Next Article in Journal
The Gut–Heart Axis: Effects of Intestinal Microbiome Modulation on Cardiovascular Disease—Ready for Therapeutic Interventions?
Next Article in Special Issue
Genome-Wide Characterization and Analysis of the bHLH Gene Family in Perilla frutescens
Previous Article in Journal
Investigation of Oxidative-Stress Impact on Human Osteoblasts During Orthodontic Tooth Movement Using an In Vitro Tension Model
Previous Article in Special Issue
Genome-Wide Association Study and Marker Development for Fusarium Oxysporum Root Rot Resistance in Soybean
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses

College of Landscape Architecture and Horticulture, Southwest Forestry University, Kunming 650224, China
*
Author to whom correspondence should be addressed.
Contributed equally to this work and should be considered co-first anthors.
Int. J. Mol. Sci. 2024, 25(24), 13526; https://doi.org/10.3390/ijms252413526
Submission received: 28 November 2024 / Revised: 13 December 2024 / Accepted: 15 December 2024 / Published: 17 December 2024
(This article belongs to the Special Issue Plant Responses to Biotic and Abiotic Stresses)

Abstract

Tea plant (Camellia sinensis) is an important horticultural crop. The quality and productivity of tea plants is always threatened by various adverse environmental factors. Numerous studies have shown that intercropping tea plants with other plants can greatly improve the quality of their products. The intercropping system of Chinese chestnut (Castanea mollissima) and tea plants is an agricultural planting model in which the two species are grown on the same piece of land following a specific spacing and cultivation method. Based on a comparative transcriptome analysis between Chinese chestnut tea intercropped plantations and a pure tea plantation, it was found that the expression levels of the WRKY genes were significantly upregulated under the intercropping pattern. In this study, we cloned a candidate gene, CsWRKY48, and verified its functions in tobacco (Nicotiana tabacum) via heterologous transformation. The contents of protective enzyme activities and osmoregulatory substances were significantly increased, and the trichomes length and density were improved in the transgenic tobacco lines. This phenotype offered an enhanced resistance to both low temperatures and aphids for transgenic lines overexpressing CsWRKY48. Further analysis indicated that the CsWRKY48 transcription factor might interact with other regulators, such as CBF, ERF, MYC, and MYB, to enhance the resistance of tea plants to biotic and abiotic stresses. These findings not only confirm the elevated resistance of tea plants under intercropping, but also indicate a potential regulatory network mediated by the WRKY transcription factor.

1. Introduction

Tea plants are a well-known cash crop in the world. Tea plants are not only threatened by biotic factors such as bacteria, fungi, and pests, but also abiotic threats such as salinity, low temperatures, drought, and high temperatures during their growth [1]. When tea plants are subjected to biotic and abiotic stresses, the normal growth of the tea plants is inhibited, resulting in their death in severe cases. However, tea plants have evolved mechanisms to respond to these stresses. For example, the level of expression of relevant resistance genes in tea plants will change, the synthesis of antioxidant substances will be accelerated, the stability of the cell wall will be enhanced, and other adaptive changes to minimize the damage caused by the stress on the tea plants will occur [2,3,4]. When the threat is diminished, these response mechanisms can return to the state before the stress and continue to maintain the various life activities of the plant [5]. Transcription factors (TFs) play an important role in these response mechanisms.
WRKYs play key roles in several signaling pathways and regulatory networks critical to plant defense responses. Plants have developed complex molecular mechanisms to reduce the harmful effects of cold temperatures and insect attacks, which involve processes that control the expression of stress-response-related genes [6]. They bind specifically to W-box (T) TGACC (A/T) sequences in the promoter regions of target genes, regulating their expression [7,8,9]. For instance, OsWRKY76 significantly increased cold resistance in rice, and this cold resistance decreased when OsWRKY76 was knocked out [10]. When Acer truncatum was exposed to low-temperature stress, all AtWRKY transcription factors were upregulated [11]. Similarly, VvWRKY28 in grape improved low-temperature stress tolerance in Arabidopsis thaliana through heterologous genetic transformation [12]. Genome-wide association analyses and forward genetics studies identified WRKY as a factor that increases resistance to sugarcane aphid (Melanaphis sacchari) in Sorghum bicolor [13]. In chrysanthemum, CmWRKY42 expression was significantly upregulated under salinity, low temperatures, and aphid stress [14]. These studies demonstrate the crucial role of WRKY TFs in plant resistance to both biotic and abiotic stresses.
Intercropping could make the best use of land resources and increase yields and income per unit area. It could make more effective use of natural resources such as light energy, water, and nutrients, and improve the efficiency of resource use. Different crops have different resource requirements in the growing process, and intercropping could lead to a more reasonable distribution and utilization of these resources, thus reducing the waste of resources [15]. By planting multiple crops, intercropping could reduce the economic risks brought about by single-crop disasters or market fluctuations. If one crop suffered a reduction in production or loss of sales due to weather, pests, diseases, or changes in market demand, the other crops might still be able to maintain good yields and marketability, thus stabilizing economic income [16,17]. Chinese chestnut tea intercropped tea plantations are the most typical tea plant intercropping mode. With a tea plant light saturation point of 30,000–50,000 LX, compared with pure tea plantations, Chinese chestnut tea intercropped tea plantations could significantly improve the photosynthetic capacity of tea plantations to prevent the occurrence of the ‘midday depression of photosynthesis’ phenomenon. Chinese chestnut tea intercropped tea plantations could also provide tea plantations with the appropriate shade, so the ecological environment of the tea plantation is more conducive to growth. The appropriate temperature for the growth of tea plants is 20–30 °C, and when the ambient temperature is higher than 30 °C, the growth rate of tea plants will be significantly slowed down. Tea plants intercropped with Chinese chestnut can control the appropriate temperature for the growth of tea plants between 20 and 30 °C. In the spring, due to shade provided by Chinese chestnut plants, the wind speed in the tea plantation will be reduced, reducing the heat exchange. In summer, the shading of Chinese chestnut plants effectively reduces the net radiation of Chinese chestnut tea intercropped tea plantations, preventing the adverse effects of high temperatures on tea plants. In winter, the cover of fallen Chinese chestnut leaves will effectively reduce the heat exchange between surface long-wave radiation and soil air, which is beneficial for soil insulation [18]. In this study, we identified a gene whose expression was significantly induced, CsWRKY48, from the transcriptomic data of tea plants intercropped with Chinese chestnut vs. pure tea plantations [19]. We analyzed the expression patterns of CsWRKY48. To further understand the function of CsWRKY48, we took low-temperature (4 °C) and aphids stresses as examples to explore the role of CsWRKY48 in the regulation of tea plant resistance to biological and abiotic stresses. This research will not only enrich the understanding of the molecular regulation mechanism of the WRKY gene family but also provide useful information for further exploring the function and regulatory mechanism of the CsWRKY48 gene under biological and abiotic stresses in Camellia sinensis.

2. Results

2.1. qPCR Analysis of WRKY48 Transcription Factors

The expression of WRKY48 showed an initial increase followed by a decrease when subjected to low-temperature treatment. WRKY48 reached its peak expression at 1 h of low-temperature treatment, which was 2.32 folds higher than at 0 h. These data suggest that WRKY48 responds to low-temperature stress (Figure 1a).
After treatment with various hormones, PEG, and NaCl, the expression of WRKY48 was significantly higher compared to water treatment. The highest expression levels of WRKY48 were observed following the GA3, PEG, and NaCl treatments, showing 5.74, 5.68, and 6.13 folds greater expression than the water treatment (Figure 1b).

