F.; Huang, T.; Qu, S.; Zhao, L.; Li, Y.; et al. Effects of soybean meal fermented by L. plantarum, B. subtilis and S. cerevisieae on growth, immune function and intestinal morphology in weaned piglets. Microb. Cell Fact. 2017, 16, 191. [Google Scholar] [CrossRef]
 - Medic, J.; Atkinson, C.; Hurburgh, C.R. Current knowledge in soybean composition. J. Am. Oil Chem. Soc. 2014, 91, 363–384. [Google Scholar] [CrossRef]
 - Tang, J.; Li, W.; Zhou, Q.; Fang, Z.; Lin, Y.; Xu, S.; Feng, B.; Zhuo, Y.; Jiang, X.; Zhao, H.; et al. Effect of heating, microbial fermentation, and enzymatic hydrolysis of soybean meal on growth performance, nutrient digestibility, and intestinal microbiota of weaned piglets. J. Anim. Sci. 2023, 101, 384. [Google Scholar] [CrossRef]
 - Xie, Z.; Hu, L.; Li, Y.; Geng, S.; Cheng, S.; Fu, X.; Zhao, S.; Han, X. Changes of gut microbiota structure and morphology in weaned piglets treated with fresh fermented soybean meal. World. J. Microbiol. Biotechnol. 2017, 33, 213. [Google Scholar] [CrossRef]
 - Lu, J.; Zhang, X.; Liu, Y.; Cao, H.; Han, Q.; Xie, B.; Fan, L.; Li, X.; Hu, J.; Yang, G.; et al. Effect of Fermented Corn-Soybean Meal on Serum Immunity, the Expression of Genes Related to Gut Immunity, Gut Microbiota, and Bacterial Metabolites in Grower-Finisher Pigs. Front. Microbiol. 2019, 10, 2620. [Google Scholar] [CrossRef]
 - Lu, J.; Zhu, M.; Cao, H.; Zhang, X.; Wang, Z.; Zhang, X.; Li, X.; Hu, J.; Yang, G.; Shi, X. Impact of Fermented Corn-Soybean Meal on Gene Expression of Immunity in the Blood, Level of Secretory Immunoglobulin A, and Mucosa-Associated Bacterial Community in the Intestine of Grower-Finisher Pigs. Front. Vet. Sci. 2020, 7, 246. [Google Scholar] [CrossRef]
 - Canibe, N.; Jensen, B. Fermented and nonfermented liquid feed to growing pigs, effect on aspects of gastrointestinal ecology and growth performance. J. Anim. Sci. 2003, 81, 2019–2031. [Google Scholar] [CrossRef] [PubMed]
 - Medeiros, S.; Xie, J.; Dyce, P.W.; Cai, H.Y.; DeLange, K.; Zhang, H.; Li, J. Isolation of bacteria from fermented food and grass carp intestine and their efficiencies in improving nutrient value of soybean meal in solid state fermentation. J. Anim. Sci. Biotechnol. 2018, 9, 29. [Google Scholar] [CrossRef] [PubMed]
 - Ma, X.; Shang, Q.; Hu, J.; Liu, H.; Brøkner, C.; Piao, X. Effects of replacing soybean meal, soy protein concentrate, fermented soybean meal or fish meal with enzyme-treated soybean meal on growth performance, nutrient digestibility, antioxidant capacity, immunity and intestinal morphology in weaned pigs. Livest. Sci. 2019, 225, 39–46. [Google Scholar] [CrossRef]
 - Zhang, L.; Piao, X. Different dietary protein sources influence growth performance, antioxidant capacity, immunity, fecal microbiota and metabolites in weaned piglets. Anim. Nutr. 2022, 8, 71–81. [Google Scholar] [CrossRef] [PubMed]
 - Czech, A.; Grela, E.R.; Kiesz, M. Dietary fermented rapeseed or/and soybean meal additives on performance and intestinal health of piglets. Sci. Rep. 2021, 11, 16952. [Google Scholar] [CrossRef] [PubMed]
 - Varsha, K.K.; Priya, S.; Devendra, L.; Nampoothiri, K.M. Control of spoilage fungi by protective lactic acid bacteria displaying probiotic properties. Appl. Biochem. Biotechnol. 2014, 172, 3402–3413. [Google Scholar] [CrossRef] [PubMed]
 - Wang, S.; Ahmadi, S.; Nagpal, R.; Jain, S.; Mishra, S.P.; Kavanagh, K.; Zhu, X.; Wang, Z.; McClain, D.A.; Kritchevsky, S.B.; et al. Lipoteichoic acid from the cell wall of a heat killed Lactobacillus paracasei D3-5 ameliorates aging-related leaky gut, inflammation and improves physical and cognitive functions: From C. elegans to mice. Geroscience 2020, 42, 333–352. [Google Scholar] [CrossRef] [PubMed]