2.2. Gene Cloning and Sequence Analysis

WRKY48 was cloned from tea plants intercropped with Chinese chestnut. Multiple sequence alignment and phylogenetic analysis revealed a high similarity between this gene and WRKY TFs in Theaceae, leading to its designation as CsWRKY48 (Figure 2a). CsWRKY48 spanned 960 bp and contained an open reading frame encoding 317 amino acids. Sequence comparison of CsWRKY48 with Arabidopsis WRKY proteins revealed that CsWRKY48 contained a typical WRKYGQK domain (Figure 2b).

2.3. Genetic Transformation in Tobacco and Screening of Transgenic Tobacco Lines

Tobacco leaves were infiltrated with Agrobacterium tumefaciens containing the pCAMBIA1300-CsWRKY48 overexpression vector, which induced resistant buds on MS3 media with hygromycin. These buds, upon reaching 1–2 cm in size, were transferred to MS4 media for seedling strengthening. Once the seedlings grew to 3–5 cm, they were moved to MS5 media for rooting and further plant development. qRT-PCR analysis revealed a transgenic efficiency of 95%.
Twenty T1 tobacco lines were obtained, and their seeds were collected and sown to produce twenty T2 transgenic lines. DNA from the transgenic tobacco was used as a template for PCR, with primers designed for the hygromycin transferase gene. Ten positive lines were identified through PCR screening. Comparative analysis with the control tobacco plants revealed the following three high-expression lines: CsWRKY48-OE4, CsWRKY48-OE16, and CsWRKY48-OE40, with expression levels that were 997.67, 1350.74, and 1473.32 folds higher, respectively (Figure 3a–h).

2.4. Phenotype Observation of the CsWRKY48 Transgenic Lines

An analysis of the stem trichomes in the transgenic tobacco showed that they had more numerous and longer trichomes compared to the control plants (Figure 3i–l). Electron microscopy of freehand sections revealed that the control plants had approximately 10 trichomes per field of view (20×), with lengths ranging from 0.54 to 1.31 mm and an average length of 0.79 mm. In contrast, the transgenic plants exhibited 20–30 trichomes, with lengths ranging from 2.23 to 3.21 mm and an average length of about 2.72 mm. This resulted in trichome lengths and densities that were three folds higher than those of the control tobacco plants (Figure 3m–p). These increases in trichome length and density suggest an improved ability of transgenic tobacco to resist cold and sucking insects.

2.5. Phenotypic Analysis of Transgenic Tobacco After Low-Temperature Treatment and Aphid Feeding

The average height of the transgenic and control tobacco plants was 42.35 cm, the leaf width was 11.27 cm, and the leaf length was 17.61 cm. No significant differences were observed in plant height, leaf length, or leaf width between the transgenic and control tobacco plants. However, the control tobacco plants showed slight wilting and yellowing after 12 h of exposure to low temperatures (Figure 4a), while the transgenic tobacco plants remained upright (Figure 4b–d). After 24 h of low-temperature treatment, the wilting and yellowing of the control tobacco plants increased further (Figure 4e), whereas the transgenic tobacco plants remained upright, except for a slight yellowing of the leaves (Figure 4f–h). There were sagging leaf margins and a pronounced yellowing of the control tobacco leaves after 12 h of aphid feeding (Figure 4i–k). However, there were no obvious differences in the transgenic tobacco after compared to before aphid feeding (Figure 4l–n).

2.6. Cold Resistance Analysis of CsWRKY48 Overexpressing Tobacco Plants

After treatment at 4 °C, the relative conductivity of the three transgenic tobacco lines were lower than before the treatment and significantly lower than that of the control plants. After 6 h of exposure to 4 °C, the relative conductivities of CsWRKY48-OE4 and CsWRKY48-OE16 reached their lowest values, which were 0.74 and 0.72 folds lower than before treatment, respectively. After 12 h, the relative conductivity of CsWRKY48-OE40 reached its lowest value, 0.72 folds lower than before treatment (Figure 5a). The malondialdehyde (MDA) content in the three transgenic lines was also lower than before treatment and significantly lower than that in the control tobacco plants. The MDA levels in the transgenic plants initially increased with treatment time and then decreased (Figure 5b).
The soluble protein content in the transgenic plants increased by an average of 1.87, 1.05, and 1.23 folds (Figure 5c); the soluble sugar content by 1.82, 1.71, and 1.78 folds (Figure 5d); and the free proline content by 1.04, 1.15, and 1.21 folds. After treatment at 4 °C, the levels of soluble protein, soluble sugar, and free proline in all three transgenic lines were higher than at 0 h and significantly higher than in the control tobacco plants, indicating a greater cold tolerance in the CsWRKY48 transgenic tobacco compared to the control tobacco plant (Figure 5e).
Following 4 °C treatment, the transgenic lines also exhibited notable increases in the POD (Peroxidase), SOD (Superoxide Dismutase), and CAT (Catalase) activities. Specifically, the POD activity increased by 1.17, 1.14, and 1.01 folds (Figure 5f); the SOD activity by 1.15, 1.08, and 1.14 folds (Figure 5g); and the CAT activity by 1.13, 0.88, and 1.19 folds (Figure 5h). These enzyme activities followed the pattern of an initial increase followed by a decrease and were significantly higher than at 0 h and in the control tobacco plants, further suggesting an enhanced cold tolerance in the CsWRKY48 transgenic lines.
Moreover, after 4 °C treatment, the relative expression of the cold resistance genes NtCBF1 and NtDREB2B significantly increased compared to both 0 h and the control tobacco plants (Figure 5i,j). CsWRKY48 significantly elevated the expression of cold-resistant genes, thereby improving the low-temperature tolerance of the plants.

2.7. Insect Resistance Analysis of CsWRKY48-Overexpressing Tobacco Plants

Following aphid feeding, the relative conductivity of the three transgenic tobacco lines decreased compared to 0 h and were significantly lower than that of the control tobacco plants. After 6 h of aphid feeding, the relative conductivities of CsWRKY48-OE4, CsWRKY48-OE16, and CsWRKY48-OE40 reached their peak values, which were 1.63, 1.12, and 1.16 folds higher than that before feeding, respectively (Figure 6a). The MDA content in the three transgenic lines was lower than that before feeding and significantly lower than that in the control tobacco plants. The MDA levels initially increased with treatment and then decreased; after 24 h of aphid feeding, the MDA content reached its lowest values, which were 0.65, 0.69, and 0.58 folds lower than that before feeding, respectively (Figure 6b).
The soluble protein content in the transgenic lines increased by 0.65, 0.76, and 0.77 folds on average (Figure 6c), while the soluble sugar content increased by 1.64, 1.02, and 1.26 folds (Figure 6d), and the free proline content by 1.18, 1.39, and 1.08 folds (Figure 6e). After aphid feeding, the levels of soluble proteins, soluble sugars, and free proline in all three transgenic tobacco lines were higher than before feeding and significantly higher than in the control plants, indicating a stronger insect tolerance in the CsWRKY48 transgenic lines compared to the control tobacco plant.
The transgenic tobacco also showed notable increases in POD, SOD, and CAT activities following aphid feeding. These enzyme activities followed an increasing and then decreasing trend. The POD activity increased by 1.01, 1.05, and 1.02 folds on average (Figure 6f), the SOD activity by 0.81, 1.13, and 1.21 folds (Figure 6g), and the CAT activity by 1.02, 1.16, and 1.03 folds (Figure 6h). These activities were significantly higher than before feeding and in the control tobacco plants, indicating an enhanced insect tolerance in the CsWRKY48 transgenic lines.
Moreover, after aphid feeding, the relative expression of two insect resistance genes, NtTD and NtChia, significantly increased compared to pre-treatment levels and the control tobacco plant (Figure 6i,j). This suggested that CsWRKY48 promoted the expression of insect resistance genes, improving the plants’ ability to resist insect attacks.

2.8. CsWRKY48 TF Promoter Analysis

The CsWRKY48 promoter was cloned, and the full length of the promoter sequence was 2037 bp. The promoter sequence of CsWRKY48 contained various core cis-elements, with notable action elements involved in the plant growth regulator response and stress resistance response. The plant growth regulator response elements included the ethylene response element EBOXBNNAPA; ABA response elements such as MYB1AT and MYBCORE; and the GA response element MYBGAHV. The resistance stress response elements included the flooding response element MYBCORE; the cold response elements CRTDREHVCBF2; and the drought response element MYCTRD22 (Figure 7a).
Similarly, the transcription factors capable of binding to these cis-elements were also found in the transcriptome data from the Chinese chestnut tea intercropped plantation. A total of 13 ERFs, 13 MYBs, 17 bHLHs, 12 bZIPs, 2 MYCs, 3 CBFs, and 2 DREBs were identified, among them, CsERF109, CsMYB73, CsDREB2A, CsbHLH147, CsChia1, CsbZIP53, and CsMYC2 showed the most significant differences in expression, which were 2.24, 1.39, 1.91, 1.86, 2.54, 1.15, and 1.28 folds higher than those of the pure tea plantation; however, the expression levels of CsERF4, CsCBF1, CsMYB12, CsbHLH14, and CsbZIP16 in the pure tea plantation were 1.12, 4.88, 1.58, 1.32, and 1.12 folds higher than those in the Chinese chestnut tea intercropped plantation (Figure 7b–h). In addition, there were significant changes in some functional genes from the transcriptomic data of tea plants intercropped with Chinese chestnut vs. pure tea plantations including CsChia1/2/4/5 (Figure 7i) and CsGSTU8/23/45 [19]. These differences in expression provide a clearer explanation for improving the resistance of tea plants in the Chinese chestnut tea intercropped plantations compared to those in pure tea plantations.

3. Materials and Methods

3.1. Plant Materials

Tender leaves (the second leaves from the top) from C. sinensis ‘Yunkang No.10’ grown in Chinese chestnut tea intercropped plantations in Kunming were promptly frozen in liquid nitrogen and stored at −80 °C. Due to the lack of an efficient homologous transformation system in C. sinensis, tobacco was used as the model plant for heterologous genetic transformation.

3.2. Plant Growth Conditions

The Chinese chestnut tea intercropped tea plantations were located in the botanical garden of Southwest Forestry University, Kunming, Yunnan Province, with a soil pH of 5.0–5.5. Tobacco plants were cultivated in a tissue culture room maintained at a constant 25 °C, with a daily light exposure of 10–12 h and a humidity range of 65–75%.
A total of six different culture media were used in this study. YEB 1 (for Agrobacterium tumefaciens liquid medium), consisting of YEB + 100 mg/L Rif (Rifampin) + 100 mg/L Kan (Kanamycin) + 6.5 g/L Agar, and YEB 2, consisting of YEB + 100 mg/L Rif + 100 mg/L Kan, were used for spreading and shaking the bacteria during the transformation step. MS (Murashige and Skoog) medium was used at different stages, as follows: MS 1 (3% MS + 6.5 g/L Agar + 30 g/L sucrose) was employed for infection during genetic transformation. MS 2 (3% MS + 2.25 mg/L 6-BA (6-Benzylaminopurine) + 0.3 mg/L NAA (Naphthaleneacetic acid) + 6.5 g/L Agar) was applied in the genetic transformation process. MS 3 (3% MS + 2.25 mg/L 6-BA + 0.3 mg/L NAA + 20 mg/L Hyg (Hygromycin) + 400 mg/L Cef (Cephalosporin) + 6.5 g/L Agar) was used for the preliminary screening of transformants. Finally, MS 4 (3% MS + 0.1 mg/L 6-BA + 0.1 mg/L NAA + 20 mg/L Hyg + 400 mg/L Cef + 6.5 g/L Agar) was utilized for the rooting culture of transgenic tobacco.

3.3. Expression of WRKY48 Under Low Temperatures, Different Plant Growth Regulators, PEG, and NaCl

The differential expression of the WRKY48 gene was analyzed from the transcriptome data of Chinese chestnut tea intercropped plantations and pure tea plantations. qPCR primers for the WRKY48 and Actin genes were designed using NCBI Primer-BLAST and synthesized by Sangon Biotech (Shanghai, China). The relative expression levels of WRKY48 were quantified using the 2−ΔΔct method under the treatments of a low temperature (4 °C), different plant growth regulators, including MJ (methyl jasmonate), SA (methyl jasmonate), GA3 (gibberellin A3), ETH (ethylene), and ABA (abscisic acid), PEG (Polyethylene glycol), and NaCl. Cold resistance analysis was performed by exposing the tea plant leaves to 4 °C for different durations of 0 h, 30 min, 1 h, 2 h, 4 h, and 8 h.

3.4. The CsWRKY48 Gene Cloning

RNA was extracted following the protocol provided in the RNA extraction kit (Magen Biotech, Guangzhou, China). Specific cloning primers, P1-F and P1-R, were designed using the NCBI online platform. The cDNA, generated from reverse transcription, served as the template for amplifying the full-length sequence of CsWRKY48. The RT-PCR conditions were set as follows: 5 min at 94 °C (one cycle), 30 s at 94 °C (35 cycles), 30 s at 55 °C (35 cycles), 1 min at 72 °C (35 cycles), followed by 10 min at 72 °C (one cycle) and 10 min at 10 °C (one cycle) for a 50 μL reaction buffer. A gel recovery kit was used to purify the desired bands (Tiangen Biotech, Beijing, China). The target band was ligated into a cloning vector and transformed into E. coli receptor cells.

3.5. The CsWRKY48 Gene Promoter Cloning and Sequence Analysis

DNA was extracted from the tea plant leaves using the TIANGEN DNA Secure Plant Kit (Tiangen Biotech, Beijing, China), and the extracted DNA was evaluated via 1.0% agarose gel electrophoresis. Specific cloning primers, P11-F: GGCGTACCTCCAGCATCTAA and P11-R: GCTTGTAATTGGCTGACCTCC, were designed through NCBI’s online platform to amplify the target fragment using diluted DNA as the template in a PCR amplification system. The PCR products were analyzed by electrophoresis, and the desired bands were purified using a gel DNA recovery kit (TAKARATM Gel DNA Recovery Kit). The target band was then ligated into a cloning vector and transformed into E. coli receptor cells. Positive colonies were sequenced, and the obtained sequence, named CsWRKY48pro, was analyzed using New Place for promoter action elements.