 - Pluske, J.R.; Hampson, D.J.; Williams, I.H. Factors influencing the structure and function of the small intestine in the weaned pig, a review. Livest. Prod. Sci. 1997, 51, 215–236. [Google Scholar] [CrossRef]
 - Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell Mol. Life Sci. 2013, 70, 631–659. [Google Scholar] [CrossRef]
 - Ji, F.J.; Wang, L.X.; Yang, H.S.; Hu, A.; Yin, Y.L. Review, the roles and functions of glutamine on intestinal health and performance of weaning pigs. Animal 2019, 13, 2727–2735. [Google Scholar] [CrossRef]
 - Su, W.; Jiang, Z.; Wang, C.; Zhang, Y.; Gong, T.; Wang, F.; Jin, M.; Wang, Y.; Lu, Z. Co-fermented defatted rice bran alters gut microbiota and improves growth performance, antioxidant capacity, immune status and intestinal permeability of finishing pigs. Anim. Nutr. 2022, 11, 413–424. [Google Scholar] [CrossRef]
 - Nicholson, J.K.; Holmes, E.; Kinross, J.; Burcelin, R.; Gibson, G.; Jia, W.; Pettersson, S. Host-gut microbiota metabolic interactions. Science 2012, 336, 1262–1267. [Google Scholar] [CrossRef]
 - Canani, R.B.; Costanzo, M.D.; Leone, L.; Pedata, M.; Meli, R.; Calignano, A. Potential beneficial effects of butyrate in intestinal and extraintestinal diseases. World J. Gastroenterol. 2011, 17, 1519–1528. [Google Scholar] [CrossRef]
 - Huang, C.; Song, P.; Fan, P.; Hou, C.; Thacker, P.; Ma, X. Dietary sodium butyrate decreases postweaning diarrhea by modulating intestinal permeability and changing the bacterial communities in weaned piglets. J. Nutr. 2015, 145, 2774–2780. [Google Scholar] [CrossRef]
 - Rist, V.T.; Weiss, E.; Eklund, M.; Mosenthin, R. Impact of dietary protein on microbiota composition and activity in the gastrointestinal tract of piglets in relation to gut health, a review. Animal 2013, 7, 1067–1078. [Google Scholar] [CrossRef]
 - Ghosh, T.S.; Arnoux, J.; O’Toole, P.W. Metagenomic analysis reveals distinct patterns of gut lactobacillus prevalence, abundance, and geographical variation in health and disease. Gut Microbes. 2020, 12, 1–19. [Google Scholar] [CrossRef] [PubMed]
 - Azad, M.; Sarker, M.; Li, T.J.; Yin, J. Probiotic species in the modulation of gut microbiota, an overview. Biomed. Res. Int. 2018, 2018, 9478630. [Google Scholar] [CrossRef]
 - Bergamaschi, M.; Tiezzi, F.; Howard, J.; Huang, Y.J.; Gray, K.A.; Schillebeeckx, C.; McNulty, N.P.; Maltecca, C. Gut microbiome composition differences among breeds impact feed efficiency in swine. Microbiome 2020, 8, 110. [Google Scholar] [CrossRef]
 - Kilkenny, C.; Browne, W.; Cuthill, I.C.; Emerson, M.; Altman, D.G. Animal research, reporting in vivo experiments, the ARRIVE guidelines. Br. J. Pharmacol. 2010, 160, 1577.e9. [Google Scholar] [CrossRef] [PubMed]
 - NRC. Nutrient Requirements of Swine, 11th ed.; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
 - AOAC. Official Methods of Analysis, 18th ed.; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2008. [Google Scholar]
 - Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
 - Wang, Z.; Zhang, X.; Zhu, L.; Yang, X.; He, F.; Wang, T.; Bao, T.; Lu, H.; Wang, H.; Yang, S. Insulin alleviates inflammation of alcoholic liver disease via SCFAs-inducing suppression of M1 and facilitation of M2 macrophages in mice. Int. Immunopharmacol. 2020, 78, 106062. [Google Scholar] [CrossRef]
 






| Item | CON | FMF-100 | p-Value | 
|---|---|---|---|
| Apparent total-tract digestibility of gross energy (%) | 90.25 ± 0.41 | 91.19 ± 0.39 | 0.13 | 
| Crude protein digestibility (%) | 97.81 ± 0.07 | 98.28 ± 0.06 | <0.01 | 
| Crude fat digestibility (%) | 87.78 ± 1.15 | 88.28 ± 1.31 | 0.78 | 