3.6. Over Expression Vector Construction, Plant Transformation of CsWRKY48, and Identification of Transgenic Lines

The BamHI and PstI restriction enzymes were used to target specific genes, followed by linearization of the cloning vectors via agarose gel electrophoresis, gel cutting, and DNA recovery (TAKARATM Gel DNA Recovery Kit). The resulting cleaved product was purified using a DNA purification kit. The target fragment was then ligated into the pCAMBIA1300-35S vector and transformed into E. coli for positive clone screening and sequencing. The extracted plasmids were introduced into Agrobacterium tumefaciens GV3101.
Tobacco leaf discs (0.5 cm * 0.5 cm) were incubated for 10 min in Agrobacterium-infused MS1 media. After infection, the surface sap was removed from the leaves, which were placed dorsal side up on MS2 media for co-culturing in the dark. After 48 h on MS2 media, the leaves were transferred, dorsal side down, onto MS3 media to induce resistant buds and screen cultures. Once the resistant buds reached 1–2 cm in length, they were transferred to MS4 media. Upon reaching a consistent height of 3–5 cm, the plants were moved to MS5 media for rooting. DNA was extracted from the transgenic tobacco, and primers for hygromycin transferase and CsWRKY48 genes were designed for the PCR screening of positive lines. All positive lines were further analyzed for gene expression via qPCR to identify those with higher expression levels. The empty vector pCAMBIA1300-35S was also transformed into tobacco plants as a control.

3.7. Observations on the Phenotype of Transgenic Tobacco

The length and density of tobacco trichomes were observed using the freehand slicing method and examined with an electron microscope (LEICA DM2500).

3.8. Low-Temperature Stress in Transgenic Tobacco

Six-week-old T2 generation control tobacco plants and transgenic tobacco seedlings with a uniform growth were subjected to 4 °C in a constant light incubator for 0, 2, 6, 12, and 24 h. Three biological replicates were performed for each line. After low-temperature treatment, the tobacco phenotypes were assessed, and the leaves were stored at −80 °C for further analysis.

3.9. Aphid Feeding Stress in Transgenic Tobacco

Six-week-old T2 generation control tobacco plants and transgenic tobacco seedlings with a uniform growth were selected. Twenty-four instar aphid larvae were placed on the second mature leaf from the top to feed for durations of 0, 2, 6, 12, and 24 h. Three biological replicates were conducted for each line. The tobacco phenotypes were observed, and combined samples from the 3rd and 4th leaves (from the top) were collected and stored at −80 °C for further analysis.

3.10. Determination of Physiological and Biochemical Indices of Transgenic Tobacco

The soluble protein content was measured using the Coomassie Brilliant Blue G-250 method, the soluble sugar content was determined via Anthrone Colorimetry, and the malondialdehyde content was assessed through Thiobarbituric Acid Colorimetry. The free proline content was measured using the acid ninhydrin method. The CAT (Catalase), POD (peroxidase), and SOD (superoxide dismutase) activities were detected using the UV absorption, Guaiacol, and Riboflavin NBT methods, respectively. Each parameter was tested three times, and the average values were recorded.

3.11. Expression Analysis of Stress-Related Genes in Transgenic Tobacco

qRT-PCR primers for the tobacco cold resistance genes NtCBF1 and NtDREB2B, as well as the insect resistance genes NtChiA and NtTD (Table 1), were designed and synthesized by Sangon Biotech (Shanghai, China). RNA extracted from the tobacco leaves subjected to low-temperature and aphid feeding stress was quality checked, reverse-transcribed into cDNA, and then used for qRT-PCR. The expression levels of cold and insect resistance genes in the stress-treated control and transgenic tobacco plants were analyzed.

3.12. Statistical Analysis and Graphing of Data

The data were processed, analyzed, and visualized using IBM SPSS Statistics 22.0, GraphPad Prism 9, Adobe Illustrator 2023, and Photoshop 2023. Duncan’s multiple range test was employed to examine significant differences between groups, and one-way ANOVA was used for multiple comparisons. All data were presented as mean ± standard error of the mean. A p < 0.05 was considered to be statistically significant.

4. Discussion

4.1. Effects of Trichomes on Plant Stress Resistance

Trichomes play a crucial protective role in plants. This study demonstrated that transgenic tobacco exhibited both an increased trichome density and length compared to the control tobacco plants. These specialized epidermal structures were essential for plant defense against insects and pathogens, as well as for an enhanced resistance to freezing and other environmental stress. For example, in Artemisia annua, glandular secreting trichomes (GSTs) were regulated by specific WRKY TFs, such as AaGSW2, which influenced trichome germination. When AaGSW2 was knocked out, trichome formation was affected [25]. Similarly, transcriptome data from tomato trichomes showed that transcription factors like MYC, bHLH, and WRKY could activate the Solanum lycopersicum terpene synthase promoter, promoting trichome growth [26,27,28]. The heterologous expression of GhWRKY53 (Gossypium hirsutum) in Arabidopsis thaliana also significantly increased trichome density [29]. A trichome transcriptome database was established with a total of 27,195 alleles, including 743 annotated TFs. Among these, MYC, bHLH, and WRKY were shown to transiently transactivate S. lycopersicum terpene synthase promoters in Nicotiana benthamiana leaves, promoting trichome formation [30]. Previous studies have highlighted the importance of MYC and bHLH in trichome development, and their cis-elements were identified in the CsWRKY48 promoter sequence. In the transcriptome data of tea plants from the Chinese chestnut tea intercropped plantations, the expression of MYC and bHLH were significantly higher than that of tea plants from the pure tea plantation. This suggested that CsWRKY48 may have interacted with MYC and bHLH to co-regulate trichome growth, which should be verified in future studies. The role of trichomes as an important component of plant defense against insects and pathogens is obvious. However, whether this defense mechanism is specific or has a broad defense effect needs to be supported by more experimental data.

4.2. Regulation of CsWRKY48 Gene by Hormone Crosstalks

The CsWRKY48 gene responded to various plant growth regulators. In this study, its expression significantly increased in transgenic tobacco following treatments with MJ, ABA, ETH, GA3, and SA. The promoter of CsWRKY48 contained several cis-acting elements responsive to these hormones, including GA3-responsive elements (TAACAAAA-motif), JA-responsive elements (AACGTG-motif), and ABA-responsive elements (VAACCA-motif, ACACNNG-motif). This suggests crosstalk between the CsWRKY48 gene and MJ, IAA, ETH, GA3, and SA pathways. Previous research supports the role of WRKY genes in hormone signaling and stress response. For example, Eucalyptus grandis (EgWRKYs) genes displayed diverse expression profiles under salt and cold stress, as well as hormone treatments (SA, JA, and BR), indicating their involvement in plant development and abiotic stress responses [31]. Eighty-four IbWRKY genes were identified in sweet potato (Ipomoea batatas) and classified into three major categories (I, II, and III), which showed different expression profiles under abiotic stresses (NaCl, PEG, heat, and cold) and hormonal treatments (ABA, ACC, JA, and SA) [32]. In Caragana korshinskii, CkWRKYs engage in crosstalk with ABA to enhance resistance to abiotic stress [33]. Similarly, in Glycyrrhiza glabra, GgWRKY15 and GgWRKY59 interacted with GA3 to enhance resistance to both biotic and abiotic stress [34]. In rice, SA interacted with OsWRKY45 and promoted its expression to improve resistance to the white-backed planthopper [35]. Based on these findings, it is hypothesized that hormones such as SA, MJ, ABA, and GA3 play important roles in regulating plant resistance to biotic and abiotic stresses. When plants were subjected to adversity stress, enzymes and hormones in the plant were altered to affect a series of physiological activities or biochemical changes to produce adaptations to resist the stress. The interactions between transcription factors and phytohormones form complex signal networks that are linked by certain common components. In this study, we found that WRKY48 responded to the induction of GA3, ETH, ABA, and other plant growth regulators, and we also found elements in the promoter region of WRKY48 that responded to these plant growth regulators, and we think that these hormones might work together with WRKY48 to form a regulatory network to increase the resistance of tea plants to biotic and abiotic stresses. However, the interactions between transcription factors and hormones were intricate, and the pathways through which they enhance plant resistance need to be further identified.

4.3. CsWRKY48 Enhancement of Cold and Insect Resistance in Plants via NtCBF1, NtDREB2B, NtChiA, NtTD, etc.

Cold and insect stress can significantly hinder plant growth and development. Identifying the genes involved in cold and insect resistance and understanding their molecular functions are essential for improving plant breeding for increased tolerance. Numerous studies have demonstrated that WRKY plays a crucial role in improving plant resistance and supporting plant growth and development. For example, in Zea mays, ZmWRKY significantly improved maize resistance to Ostrinia furnacalis [36]. In Arabidopsis, WRKY, MYB, ERF, bHLH, and bZIP were vital for stress-specific defense responses during aphid and Pseudomonas syringae attacks. In Populus euramericana, the overexpression of PeWRKY31 increased salt tolerance and insect resistance in transgenic tobacco [37]. Additionally, the overexpression of PmWRKY57 in Arabidopsis led to the upregulation of cold-responsive genes such as AtCOR6.6, AtCOR47, AtKIN1, and AtRCI2A, improving cold resistance [38]. In banana, the application of ABA induced the expression of MaWRKYs and increased endogenous ABA levels, which improved cold resistance [39]. Similarly, in rice, OsWRKY76 interacted with OsbHLH148 to transactivate the expression of OsDREB2B, thereby improving cold tolerance [10]. CsWRKY48 directly binds to the W-box elements in the promoter of CsGSTU8 and activates its expression, thereby increasing the drought tolerance of the tea plant [40]. CsGSTU45 was differentially expressed in the Chinese chestnut tea intercropped transcriptome data, similar to drought tolerance, and we inferred that CsWRKY48 regulated CsGSTU45, which should be verified in future studies. This study demonstrated that the expression of cold resistance genes (NtCBF1 and NtDREB2B) and insect resistance genes (NtChiA and NtTD) was significantly upregulated in tobacco overexpressing the CsWRKY48 gene. Tea plants might defend themselves against biotic or abiotic stresses through crosstalk in hormonal networks, as well as interactions between transcription factors. Combined with previous studies, we identified binding sites for transcription factors such as MYB, ERF, and MYC in the promoter of CsWRKY48. We supposed that CsWRKY48 might be affected by endogenous plant growth regulators, as well as upstream transcription factors, to activate the expression of cold and insect resistance genes, such as NtCBF1, NtDREB2B, NtChiA, and NtTD, as a means of enhancing tea plant resilience.

5. Conclusions

In this study, we demonstrated that CsWRKY48 significantly increased tea plants resistance to biotic and abiotic stresses in Chinese chestnut tea intercropped plantations. In this environment, changes in light exposure and allelopathic interactions may influence the hormonal levels in tea plants, triggering the activation of the CsWRKY48 gene. This activation is mediated by the interaction of the CsWRKY48 promoter with transcription factors such as MYB, MYC, bHLH, and ERF (Figure 8). CsWRKY48 induced the upregulation of cold resistance genes like CsCBF and CsDREB, as well as insect resistance genes like CsChiA, which contributed to the overall plant health in Chinese chestnut tea intercropped plantation. Moreover, CsWRKY48 affected trichome length and density, further improving resistance to cold and insects while increasing the fragrance of tea plants. Future research should focus on revealing how CsWRKY48 interacts with plant growth regulators and transcription factors, such as MYB, MYC, bHLH, and ERF, to boost cold and insect resistance in tea plants. Understanding these interactions will be vital for uncovering the mechanisms that improve plant resilience in Chinese chestnut tea intercropped systems.