| Crude fiber digestibility (%) | 66.54 ± 6.07 | 73.90 ± 5.17 | 0.04 | 
| Item | CON | FMF-10 | FMF-50 | FMF-100 | 
|---|---|---|---|---|
| Ingredient composition, % | ||||
| Corn | 52 | 46.8 | 26 | 0 | 
| Soybean meal | 14 | 12.6 | 7 | 0 | 
| Fermented corn–soybean meal mixed feed | 0 | 6.60 | 33.00 | 66.00 | 
| Soybean hull | 3.64 | 3.64 | 3.64 | 3.64 | 
| Whey protein concentrate | 6 | 6 | 6 | 6 | 
| Low-protein whey powder | 10 | 10 | 10 | 10 | 
| Fishmeal | 4 | 4 | 4 | 4 | 
| Soybean oil | 3 | 3 | 3 | 3 | 
| Sucrose | 0.9 | 0.9 | 0.9 | 0.9 | 
| Lactose | 2.1 | 2.1 | 2.1 | 2.1 | 
| Calcium citrate | 0.3 | 0.3 | 0.3 | 0.3 | 
| Calcium hydrogen phosphate | 1.8 | 1.8 | 1.8 | 1.8 | 
| L-Lys-HCL | 0.7 | 0.7 | 0.7 | 0.7 | 
| DL-Met | 0.3 | 0.3 | 0.3 | 0.3 | 
| L-Thr | 0.34 | 0.34 | 0.34 | 0.34 | 
| L-Trp | 0.06 | 0.06 | 0.06 | 0.06 | 
| Sodium chloride | 0.2 | 0.2 | 0.2 | 0.2 | 
| Choline chloride 50% | 0.2 | 0.2 | 0.2 | 0.2 | 
| ZnO | 0.2 | 0.2 | 0.2 | 0.2 | 
| 1 Vitamin–mineral premix | 0.26 | 0.26 | 0.26 | 0.26 | 
| Total | 100 | 100 | 100 | 100 | 
| 2 Calculated nutrient levels (88% dry matter basis) | ||||
| DE, kcal/kg | 3552 | 3552 | 3552 | 3552 | 
| Ca, % | 0.79 | 0.79 | 0.79 | 0.79 | 
| CP, % | 19.77 | 19.77 | 19.77 | 19.77 | 
| SID Lys, % | 1.59 | 1.59 | 1.59 | 1.59 | 
| SID Met, % | 0.585 | 0.585 | 0.585 | 0.585 | 
| SID Thr, % | 1.023 | 1.023 | 1.023 | 1.023 | 
| SID Trp, % | 0.27 | 0.27 | 0.27 | 0.27 | 
| Available P, % | 0.55 | 0.55 | 0.55 | 0.55 | 
| Total P, % | 0.73 | 0.73 | 0.73 | 0.73 | 
| Genes | Sequences (5′–3′) | Product Size (bp)  | GenBank Accession Number | |
|---|---|---|---|---|
| TNF | Forward Reverse  | CACGCTCTTCTGCCTACTGC GTCCCTCGGCTTTGACATT  | 164 | NM_214022.1 | 
| ACTB | Forward Reverse  | CATCGTCCACCGCAAAT TGTCACCTTCACCGTTCC  | 210 | NC_010445 | 
| CLDN1 | Forward Reverse  | GATTTACTCCTACGCTGGTGAC CACAAAGATGGCTATTAGTCCC  | 199 | NM_001244539.1 | 
| OCLN | Forward Reverse  | GCACCCAGCAACGACAT CATAGACAGAATCCGAATCAC  | 144 | XM_005672525 | 
| IL10 | Forward Reverse  | GAAGCGCATCGAGGCCATTC AGGCACTCTTCACCTCCTC  | 162 | NM_214015.1 | 
| IL1B | Forward Reverse  | CTCCAGCCAGTCTTCATTGTTC TGCCTGATGCTCTTGTTCCA  | 230 | NM_214055.1 | 
| TJP1 | Forward Reverse  | AGCCCGAGGCGTGTTT AGCCCGAGGCGTGTTT  | 147 | XM_021098827.1 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiu, Y.; Tang, J.; Wang, L.; Yang, X.; Jiang, Z. Fermented Corn–Soybean Meal Improved Growth Performance and Reduced Diarrhea Incidence by Modulating Intestinal Barrier Function and Gut Microbiota in Weaned Piglets. Int. J. Mol. Sci. 2024, 25, 3199. https://doi.org/10.3390/ijms25063199
Qiu Y, Tang J, Wang L, Yang X, Jiang Z. Fermented Corn–Soybean Meal Improved Growth Performance and Reduced Diarrhea Incidence by Modulating Intestinal Barrier Function and Gut Microbiota in Weaned Piglets. International Journal of Molecular Sciences. 2024; 25(6):3199. https://doi.org/10.3390/ijms25063199
Chicago/Turabian StyleQiu, Yueqin, Jiaxi Tang, Li Wang, Xuefen Yang, and Zongyong Jiang. 2024. "Fermented Corn–Soybean Meal Improved Growth Performance and Reduced Diarrhea Incidence by Modulating Intestinal Barrier Function and Gut Microbiota in Weaned Piglets" International Journal of Molecular Sciences 25, no. 6: 3199. https://doi.org/10.3390/ijms25063199
APA StyleQiu, Y., Tang, J., Wang, L., Yang, X., & Jiang, Z. (2024). Fermented Corn–Soybean Meal Improved Growth Performance and Reduced Diarrhea Incidence by Modulating Intestinal Barrier Function and Gut Microbiota in Weaned Piglets. International Journal of Molecular Sciences, 25(6), 3199. https://doi.org/10.3390/ijms25063199
        