Author Contributions

J.W. worked with Y.G. to complete the heterogenetic transformation of tobacco; J.W. completed the cold resistance analysis of transgenic tobacco; Y.G. completed the aphid resistance analysis of transgenic tobacco. T.W. designed the experiments and modified the manuscript. M.L. and Y.B. finished collating the data. In addition, all authors provided critical feedback and helped shape the research, analysis, and manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The author(s) declare that financial support was received for the research, authorship, and publication of this article. This research was funded by the Joint Special Project of Yunnan Province for Agricultural Basic Research (202301BD070001-242), Technology Talent and Platform Plan (202305AF150058), and Yunnan Key Laboratory of Tea Germplasm Conservation and Utilization in the Lancang River Basin (202449CE340010).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, C.; Yu, W.; Xu, X.; Wang, Y.; Wang, B.; Xu, S.; Lan, Q.; Wang, Y. Research advancements in salt tolerance of cucurbitaceae: From salt response to molecular mechanisms. Int. J. Mol. Sci. 2024, 25, 9051. [Google Scholar] [CrossRef] [PubMed]
  2. Waadt, R.; Seller, C.A.; Hsu, P.K.; Takahashi, Y.; Munemasa, S.; Schroeder, J.I. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 680–694. [Google Scholar] [CrossRef] [PubMed]
  3. Wang, H.; Ye, T.; Guo, Z.; Yao, Y.; Tu, H.; Wang, P.; Zhang, Y.; Wang, Y.; Li, X.; Li, B.; et al. A double-stranded RNA binding protein enhances drought resistance via protein phase separation in rice. Nat. Commun. 2024, 15, 2514. [Google Scholar] [CrossRef] [PubMed]
  4. Han, D.; Du, M.; Zhou, Z.; Wang, S.; Li, T.; Han, J.; Xu, T. An NAC transcription factor gene from Malus baccata, MbNAC29, increases cold and high salinity tolerance in Arabidopsis. Vitr. Cell. Dev. Biol.—Plant 2020, 56, 588–599. [Google Scholar] [CrossRef]
  5. Wang, Y.; He, W.; Wang, L.; Lan, Y.X.; Wu, M. TCP transcription factor identification in pecan (Carya illinoensis) and salt tolerance function analysis of CiTCP8. Sci. Hortic. 2024, 13, 2568. [Google Scholar] [CrossRef]
  6. Javed, T.; Gao, S.J. WRKY transcription factors in plant defense. Trends Genet. 2023, 39, 787–801. [Google Scholar] [CrossRef] [PubMed]
  7. Qing, L.D.; Yi, T.; Xue, M.Z. Overexpression of the transcription factor MdWRKY115 improves drought and osmotic stress tolerance by directly binding to the MdRD22 promoter in apple. Hortic. Plant J. 2024, 10, 629–640. [Google Scholar]
  8. Jiang, J.; Ma, S.; Ye, N. WRKY transcription factors in plant responses to stresses. J. Integr. Plant Biol. 2017, 59, 86–101. [Google Scholar] [CrossRef]
  9. Li, H.L.; Zhang, L.B.; Guo, D.; Li, C.Z.; Peng, S.Q. Identification and expression profiles of the WRKY transcription factor family in Ricinus communis. Gene 2012, 503, 48–53. [Google Scholar] [CrossRef]
  10. Zhang, M.; Zhao, R.; Huang, K.; Huang, S.; Wang, H.; Wei, Z.; Li, Z.; Bian, M.; Jiang, W.; Wu, T.; et al. The OsWRKY63-OsWRKY76-OsDREB1B module regulates chilling tolerance in rice. Plant J. 2022, 112, 383–398. [Google Scholar] [CrossRef]
  11. Li, Y.; Li, X.; Wei, J.; Cai, K.; Zhang, H.; Ge, L.; Ren, Z.; Zhao, C.; Zhao, X. Genome-wide identification and analysis of the WRKY gene family and cold stress response in Acer truncatum. Genes 2021, 12, 1867. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, W.; Liang, X.; Cai, W.; Wang, H.; Liu, X.; Cheng, L.; Song, P.; Luo, G.; Han, D. Isolation and functional analysis of VvWRKY28, a Vitis vinifera WRKY transcription factor gene, with functions in tolerance to cold and salt stress in transgenic Arabidopsis thaliana. Int. J. Mol. Sci. 2022, 23, 13418. [Google Scholar] [CrossRef] [PubMed]
  13. Poosapati, S.; Poretsky, E.; Dressano, K.; Ruiz, M.; Vazquez, A.; Sandoval, E.; Estrada-Cardenas, A.; Duggal, S.; Lim, J.H.; Morris, G.; et al. A sorghum genome-wide association study (GWAS) identifies a WRKY transcription factor as a candidate gene underlying sugarcane aphid (Melanaphis sacchari) resistance. Planta 2022, 255, 37. [Google Scholar] [CrossRef]
  14. Li, P.; Song, A.; Gao, C.; Jiang, J.; Chen, S.; Fang, W.; Zhang, F.; Chen, F. The over-expression of a chrysanthemum WRKY transcription factor enhances aphid resistance. Plant Physiol. Biochem. 2015, 95, 26–34. [Google Scholar] [CrossRef]
  15. Pokharel, S.S.; Yu, H.; Fang, W.; Parajulee, M.N.; Chen, F. Intercropping cover crops for a vital ecosystem service: A review of the biocontrol of insect pests in tea agroecosystems. Plants 2023, 12, 2361. [Google Scholar] [CrossRef]
  16. Wen, B.; Zhang, X.; Ren, S. Characteristics of soil nutrients, heavy metals and tea quality in different intercropping patterns. Agrofor. Syst. 2020, 94, 963–974. [Google Scholar] [CrossRef]
  17. Hong, Y.; Heerink, N.; Jin, S.; Berentsen, P.; Zhang, L.; Werf, W.V. Intercropping and agroforestry in China—Current state and trends. Agric. Ecosyst. Environ. 2017, 244, 52–61. [Google Scholar] [CrossRef]
  18. Wang, L.; Dossa, K.; You, J.; Zhang, Y.; Li, D.; Zhou, R.; Yu, J.; Wei, X.; Zhu, X.; Jiang, S.; et al. High-resolution temporal transcriptome sequencing unravels ERF and WRKY as the master players in the regulatory networks underlying sesame responses to waterlogging and recovery. Genomics 2021, 113, 276–290. [Google Scholar] [CrossRef] [PubMed]
  19. Wu, T.; Jiang, Y.; Li, M.; Pu, D.; Shi, M.; Lan, Z.Q. RNA-seq analysis reveals the potential mechanism of improved viability and product quality of tea plants through intercropping with Chinese chestnut. Plant Growth Regul. 2022, 96, 177–193. [Google Scholar] [CrossRef]
  20. Zhang, J.; He, X.; Zhou, J.; Dong, Z.; Yu, H.; Tang, Q.; Yuan, L.; Peng, S.; Zhong, X.; He, Y. Selection and verification of standardized reference genes of Angelica dahurica under various abiotic stresses by real-time quantitative PCR. Genes 2024, 15, 79. [Google Scholar] [CrossRef]
  21. Song, J.; Wu, H.; He, F.; Qu, J.; Wang, Y.; Li, C.; Liu, J.H. Citrus sinensis CBF1 functions in cold tolerance by modulating Putrescine Biosynthesis through regulation of Arginine Decarboxylase. Plant Cell Physiol. 2022, 63, 19–29. [Google Scholar] [CrossRef] [PubMed]
  22. Li, X.Y.; Wang, Y.; Dai, Y.; He, Y.; Li, C.X.; Mao, P.; Ma, X.R. The transcription factors of tall fescue in response to temperature stress. Plant Biol. 2021, 23 (Suppl. S1), 89–99. [Google Scholar] [CrossRef] [PubMed]
  23. Vaghela, B.; Vashi, R.; Rajput, K.; Joshi, R. Plant chitinases and their role in plant defense: A comprehensive review. Enzym. Microb. Technol. 2022, 159, 110055. [Google Scholar] [CrossRef]
  24. Schäfer, M.; Meza-Canales, I.D.; Navarro-Quezada, A.; Brütting, C.; Vanková, R.; Baldwin, I.T.; Meldau, S. Cytokinin levels and signaling respond to wounding and the perception of herbivore elicitors in Nicotiana attenuata. J. Integr. Plant Biol. 2015, 57, 198–212. [Google Scholar] [CrossRef]
  25. Xie, L.; Yan, T.; Li, L.; Chen, M.; Ma, Y.; Hao, X.; Fu, X.; Shen, Q.; Huang, Y.; Qin, W.; et al. The WRKY transcription factor AaGSW2 promotes glandular trichome initiation in Artemisia annua. J. Exp. Bot. 2021, 72, 1691–1701. [Google Scholar] [CrossRef] [PubMed]
  26. Xu, J.; van Herwijnen, Z.O.; Dräger, D.B.; Sui, C.; Haring, M.A.; Schuurink, R.C. SlMYC1 regulates type VI glandular trichome formation and terpene biosynthesis in tomato glandular cells. Plant Cell 2018, 30, 2988–3005. [Google Scholar] [CrossRef]
  27. Hua, B.; Chang, J.; Wu, M.; Xu, Z.; Zhang, F.; Yang, M.; Xu, H.; Wang, L.J.; Chen, X.Y.; Wu, S. Mediation of JA signalling in glandular trichomes by the woolly/SlMYC1 regulatory module improves pest resistance in tomato. Plant Biotechnol. J. 2021, 19, 375–393. [Google Scholar] [CrossRef]
  28. Zhao, Q.; Xiang, X.; Liu, D.; Yang, A.; Wang, Y. Tobacco transcription factor NtbHLH123 confers tolerance to cold stress by regulating the NtCBF Pathway and reactive oxygen species homeostasis. Front. Plant Sci. 2018, 9, 381. [Google Scholar] [CrossRef]
  29. Yang, D.; Liu, Y.; Cheng, H.; Wang, Q.; Lv, L.; Zhang, Y.; Song, G.; Zuo, D. Identification of the group III WRKY subfamily and the functional analysis of GhWRKY53 in Gossypium hirsutum L. Plants 2021, 10, 1235. [Google Scholar] [CrossRef] [PubMed]
  30. Spyropoulou, E.A.; Haring, M.A.; Schuurink, R.C. RNA sequencing on Solanum lycopersicum trichomes identifies transcription factors that activate terpene synthase promoters. BMC Genet. 2014, 15, 402. [Google Scholar] [CrossRef]
  31. Fan, C.; Yao, H.; Qiu, Z.; Ma, H.; Zeng, B. Genome-wide analysis of Eucalyptus grandis WRKY genes family and their expression profiling in response to hormone and abiotic stress treatment. Gene 2018, 678, 38–48. [Google Scholar] [CrossRef]
  32. Liu, S.; Zhang, C.; Guo, F.; Sun, Q.; Yu, J.; Dong, T.; Wang, X.; Song, W.; Li, Z.; Meng, X.; et al. A systematical genome-wide analysis and screening of WRKY transcription factor family engaged in abiotic stress response in sweetpotato. BMC Plant Biol. 2022, 22, 616. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, J.; Li, G.; Wang, R.; Wang, G.; Wan, Y. Genome-wide analysis of WRKY transcription factors involved in abiotic stress and ABA response in Caragana korshinskii. Int. J. Mol. Sci. 2023, 24, 9519. [Google Scholar] [CrossRef]
  34. Goyal, P.; Manzoor, M.M.; Vishwakarma, R.A.; Sharma, D.; Dhar, M.K.; Gupta, S. A comprehensive transcriptome-wide identification and screening of WRKY gene family engaged in abiotic stress in Glycyrrhiza glabra. Sci. Rep. 2020, 10, 373. [Google Scholar] [CrossRef]
  35. Jan, R.; Asaf, S.; Lubna Asif, S.; Kim, E.G.; Jang, Y.H.; Kim, N.; Al-Harrasi, A.; Lee, G.S.; Kim, K.M. Enhancing the expression of the OsF3H gene in Oryza sativa leads to the regulation of multiple biosynthetic pathways and transcriptomic changes that influence insect resistance. Int. J. Mol. Sci. 2022, 23, 15308. [Google Scholar] [CrossRef]
  36. Tang, Y.; Guo, J.; Zhang, T.; Bai, S.; He, K.; Wang, Z. Genome-wide analysis of WRKY gene family and the synamic responses of key WRKY genes involved in Ostrinia furnacalis attack in Zea mays. Int. J. Mol. Sci. 2021, 22, 13045. [Google Scholar] [CrossRef] [PubMed]
  37. Yu, X.; Pan, Y.; Dong, Y.; Lu, B.; Zhang, C.; Yang, M.; Zuo, L. Cloning and overexpression of PeWRKY31 from Populus × euramericana enhances salt and biological tolerance in transgenic Nicotiana. BMC Plant Biol. 2021, 21, 80. [Google Scholar] [CrossRef]
  38. Wang, Y.; Dong, B.; Wang, N.; Zheng, Z.; Yang, L.; Zhong, S.; Fang, Q.; Xiao, Z.; Zhao, H. A WRKY transcription factor PmWRKY57 from Prunus mume improves cold tolerance in Arabidopsis thaliana. Mol. Biotechnol. 2023, 65, 1359–1368. [Google Scholar] [CrossRef] [PubMed]
  39. Luo, D.L.; Ba, L.J.; Shan, W.; Kuang, J.F.; Lu, W.J.; Chen, J.Y. Involvement of WRKY transcription factors in Abscisic-Acid-Induced cold tolerance of banana fruit. J. Agric. Food Chem. 2017, 65, 3627–3635. [Google Scholar] [CrossRef]
  40. Zhang, Y.; He, J.; Xiao, Y.; Zhang, Y.; Liu, Y.; Wan, S.; Liu, L.; Dong, Y.; Liu, H.; Yu, Y. CsGSTU8, a Glutathione S-transferase from Camellia sinensis, is regulated by CsWRKY48 and plays a positive role in drought tolerance. Front. Plant Sci. 2021, 12, 795919. [Google Scholar] [CrossRef]
Figure 1. Expression analysis of WRKY48. (a) WRKY48 expression under low temperature; (b) WRKY48 expression under H2O (as a control), MJ (Methyl Jasmonate), SA (Salicylic acid), GA3 (Gibberellin A3), ETH (Ethylene), ABA (Abscisic acid), PEG (Polyethylene glycol), and NaCl. Note: The bar chart represents the mean of three biological replicates, with error bars showing standard deviations. Asterisks indicate statistical significance based on one-way analysis of variance (** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 1. Expression analysis of WRKY48. (a) WRKY48 expression under low temperature; (b) WRKY48 expression under H2O (as a control), MJ (Methyl Jasmonate), SA (Salicylic acid), GA3 (Gibberellin A3), ETH (Ethylene), ABA (Abscisic acid), PEG (Polyethylene glycol), and NaCl. Note: The bar chart represents the mean of three biological replicates, with error bars showing standard deviations. Asterisks indicate statistical significance based on one-way analysis of variance (** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Ijms 25 13526 g001
Figure 2. Analysis results of amino acid sequences for CsWRKY48. (a) Phylogenetic tree and (b) sequence analysis. Note: The target protein was marked with a red, ClWRKY48 (Camellia lanceoleosa, KAI8010938.1), NsWRKY48 (Nyssa sinensis, KAA8531200.1), CfWRKY48 (Cornus florida, XP059632820.1), VvWRKY48 (Vitis vinifera, RVW69378.1), and VrWRKY48 (Vitis rotundifolia, KAJ9699830.1).
Figure 2. Analysis results of amino acid sequences for CsWRKY48. (a) Phylogenetic tree and (b) sequence analysis. Note: The target protein was marked with a red, ClWRKY48 (Camellia lanceoleosa, KAI8010938.1), NsWRKY48 (Nyssa sinensis, KAA8531200.1), CfWRKY48 (Cornus florida, XP059632820.1), VvWRKY48 (Vitis vinifera, RVW69378.1), and VrWRKY48 (Vitis rotundifolia, KAJ9699830.1).
Ijms 25 13526 g002
Figure 3. Genetic transformation, positive seedling screening, and phenotypic observation of transgenic tobacco. (a) Tobacco leaf discs infected with Agrobacterium tumefaciens; (b) induction of resistant buds; (c) expansion of resistant buds; (d) isolation of resistant buds; (e) formation of independent lines; (f) expression analysis of transgenic lines; (g) transgenic tobacco after transplanting; (h) seeds harvested from mature transgenic tobacco for subsequent experiments; (i,m) control tobacco plants; (j,n) CsWRKY48-OE4; (k,o) CsWRKY48-OE16; and (l,p) CsWRKY48-OE40. Note: The bar chart represents the mean of three biological replicates, with error bars showing standard deviations. Asterisks indicate statistical significance based on one-way analysis of variance (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 3. Genetic transformation, positive seedling screening, and phenotypic observation of transgenic tobacco. (a) Tobacco leaf discs infected with Agrobacterium tumefaciens; (b) induction of resistant buds; (c) expansion of resistant buds; (d) isolation of resistant buds; (e) formation of independent lines; (f) expression analysis of transgenic lines; (g) transgenic tobacco after transplanting; (h) seeds harvested from mature transgenic tobacco for subsequent experiments; (i,m) control tobacco plants; (j,n) CsWRKY48-OE4; (k,o) CsWRKY48-OE16; and (l,p) CsWRKY48-OE40. Note: The bar chart represents the mean of three biological replicates, with error bars showing standard deviations. Asterisks indicate statistical significance based on one-way analysis of variance (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Ijms 25 13526 g003
Figure 4. Phenotype analysis of transgenic tobacco after low-temperature treatment and aphid feeding. (a,e,ik) WT (wild-type); (b,f) CsWRKY48-OE4; (c,g) CsWRKY48-OE16; (d,h) CsWRKY48-OE40; (ad) after low-temperature treatment for 12h; (eh) after low-temperature treatment for 24 h; (in) after aphid feeding for 12 h.
Figure 4. Phenotype analysis of transgenic tobacco after low-temperature treatment and aphid feeding. (a,e,ik) WT (wild-type); (b,f) CsWRKY48-OE4; (c,g) CsWRKY48-OE16; (d,h) CsWRKY48-OE40; (ad) after low-temperature treatment for 12h; (eh) after low-temperature treatment for 24 h; (in) after aphid feeding for 12 h.
Ijms 25 13526 g004
Figure 5. Physiological and biochemical indices and relative expression of two cold resistance genes in transgenic tobacco at 4 °C. (a) Relative conductivity; (b) MDA content; (c) soluble protein content; (d) soluble sugar content; (e) proline content; (f) POD activity; (g) SOD activity; (h) CAT activity; (i) relative expression of NtCBF1; and (j) relative expression of NtDREB2B. Note: The bar chart represents the mean of three biological replicates, with error bars showing standard deviations. Asterisks indicate statistical significance based on one-way analysis of variance (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 5. Physiological and biochemical indices and relative expression of two cold resistance genes in transgenic tobacco at 4 °C. (a) Relative conductivity; (b) MDA content; (c) soluble protein content; (d) soluble sugar content; (e) proline content; (f) POD activity; (g) SOD activity; (h) CAT activity; (i) relative expression of NtCBF1; and (j) relative expression of NtDREB2B. Note: The bar chart represents the mean of three biological replicates, with error bars showing standard deviations. Asterisks indicate statistical significance based on one-way analysis of variance (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Ijms 25 13526 g005
Figure 6. Antioxidant enzyme activities and the expression of two insect resistance genes in the control tobacco plant and the CsWRKY48 transgenic plant after aphid feeding. (a) Relative conductivity; (b) MDA content; (c) soluble protein content; (d) soluble sugar content; (e) proline content; (f) POD activity; (g) SOD activity; (h) CAT activity; (i) relative expression of NtTD; and (j) relative expression of NtChiA. Note: The bar chart represents the mean of three biological replicates, with error bars indicating standard deviations. Asterisks denote statistical significance based on one-way analysis of variance (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 6. Antioxidant enzyme activities and the expression of two insect resistance genes in the control tobacco plant and the CsWRKY48 transgenic plant after aphid feeding. (a) Relative conductivity; (b) MDA content; (c) soluble protein content; (d) soluble sugar content; (e) proline content; (f) POD activity; (g) SOD activity; (h) CAT activity; (i) relative expression of NtTD; and (j) relative expression of NtChiA. Note: The bar chart represents the mean of three biological replicates, with error bars indicating standard deviations. Asterisks denote statistical significance based on one-way analysis of variance (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Ijms 25 13526 g006
Figure 7. Prediction of cis-elements in the promoter of CsWRKY48, and analysis of the expression of relevant transcription factors and resistance genes in the transcriptomic data of the tea plants intercropped with Chinese chestnut. Note: (a) Prediction of cis-element in the promoter of CsWRKY48; analysis of the expression of relevant transcription factors and resistance genes in the transcriptomic data of the tea plants intercropped with Chinese chestnut. (bi) Analysis of the expression of relevant transcription factors and resistance genes in the transcriptomic data of the tea plants intercropped with Chinese chestnut (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Figure 7. Prediction of cis-elements in the promoter of CsWRKY48, and analysis of the expression of relevant transcription factors and resistance genes in the transcriptomic data of the tea plants intercropped with Chinese chestnut. Note: (a) Prediction of cis-element in the promoter of CsWRKY48; analysis of the expression of relevant transcription factors and resistance genes in the transcriptomic data of the tea plants intercropped with Chinese chestnut. (bi) Analysis of the expression of relevant transcription factors and resistance genes in the transcriptomic data of the tea plants intercropped with Chinese chestnut (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).
Ijms 25 13526 g007
Figure 8. Resistance mechanism of Chinese chestnut tea plantation. Note: Grey box indicates that tea plants in pure tea plantations were susceptible to low temperatures and aphid stresses; pink box indicates that tea plants in Chinese chestnut tea intercropped tea plantations were more resistant to low temperatures and aphids. POD: Peroxidase; SOD: Superoxide dismutase; CAT: Catalase; ERF: Ethylene responsive factor; bHLH: Basic helix–loop–helix; bZIP: Basic leucine zippers; MYB: Myeloblastosis viral; CBF1: C-repeat binding factor; DREB2B: Dehydration responsive element binding; Chia: Chitinase; TD: Threonine deaminase.
Figure 8. Resistance mechanism of Chinese chestnut tea plantation. Note: Grey box indicates that tea plants in pure tea plantations were susceptible to low temperatures and aphid stresses; pink box indicates that tea plants in Chinese chestnut tea intercropped tea plantations were more resistant to low temperatures and aphids. POD: Peroxidase; SOD: Superoxide dismutase; CAT: Catalase; ERF: Ethylene responsive factor; bHLH: Basic helix–loop–helix; bZIP: Basic leucine zippers; MYB: Myeloblastosis viral; CBF1: C-repeat binding factor; DREB2B: Dehydration responsive element binding; Chia: Chitinase; TD: Threonine deaminase.
Ijms 25 13526 g008
Table 1. Primers synthesis of qPCR for cold resistance and insect resistance genes.
Table 1. Primers synthesis of qPCR for cold resistance and insect resistance genes.
Primer NameGenBank No.Sequence
NtEF1α-FNM001326165
[20]
TGGTTGTGACTTTTGGTCCCA
NtEF1α-RACAAACCCACGCTTGAGATCC
NtCBF1-FNP001312156
[21]
GGATGAGGAGACGCTATTCTG
NtCBF1-RTGTGAACACTGAGGTGGAGG
NtDREB2B-FEU727156
[22]
CGGCCGCCCATCTGAGTC
NtDREB2B-RAGGTGGAGGCAGCATTAGTC
NtChiA-FP08252.2
[23]
GGCCTTGTGGAAGAGCCATA
NtChiA-RCCAAATCCAGGGAGGCGATT
NtTD-FAAG59585.1
[24]
ACATGGGTCAAGTTAGGCGG
NtTD-RTATAGGGGTGGCAAATGGGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, J.; Gong, Y.; Li, M.; Bai, Y.; Wu, T. A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses. Int. J. Mol. Sci. 2024, 25, 13526. https://doi.org/10.3390/ijms252413526

AMA Style

Wang J, Gong Y, Li M, Bai Y, Wu T. A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses. International Journal of Molecular Sciences. 2024; 25(24):13526. https://doi.org/10.3390/ijms252413526

Chicago/Turabian Style

Wang, Jianzhao, Yikai Gong, Meng Li, Yan Bai, and Tian Wu. 2024. "A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses" International Journal of Molecular Sciences 25, no. 24: 13526. https://doi.org/10.3390/ijms252413526

APA Style

Wang, J., Gong, Y., Li, M., Bai, Y., & Wu, T. (2024). A CsWRKY48 Gene from Tea Plants Intercropped with Chinese Chestnut Plays an Important Role in Resistance to Biotic and Abiotic Stresses. International Journal of Molecular Sciences, 25(24), 13526. https://doi.org/10.3390/ijms252413526

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop