Next Article in Journal
The Molecular Characterization and Antioxidant Defense of a Novel Nrf2 from the Pacific Abalone Haliotis discus hannai Ino
Next Article in Special Issue
PER1 Oscillation in Rat Parathyroid Hormone and Calcitonin Producing Cells
Previous Article in Journal
Mediastinal Teratoma with Nephroblastomatous Elements: Case Report, Literature Review, and Comparison with Maturing Fetal Glomerulogenic Zone/Definitive Zone Ratio and Nephrogenic Rests
Previous Article in Special Issue
Interaction Between Early Meals (Big-Breakfast Diet), Clock Gene mRNA Expression, and Gut Microbiome to Regulate Weight Loss and Glucose Metabolism in Obesity and Type 2 Diabetes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Impact of Circadian Clock PER2 Gene Overexpression on Rumen Epithelial Cell Dynamics and VFA Transport Protein Expression

1
Laboratory of Metabolic Manipulation of Herbivorous Animal Nutrition, College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
2
College of Animal Science & Technology, Yangzhou University, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(22), 12428; https://doi.org/10.3390/ijms252212428
Submission received: 23 October 2024 / Revised: 5 November 2024 / Accepted: 14 November 2024 / Published: 19 November 2024
(This article belongs to the Special Issue Molecular Advances in Circadian Rhythm and Metabolism)

Abstract

The circadian gene PER2 is recognized for its regulatory effects on cell proliferation and lipid metabolism across various non-ruminant cells. This study investigates the influence of PER2 gene overexpression on goat rumen epithelial cells using a constructed pcDNA3.1-PER2 plasmid, assessing its impact on circadian gene expression, cell proliferation, and mRNA levels of short-chain fatty acid (SCFA) transporters, alongside genes related to lipid metabolism, cell proliferation, and apoptosis. Rumen epithelial cells were obtained every four hours from healthy dairy goats (n = 3; aged 1.5 years; average weight 45.34 ± 4.28 kg), cultured for 48 h in vitro, and segregated into control (pcDNA3.1) and overexpressed (pcDNA3.1-PER2) groups, each with four biological replicates. The study examined the potential connection between circadian rhythms and nutrient assimilation in ruminant, including cell proliferation, apoptosis, cell cycle dynamics, and antioxidant activity and the expression of circadian-related genes, VFA transporter genes and regulatory factors. The introduction of the pcDNA3.1-PER2 plasmid drastically elevated PER2 expression levels by 3471.48-fold compared to controls (p < 0.01), confirming effective overexpression. PER2 overexpression resulted in a significant increase in apoptosis rates (p < 0.05) and a notable reduction in cell proliferation at 24 and 48 h post-transfection (p < 0.05), illustrating an inhibitory effect on rumen epithelial cell growth. PER2 elevation significantly boosted the expression of CCND1, WEE1, p21, and p16 (p < 0.05) while diminishing CDK4 expression (p < 0.05). While the general expression of intracellular inflammation genes remained stable, TNF-α expression notably increased. Antioxidant marker levels (SOD, MDA, GSH-Px, CAT, and T-AOC) exhibited no significant change, suggesting no oxidative damage due to PER2 overexpression. Furthermore, PER2 overexpression significantly downregulated AE2, NHE1, MCT1, and MCT4 mRNA expressions while upregulating PAT1 and VH+ ATPase. These results suggest that PER2 overexpression impairs cell proliferation, enhances apoptosis, and modulates VFA transporter-related factors in the rumen epithelium. This study implies that the PER2 gene may regulate VFA absorption through modulation of VFA transporters in rumen epithelial cells, necessitating further research into its specific regulatory mechanisms.

1. Introduction

The circadian clock system governs the expression of clock-controlled genes (CCGs), which influence several physiological functions [1]. This regulatory framework is crucial for maintaining homeostasis and optimizing the timing and coordination of biological activities according to the 24 h circadian rhythm [2]. The circadian cycle is driven by complex feedback loops that link transcription and translation. Core clock genes that produce rhythmic patterns of gene expression, such as CLOCK, BMAL1, PER, and CRY, are involved in these loops [3]. Two essential elements of the positive limb of the circadian clock are BMAL1 and CLOCK. In order to start the transcription of target genes, including Period (PER) and Cryptochrome (CRY), they form a heterodimer that binds to E-box motifs in their promoters [4,5].
The rumen is a vital organ in ruminants, serving as the primary site for microbial fermentation of ingested feed. It plays a critical role in nutrient absorption, converting complex plant materials into volatile fatty acids, amino acids, and other essential nutrients that are pivotal for the animal’s energy metabolism and overall health [6,7]. Understanding rumen physiology is crucial not only for optimizing ruminant nutrition and enhancing productivity but also for maintaining animal health and welfare. Recent studies have suggested that circadian rhythms, which are endogenously generated near-24 h cycles, profoundly influence various physiological processes, including metabolism, digestion, and immune function [8,9]. The PER2 gene, a core component of the circadian clock, regulates these rhythms and may significantly affect rumen functionality by modulating gene expression linked to nutrient absorption and cellular dynamics. Therefore, examining the circadian regulation of the rumen through the lens of PER2 function provides valuable insights into how temporal organization impacts ruminant physiology, with potential implications for improving animal health and productivity [10,11].
The PER and CRY proteins, which are essential for the circadian feedback loop, are expressed when the BMAL1-CLOCK complex is activated. Following production, these proteins return to the nucleus to inhibit BMAL1-CLOCK activity, which controls the expression of these proteins [12,13]. While PER3 may affect rhythm amplitude and resilience [14], PER1 and PER2 are crucial for preserving the clock’s precision and stability [15,16]. CRY proteins, including CRY1 and CRY3, are indispensable for the inhibition of BMAL1-CLOCK and help synchronize the circadian clock with light–dark cycles via photic entrainment [4,17].
The key circadian clock gene, PER2, significantly influences cell proliferation and lipid metabolism. Previous research on non-ruminant cells indicates that this circadian clock gene affects multiple cellular activities, including cell division, apoptosis, lipid metabolism, and mRNA levels associated with amino acid transporters [18,19,20,21]. Moreover, research indicates that circadian clock genes in non-ruminant gastrointestinal systems significantly regulate macronutrient absorption and transport [22]. Casey and Plaut [23] suggested, based on rodent models, that circadian clocks are essential for maintaining lactation homeostasis by affecting hormone profiles, such as prolactin, and altering metabolic pathways [23].
Most studies on ruminants have focused on the function of circadian clock genes in metabolic organs such as the liver, adipose tissue, and mammary gland, as well as their interaction with nuclear receptors, specifically peroxisome proliferator-activated receptors (PPARs), which are essential for lipid metabolism [24,25]. In mammary cells, studies indicate that PER2 partly controls α-casein protein production [26]. Circadian clock components’ presence and physiological functions in rapidly proliferating tissues, such as the ruminal epithelium, remain uncertain. This knowledge gap underscores the demand for more studies to explore the expression and functional importance of circadian clock genes in rumen and their potential impact on ruminal physiology and overall animal health.
Nutrient transporters involved in the absorption of glucose, peptides, and lipids exhibit different diurnal rhythms in their mRNA expression levels, according to studies conducted in non-ruminants [27,28]. Additionally, studies using rodent models have shown that the circadian clock affects the mRNA levels of ion transporters in the intestines, particularly SLC4A1 (AE1) and SLC9A3 (NHE3), with peak expression taking place at the beginning of the night phase [29]. Additionally, research in controlled settings has shown that BMAL1, a crucial gene linked to circadian rhythm, can influence glucose absorption in Caco-2 cells by modifying the translation of SLC5A1 (SGLT1) [30,31,32].
Considering these findings, we hypothesized that ruminal epithelial cells (RECs) may also express components of the circadian clock and that PER2 may be essential for controlling cellular proliferation and nutrient transporter mRNA expression levels in these cells.
This hypothesis aims to investigate the potential connection between circadian rhythms and nutrient assimilation in ruminants, building upon the foundational knowledge derived from non-ruminant models.
The interaction between these genes is intricate and precisely regulated, emphasizing the sophisticated nature of circadian regulation [33]. This study seeks to further explore this complexity by examining the effects of PER2 overexpression on rumen epithelial cell proliferation and VFA absorption protein expression.

2. Results

2.1. Detection of PER2 Overexpression Efficiency

The PER2 gene showed a relative expression level of 4061.63 after 48 h of transfection with the pcDNA3.1-PER2 plasmid (Figure 1). The overexpression group exhibited a 3471.48-fold increase in PER2 expression compared to the control group, representing a statistically significant difference (p < 0.01). These findings confirm the successful overexpression of the PER2 gene in goats, establishing a solid foundation for subsequent experiments.

2.2. Effect of PER2 Overexpression on Cell Proliferative Activity and Apoptosis of Goat Rumen Epithelial Cells

Flow cytometry was employed to assess apoptosis in goat rumen epithelial cells 48 h after transfection with the pcDNA3.1-PER2 plasmid (Figure 2A). The results showed a significant rise in apoptosis levels among the PER2 overexpression set when compared to the control set (p < 0.05) (Figure 2B). Furthermore, the CCK8 proliferation assay evaluated cell viability at 24 and 48 h post-transfection. The findings indicated a markedly diminished cellular viability within the PER2 overexpression cohort in contrast to the control cohort at both temporal measurements (p < 0.05) (Figure 2C). These results suggest that PER2 overexpression reduces the survival of goat rumen epithelial cells.
According to Table 1, the intensified expression of the PER2 gene has considerably improved the levels of pro-apoptotic genes P21, BAX, and CASPASE6 (p < 0.05). In contrast, the anti-apoptotic gene BCL2 showed significantly reduced expression (p < 0.05). However, other apoptosis-related genes, including CASPASE3, CASPASE7, CASPASE8, CASPASE9, and p53, exhibited no significant alterations in expression levels (p > 0.05).

2.3. Effect of PER2 Overexpression on Cell Cycle Gene Expression in Goat Rumen Epithelial Cells

Overexpression of the PER2 gene led to a notable increase in the expression levels of CCND1, WEE1, p21, and p16 when compared to the control group (p < 0.05), as shown in (Table 2). Furthermore, a significant decrease in CDK4 gene expression was observed (p < 0.05). The enhanced PER2 gene expression resulted in substantially higher levels of CCND1, WEE1, p21, and p16 relative to the control set (p < 0.05), as illustrated in Table 2. Moreover, a considerable reduction in CDK4 gene expression was noted (p < 0.05).

2.4. Effect of PER2 Overexpression on Inflammatory Gene Expression in Goat Rumen Epithelial Cells

As shown in Figure 3 and Table 3, overexpression of the PER2 gene did not lead to significant changes in the expression of intracellular inflammatory genes (p > 0.05), with the exception of TNF-α, which increased significantly.

2.5. Effect of PER2 Gene Overexpression on Rumen Epithelial Cell Membrane Damage in Goats

LDH release was measured to assess the impact of PER2 gene overexpression on membrane damage in goat rumen epithelial cells. As shown in Figure 3, there was no significant difference in LDH release between the control group (pcDNA3.1) and the overexpression group (pcDNA3.1-PER2) (p > 0.05).

2.6. Effect of PER2 Gene Overexpression on ROS in Goat Rumen Epithelial Cells

As shown in Figure 4, the DEFH-DA probe was used to measure ROS levels in goat rumen epithelial cells. The results indicated no significant change in ROS fluorescence intensity in the PER2 overexpression group compared to the control group. This suggests that PER2 gene overexpression did not cause oxidative damage to the rumen epithelial cells.

2.7. Effect of PER2 Gene Overexpression on Antioxidants in Goat Rumen Epithelial Cells

As shown in Figure 5, the antioxidant performance of goat rumen epithelial cells was evaluated using a detection kit. The results revealed no significant changes in the levels of intracellular SOD, MDA, GSH-PX, CAT, or T-AOC in the PER2 overexpression group compared to the control group. These findings suggest that PER2 gene overexpression did not induce oxidative damage in goat rumen epithelial cells.

2.8. Effect of PER2 Gene Overexpression on VFA Transporters and Related Factors in Rumen Epithelial Cells

The mRNA expression levels of VFA transporters and related factors are presented in Table 4. Overexpression of the PER2 gene resulted in significantly reduced relative expression levels of the AE2, NHE1, MCT1, and MCT4 genes when compared to the control group (p < 0.01). In contrast, the PAT1 and VH+ ATPase genes exhibited significantly higher relative expression levels in the overexpression group (p < 0.05). While NHE3 and NA/K ATPase genes showed increased relative expression levels in the overexpression group, these differences were not statistically significant (p > 0.05).

3. Discussion

Before exploring the effects of PER2 overexpression on goat rumen epithelial cells, it is crucial to understand its broader biological role across various species. In pigs, sheep, and cattle, PER2 is essential for regulating circadian rhythms, influencing significant physiological and metabolic processes, which provides valuable insights for the current study.
In pigs, circadian regulation by PER2 is vital for maintaining metabolic balance. The interaction of PER2 with other clock genes such as BMAL1 and CRY2 affects lipid metabolism, which in turn influences growth and meat quality [34]. Zhou et al. [35] demonstrated that diurnal variations in fatty acid metabolism highlight the significance of timing in feed administration. Alterations in PER2 expression have been linked to changed lipid metabolism, suggesting potential improvements in growth performance and a reduction in liver fat accumulation through its manipulation [36]. Furthermore, synchronizing feeding schedules with circadian rhythms boosts muscle quality and milk lipid profiles, underscoring PER2’s role in aligning metabolic activities with environmental cues for optimum productivity [37,38].
In sheep, PER2 expression is closely associated with seasonal reproductive cycles driven by photoperiod changes [39,40]. This synchronization ensures that reproductive activities occur under favorable conditions. PER2 cycles, along with other clock genes, facilitate fertility optimization and adapt metabolic functions to seasonal changes [41,42]. Under extended daylight, PER2 expression lengthens, correlating with shifts in reproductive hormone levels, such as kisspeptin [41]. Understanding PER2 modulation can enhance breeding strategies aligned with natural photoperiods, improving reproductive outcomes [43].
In cattle, circadian rhythms significantly impact processes like reproduction and lactation, with PER2 and its interaction with other major clock genes playing a key role [44]. Diurnal changes in luteinizing hormone levels during the estrous cycle suggest a circadian influence linked to PER2 [45]. PER2 regulates milk production by influencing the synthesis of milk proteins and metabolic genes during lactation [25,46]. Photoperiod adjustments, like increased light exposure, enhance milk yields partially due to altered PER2 expression, which improves metabolic processes [47,48,49]. Modulating PER2 in bovine systems highlights its importance in boosting dairy and reproductive performance, offering insights into management practices that leverage circadian biology for increased productivity [50,51].
Overall, PER2 is a crucial component within the circadian system which is intricately involved in regulating metabolic and reproductive functions across various species. Its synchronization with environmental stimuli presents practical applications in agriculture, promising enhancements in productivity, and resource efficiency by aligning management practices with innate biological rhythms.

3.1. Effect of PER2 Gene Overexpression on the Proliferative Activity and Apoptosis Level of Goat Rumen Epithelial Cells

The circadian rhythm regulates many functions related to the normal physiological metabolism of organisms, leading to periodic changes within a 24 h cycle. Current research demonstrates that clock genes influence various physiological activities, including cell proliferation and apoptosis [52,53,54,55]. In non-ruminant models, overexpression of PER1 has been shown to inhibit cell growth [56,57,58]. PER2, a key core clock gene, acts as an important negative regulator in the circadian feedback loop, maintaining both the circadian rhythm of cells and a normal cell cycle [59,60,61,62]. Research has demonstrated that PER2 can regulate cell proliferation and apoptosis [19,63,64]. Several other investigations revealed that the boosted expression of the PER2 gene fosters autophagy and apoptosis, while concurrently restraining OSCC cell growth. Moreover, PER2 overexpression exhibits a substantial growth-inhibitory effect on mouse tumor cells, playing a vital role in tumor suppression by triggering apoptotic cell death [54,65].
In studies involving rumen epithelial cells and mammary epithelial cells, silencing the PER2 gene has been shown to promote cell proliferation and inhibit apoptosis [66,67], while overexpression of PER2 exacerbates apoptosis [54,68,69]. Gao et al. [32] found that treating rumen epithelial cells with 15 mM sodium butyrate enhanced PER2 gene expression, which resulted in a surplus of PER2 production. This surplus was linked to decreased cell proliferation and gene alterations related to the cell cycle, thus impacting cell division. In this investigation, we noted a pronounced elevation in the levels of apoptosis in goat rumen epithelial cells after the overexpression of PER2. BCL2 family proteins are key mitochondrial responses to apoptotic signaling regulators, typically inhibiting cell apoptosis. In contrast, BAX is a pro-apoptotic member that promotes apoptotic cell death. The interplay between anti-apoptotic and pro-apoptotic molecules determines how cells respond to apoptotic signals [70,71]. In this investigation, mRNA levels of apoptosis-related factors were evaluated using qRT-PCR. The results showed that in the control group treated with void plasmids, increased PER2 concentrations significantly enhanced the expression of pro-apoptotic genes, such as CASP6 and BAX, while simultaneously causing a substantial decrease in the expression of the anti-apoptotic gene BCL2.
p21 acts as an inhibitor of cyclin-dependent kinases, inducing cell cycle arrest during the G phase by blocking CDK activity and relevant DNA replication factors. This leads to the cessation of cell division and proliferation, thereby inhibiting cellular growth. The expression of the p21 gene is primarily regulated by p53, which induces p21 expression in response to DNA damage [72,73,74]. In this trial, consistent with previous reports, overexpression of PER2 increased the mRNA levels of p53 and p21 in goat rumen epithelial cells [75]. Additionally, cell viability in the overexpression group was significantly lower than in the control group, corroborating the aforementioned results and further confirming that PER2 may modulate cell proliferation and apoptosis by influencing the expression of various apoptosis-related factors.
PER2’s involvement in cellular mechanisms extends beyond its circadian regulatory functions, notably through its interaction with the p53 pathway. PER2 has been recognized to modulate the stability and transcriptional activity of p53, a pivotal tumor suppressor involved in cell cycle arrest and apoptosis. The overexpression of PER2 can enhance p53 stabilization, thereby augmenting the transcription of downstream targets such as p21, which contributes to G1 cell cycle arrest [76,77,78]. This interaction suggests a mechanism by which PER2 may influence apoptosis through the upregulation of pro-apoptotic genes and downregulation of anti-apoptotic genes. Additionally, this could explain PER2’s inhibitory effects on cell proliferation, as increased p53 activity hampers cell cycle progression and promotes apoptotic pathways. Understanding this PER2-p53 axis provides significant insights into how circadian clock genes might exert control over cell fate decisions, especially in rumen epithelial cells under varying physiological conditions.

3.2. Effect of PER2 Gene Overexpression on Cell Cycle Gene Expression in Goat Rumen Epithelial Cells

The normal activity of the cell cycle is tightly regulated by various cell cycle genes and proteins, with cyclin-dependent kinases (CDKs) and cyclins playing central roles. Recent scholarly investigations have elucidated a robust correlation between the cellular cycle and the circadian rhythm, emphasizing that numerous genes implicated in the cellular cycle are concurrently regulated by genes governing the circadian clock. For example, it has been reported that CCND and WEE1 are directly regulated by clock genes [15,73]. The PER2 gene, an essential element of the circadian rhythm, contributes substantially to this mechanism by modulating an array of downstream genes associated with the cell cycle. Abnormal expression of the PER2 gene can disrupt the cell cycle, leading to imbalanced expression of cell cycle-related genes, which in turn causes disturbances in the cell cycle and an imbalance between cell growth and apoptosis [55,79].
Cell cycle-related factors are essential for the proper functioning of the cell cycle, ensuring a balance between cell proliferation and apoptosis. The cell cycle is regulated by a molecular network that includes cyclins, CDKs, and CDK inhibitors (CKIs). CDKs are at the core of this regulatory system and are modulated by both cyclins and CKIs. The main cyclins are CCNA2, CCNB1, CCND1, and CCNE1, and they work alongside vital CDKs like CDK1, CDK2, CDK4, and CDK6 for the advancement of the cell cycle. CKIs, particularly p16 and p21, play a crucial role in this regulatory network [80,81]. During each part of the cell cycle, designated cyclins bind to their assigned CDKs to create cyclin/CDK complexes, leading to the activation of CDKs and supporting the organized flow of the cell cycle. Conversely, CKIs can inhibit cell cycle progression by binding to specific CDKs or cyclin/CDK complexes, thereby inhibiting CDK activity [80,82].
This study demonstrated that enhancing PER2 gene expression in rumen epithelial cells led to a notable increase in CCND1, WEE1, p21, and p16 levels, while CDK4 gene expression decreased significantly. These findings align with previous research on PER2 gene interference in human oral squamous cell carcinoma cells [19]. Specifically, p21 induces cell cycle arrest in the G phase by inhibiting CDKs and DNA replication factors, resulting in the cessation of cell division and proliferation, thus impeding cell growth [83,84]. This suggests that PER2 plays a crucial role in regulating the cyclin–CDK-CKI cell cycle regulatory network.

3.3. Effect of PER2 Gene Overexpression on Anti-Inflammatory Factors and Antioxidant Properties of Goat Rumen Epithelial Cells

Multiple studies have shown that core clock genes and inflammatory factors in cells exhibit a circadian rhythm [85,86,87]. Toll-like receptors (TLRs) are crucial for innate immune recognition and cell activation in response to antigens, thus facilitating immunoinflammatory responses. TLR2 and TLR4 are particularly important among TLRs. Research has shown that TLR2 and TLR4 can trigger NF-κB translocation by binding to intestinal LPS, subsequently inducing the expression of inflammatory cytokines such as IL-1, IL-6, IL-8, TNF-α, and INF-γ [88].
Further investigations have shown that knocking out the Per2 gene in rat RNK16 cells affects the expression of immune modulators like INF-γ and TNF-α to some extent. Similarly, studies involving LPS-stimulated BV2 cells from Per2 knockout mice revealed substantial increases in TNF-α and IL-6 levels within the cell culture medium [89]. Additionally, earlier research revealed a significant reduction in TLR2 expression in the colon of Per2 gene knockout mice [90]. Combined with the result of the previous findings, this study demonstrated that overexpression of the PER2 gene in goat rumen epithelial cells led to a significant increase in TNF-α expression, while there was no significant impact on anti-inflammatory factors or antioxidant activity. This could be attributed to the possibility that inflammation is linked to immune responses involving certain gut microbiota interacting with Toll-like receptors, a process that in vitro cell assays may not accurately replicate. Another potential explanation is that the increase in TNF-α expression might promote apoptosis. Future studies should investigate the specific mechanisms underlying these observations.

3.4. Effect of PER2 Gene Overexpression on VFA Transporters and Related Factors in Goat Rumen Epithelial Cells

Circadian clock genes are essential in modulating the uptake and translocation of macronutrients within the gastrointestinal system [91,92]. Recent studies have increasingly shown that the PER2 gene can influence lipid metabolism [20,93] and affect the mRNA abundance of amino acid transporters [39,94]. The AE2 protein, located in the epithelial cell membrane of the rumen, regulates the exchange of volatile fatty acids (VFAs) and bicarbonate (HCO3), playing a crucial role in maintaining internal balance. AE2, alongside chloride ions (Cl), contributes to VFA absorption and transport [95].
The Na+/H+ exchanger (NHE) family, especially NHE1, includes functions that affect how cells grow and die in a programmed manner, sustain cellular volume balance, and regulate pH levels inside the cell along with ionic transport. NHE1 activation has been shown to promote rapid progression through the G1 phase of the cell cycle; conversely, its inhibition can cause significant delays in the S phase, potentially arresting cell division [96]. MCT1 and MCT4, the transporters in question, are essential for moving short-chain fatty acids (SCFAs) through the epithelial cells of the rumen, helping with their transluminal transfer alongside ketone bodies and lactate [97]. Essentially, research demonstrates that the overexpression of PER2 driven by butyrate results in diminished mRNA levels of MCT1 and MCT4, while concurrently boosting the mRNA levels of V-H+-ATPase [32].
This research revealed that heightened levels of PER2 in rumen epithelial cells led to a pronounced decrease in AE2, NHE1, MCT1, and MCT4 expressions, whereas PAT1 and V-H+-ATPase expressions demonstrated a noteworthy increase. This might be due to PER2’s regulatory effect on MCTs via the p53 pathway. The p53 protein acts as an important transcription factor involved in various cellular signaling mechanisms, with its expression influenced by the PER2 protein. It has been reported that PER2 overexpression can enhance p53 expression in vitro [54,98]. High concentrations of butyrate can further upregulate p53 expression, inducing apoptosis in rumen epithelial cells and reducing cell viability [99]. Conversely, P53 has been shown to inhibit MCT1 expression, leading to reduced lactate excretion [100,101].
The investigation we conducted featured a quantitative assessment of gene expression via qRT-PCR, suggesting that the decline in gene expression did not align with reduced cell density. Therefore, it can be speculated that PER2 may regulate MCTs by influencing cell proliferation, growth, development, and the cell cycle in rumen epithelium, ultimately affecting VFA absorption and metabolism. Taken together with earlier findings, it appears that PER2 can modulate the transcription of VFA transport-related factors in rumen epithelial cells, thereby playing a role in regulating SCFA absorption and lipid metabolism.
Understanding the role of the PER2 gene in the rumen presents a significant opportunity to influence livestock management, dietary formulations, and enhance ruminant productivity. PER2 is integral to the regulation of circadian rhythms, which in turn affect metabolic processes. By elucidating how PER2 functions within the rumen’s microbial ecosystem, we can tailor feeding schedules and dietary ingredients to align better with the animals’ natural metabolic cycles. This alignment can improve digestion efficiency and nutrient absorption, potentially leading to faster growth rates and higher milk yields. Additionally, understanding PER2 could help in developing precision feeding strategies that enhance animal health and reduce waste, thereby optimizing overall productivity and sustainability in ruminant farming. [23,102,103,104,105,106,107].
Numerous studies have delved into the roles of circadian clock genes, such as CLOCK, BMAL1, PER, and CRY, in the liver and mammary glands, highlighting their complex involvement in metabolic pathways and physiological regulation [102,103]. In the liver, which serves as a crucial metabolic center, these genes coordinate essential processes including glucose homeostasis, lipid metabolism, and detoxification. Specifically, the PER2 gene, part of the period family, plays a pivotal role in maintaining the feedback loops that regulate these rhythms. It functions as a negative regulator, interacting with other clock proteins to modulate the timing of gene expression involved in metabolic pathways [104,105,106].
Similarly, in the mammary glands, circadian clock genes, including PER2, regulate lactation cycles by controlling the timing of milk synthesis-related gene expression. This regulation directly affects milk quality and production yield, ensuring synchronization with the organism’s biological rhythms. The PER2 protein acts as a crucial component in this regulatory network, influencing the transcription of genes crucial for sustaining lactation cycles within optimal periods [23,107].
Despite these advancements, there is a notable gap in our understanding of the expression and functional impact of circadian clock genes, particularly PER2, within the rumen. The rumen is essential for microbial fermentation and nutrient processing in ruminants. Here, circadian rhythms might play a crucial role, with PER2 potentially influencing the temporal organization of microbial enzyme activity, thereby affecting feed conversion and nutrient absorption [105,108]. Investigating how PER2 and other circadian genes function in the rumen could lead to innovative strategies to improve digestive efficiency, enhance animal health, and boost production outputs. Therefore, research focused on uncovering circadian regulation in the rumen is a pivotal and largely unexplored field with promising potential benefits spanning both scientific inquiry and industrial application [109,110]. Investing in this research area could yield significant insights and advancements in agricultural practices and livestock management, ultimately contributing to better economic and health outcomes for the industry [111].

4. Materials and Methods

4.1. Statement of Ethical Approval

The animal studies in this work followed the ethical norms and protocols approved by the Animal Care and Use Committee (202203-512 Approval) at Yangzhou University, Jiangsu, China.

4.2. Experimental Design

This study aimed to investigate the effects of overexpression of the PER2 gene in rumen epithelial cells. To increase PER2 expression, we employed gene overexpression strategies. The cells were separated into a control group (pcDNA3.1) and an overexpression group (pcDNA3.1-PER2), each with four biological replicates.
After culturing the cells, samples were collected at 24 and 48 h to examine various parameters: cell proliferation, apoptosis, and cell cycle progression. Additionally, we investigated alterations in inflammatory indicators, antioxidant activity, PER2 expression, and proteins involved in volatile fatty acid absorption. Our goal was to learn how the PER2 protein affects the uptake of volatile fatty acids in rumen epithelial cells, particularly in terms of circadian rhythm control.

4.3. Rumen Epithelial Tissue, Cell Total RNA Extraction, and qRT-PCR

The initial digestion of primary cells involved a 3 min treatment with a 0.25% trypsin and 0.02% Na-EDTA solution, followed by a 5 min digestion using fresh trypsin–EDTA solution. The resulting cells were subsequently seeded at 2 × 10⁶ cells/mL, then cultured in a growth medium for passaging. Third-generation cells were obtained within two weeks and progressively cryopreserved at −80 °C in a mixture of 10% DMSO, 50% fetal bovine serum, and 40% DMEM/F12. These stored cells were later revived and cultured to the sixth generation for experimental use, aged under 4 months at the start of the initial experiment.
The rumen epithelial cells (RECs) were isolated from three healthy Guanzhong dairy goats (all females, 1.5 years of age, approximately 45.34 ± 4.28 kg body weight, which is roughly equivalent to a 21-year-old human) using a modified serial trypsin digestion method [112]. The extracted RECs were cultured in a medium composed of DMEM and Nutrient Mixture F-12, enriched with 5% fetal bovine serum, antibiotics (200 U/mL penicillin, 0.2 mg/mL streptomycin, 0.1 mg/mL gentamicin), 5 μg/mL amphotericin B, 1% insulin–transferrin–selenium solution, and 10 ng/mL epidermal growth factor. The culture medium was changed every two days. To maintain REC purity and prevent fibroblast contamination, the cells underwent repeated trypsin digestion and differential attachment processes. Microscopic evaluation confirmed the absence of other cell types. Before the experiments, immunofluorescence staining was used to confirm that the cells were epithelial by detecting the cytokeratin 18 protein. The functionality of the isolated REC was assessed by culturing them with either 0 mM (control) or 15 mM sodium butyrate for 24 h. The treated cells exhibited higher BHB concentrations, demonstrating their ability to metabolize butyrate, a crucial function of REC [113].
The rumen epithelium consists of four distinct layers, with ketogenic enzymes predominantly situated in the mitochondria of stratum basale cells. This observation led researchers to infer that isolated RECs originated from this particular layer. An initial 3 min exposure to a solution comprising 0.25% trypsin and 0.02% Na-EDTA was part of the isolation technique. This was followed by a 5 min treatment with a new trypsin–EDTA solution. Following harvest, the cells were planted in growth media for passage at a density of 2 × 10⁶ cells/mL. After being collected within two weeks, third-generation cells were gradually frozen and stored at −80 °C in a solution that contained 40% DMEM/F12, 50% fetal bovine serum, and 10% DMSO. These cryopreserved cells were later revived and cultured to the sixth generation for experimental purposes, ensuring they were no older than 4 months at the onset of the first experiment.
RNA extraction was conducted using the Trizol method, following a protocol previously established by Wang et al. [114]. To synthesize cDNA, 1 μg of RNA was reverse transcribed using the Tiangen FastQuantc DNA First Strand Synthesis Kit (KR106, Tiangen, Beijing, China) according to the manufacturer’s instructions. Oligo 6 software was utilized to design primers for target genes and internal controls (ACTB and GAPDH), which were subsequently produced by Invitrogen Trading Co. Ltd. (Shanghai, China). Real-time PCR was performed using an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with SuperReal PreMix Plus (SYBR Green) from TIANGEN Biotech Co. Ltd., Beijing, China (FP215). To ensure reliability, each reaction was performed in triplicate. Additional information regarding the RT-PCR procedure can be found in our earlier publication [114]. The specificity of primers was verified through dissociation curve analysis during RT-PCR and further confirmed by agarose gel electrophoresis of PCR products.

4.4. CDS Sequence Cloning

The goat PER2 gene’s CDS was cloned by designing primers based on the full mRNA sequence available on GenBank. The primers used were PER2-F (forward): CCCAAGCTTAGAGCCAGCATGGACGGC and PER2-R (reverse): CCGGAATTCCTAGCGGACGTCGCTGGC. The forward primer included a Hind III digestion site, while the reverse primer included an EcoRI enzyme cleavage site and protective bases. Nanjing Qingke Biotechnology Co., Ltd., Nanjing, China, synthesized these primers. The plasmid structure is shown in (Figure 6a).
The coding sequence (CDS) of the goat PER2 gene was amplified using the cDNA synthesized in the previous step as the template. The PCR reaction mixture (50 μL total) contained PrimeSTAR GXL DNA Polymerase (1 μL, 1.25 U/μL), 5X PrimeSTAR GXL Buffer (10 μL), dNTP Mixture (4 μL, 2.5 mM each), upstream and downstream primers (1.5 μL each), cDNA template (5 μL), and sterilized water to reach the final volume.
PCR conditions included initial pre-denaturation (98 °C, 5 min), followed by 35 cycles of 98 °C for 10 s, 60 °C for 15 s, and 68 °C for 30 s. A final extension (68 °C, 10 min) was performed before termination and storage at 4 °C. The PCR product underwent 1% agarose gel electrophoresis to verify the amplified fragment’s specificity and size.
After confirming successful amplification via gel electrophoresis, the target DNA fragment was cut out from the gel and purified. The PER2 CDS amplification is shown in Figure 6b. The purified product was then ligated into the pMD19-T vector following the addition of an A-tail. A 10 μL portion of the ligation mixture was used to transform E. coli DH5α competent cells. The transformed cells were plated onto selection plates containing 1% ampicillin and incubated overnight at 37 °C.
Following incubation, bacterial colonies were picked, cultured in a shaking incubator, and subjected to PCR screening to identify positive clones. The selected positive clones were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. Based on the sequencing results, positive clones were further verified through digestion and confirmed to have the correct sequence. The successfully constructed T-PER2 plasmid was preserved by mixing the bacterial culture with sterilized 50% glycerol at a 2:3 volume ratio for long-term storage.

4.5. Overexpression Vector (pcDNA3.1-PER2) Construction

To construct the pcDNA3.1-PER2 overexpression vector, the previously constructed T-PER2 plasmid and the pcDNA3.1 vector were digested separately using the restriction enzymes Hind III and EcoRI (Figure 6c). Following digestion, the desired fragments were extracted from the gel and purified. These fragments were then joined using T4 DNA ligase to form the recombinant plasmid. E. coli DH5α competent cells were transformed with the ligation product and cultured on ampicillin-containing screening plates. Colonies were selected based on antibiotic resistance, and positive clones were sequenced to verify correct PER2 gene insertion. Following confirmation by sequencing, the positive clones were used to extract endotoxin-free plasmids. These plasmids were then subjected to enzymatic digestion to verify the successful construction of the pcDNA3.1-PER2 plasmid.
Finally, the successfully constructed plasmid and the corresponding bacterial culture were preserved. The bacterial culture was mixed with sterilized 50% glycerol and stored for long-term use.

4.6. Transient Transfection of Cells

Transient transfection was performed using Lipofectamine™ 2000 transfection reagent (Thermo-fisher, Thousand Oaks, California, USA). Depending on experimental requirements, cells were seeded in 6-well, 24-well, or 96-well plates one day before transfection. When the cells reached approximately 70% to 80% confluency, they were washed with PBS, and an appropriate amount of culture medium or Opti-MEM medium was added. Endotoxin-free plasmids were diluted in a serum-free medium at a ratio of 1:1 to 1:3 (μg plasmid: μL Lipofectamine). The plasmid and Lipofectamine reagent were diluted and mixed in a 1:1 volume ratio before incubating at room temperature for 20 min to produce DNA–lipid complexes. These complexes were added to cells in well plates, with four replicates per experimental group. After 3 to 6 h of incubation, the transfection medium was replaced with a full-growth medium. The cells were then grown for 24 to 48 h before being used in further tests.

4.7. Cell Proliferation Viability Detection

The CCK8 kit was utilized to evaluate cell proliferation. Cells were distributed in 96-well plates, with 100 μL per well. The experiment had two groups, control (pcDNA3.1) and overexpression (pcDNA3.1-PER2), each with four replicate wells. After 24–48 h of the incubation process, each well was filled with 10 μL of CCK8. The plates were gently stirred to achieve even reagent dispersion and then incubated in a cell culture incubator for two hours. To assess cell growth rates, the absorbance at 450 nm was measured using a microplate reader following incubation.

4.8. Apoptosis Detection

Cells were kept in 6-well plates and segregated into two separate experimental classifications: the control classification (pcDNA3.1) and the overexpression classification (pcDNA3.1-PER2). Subsequent to finishing the treatment, cell pellets were acquired and went through two washes using cold phosphate-buffered saline (PBS). To investigate apoptosis, the cell pellet was rehydrated in 100 μL of 1× Binding Buffer to yield a uniform single-cell suspension. Subsequently, the suspension received 5 μL of the staining solutions, which were Annexin V-FITC and propidium iodide (PI). The resultant mixture was meticulously homogenized, shielded from photonic exposure, and allowed to incubate at ambient temperature for a duration of 10 min. Following this incubation period, 400 μL of 1× Binding Buffer was introduced to the cell suspension. The sample was gently mixed and analyzed by flow cytometry within 1 h to assess apoptosis levels.

4.9. Detection of Related Genes

To detect the expression of apoptosis-related genes, primers were designed using the NCBI Primer-BLAST tool. The target genes for this analysis included BCL2, CASPASE3, CASPASE8, CASPASE9, p53, p21, BAX, CASPASE6 and CASPASE7.

4.10. Cellular Reactive Oxygen Species, (ROS) Detection

To measure intracellular levels of reactive oxygen species (ROS), we used a reactive oxygen species detection kit. The ROS detection kit was sourced from Thermo Fisher Scientific, with catalog number D399. Cells were seeded at a density of 2 × 105 cells/mL in 6-well plates, with both control (pcDNA3.1) and overexpression (pcDNA3.1-PER2) groups prepared. After the designated treatment period, the medium was removed, and the cells were washed twice with PBS. Then, 1 mL of 10 μmol/L DCFH-DA working solution, freshly prepared and protected from light to prevent degradation, was added to each well. Cells were exposed to DCFH-DA solution at 37 °C for 20 min. Post-incubation, the solution was extracted, and the cells underwent three washes with serum-free medium to remove excess dye. The fluorescence was then observed using a laser confocal microscope to assess ROS levels within the cells.

4.11. Detection of Lactate Dehydrogenase (LDH) Activity in Cells

To assess the enzymatic performance of lactate dehydrogenase (LDH), cellular samples were placed into 6-well plates at a concentration of 3 × 105 cells in each well, including three replicates’ samples for every experimental group. The experimental groups included untransfected cells, pcDNA3.1-transfected cells (serving as the maximum enzyme activity control), and pcDNA3.1-PER2-transfected cells. These plates were incubated at 37 °C with 5% CO2 for the specific experimental time. One hour prior to the measurement phase, the cell culture plates were withdrawn from the incubator, and an LDH release reagent was introduced into the wells intended for the maximal enzyme activity control at a volume corresponding to 10% of the initial culture volume. The reagent was thoroughly mixed by pipetting, and the plates were returned to the incubator for continued reaction. Following the incubation period, 120 μL of the liquid from all wells was moved to a fresh 96-well plate, followed by the addition of 60 μL of LDH detection solution. The plate was subsequently covered to exclude light exposure and maintained at ambient temperature for a duration of 30 min.

4.12. Detection of Antioxidant Properties of Cells

To evaluate the antioxidant properties of the cells, we used an antioxidant detection kit from Nanjing Jiancheng Company, Nanjing, China. The procedure was performed according to the manufacturer’s instructions to ensure accurate and reliable results. Each step was carefully followed as outlined in the product guidelines to effectively assess the antioxidant capacity of the cells.

4.13. Statistical Analysis

FlowJo V10 software was used to interpret the flow cytometry results for apoptosis data. Cell cycle data were analyzed using ModFit LT software version 6.0 (https://www.vsh.com/products/mflt, accessed on 4 November 2024) to accurately assess cell cycle distributions. Statistical analysis and graphical representation of the data were performed using SPSS 25.0, Excel 2016, and GraphPad Prism software. These tools facilitated comprehensive statistical evaluation and the creation of informative charts and graphs to effectively present the research findings.

5. Conclusions

The circadian clock genes are highly expressed in cultured (REC) rumen epithelial cells. This study indicates that elevated levels of PER2 within these cells significantly promote apoptosis while simultaneously inhibiting cellular proliferation. This effect is achieved through the upregulation of pro-apoptotic genes like CASP6 and BAX and the downregulation of the anti-apoptotic gene BCL2. The overexpression of PER2 modulates the transcriptional activity of key genes associated with the cell cycle, highlighting its crucial role in balancing cell proliferation and apoptosis. These findings underscore the significant regulatory functions of PER2 within cellular mechanisms and provide a strong foundation for further investigations into its underlying processes.

Author Contributions

All authors were involved in the preparation of the manuscript. R.A.: methodology, collection and analysis of data, preparation of figures, writing—original draft. Y.Z. (Yongkang Zheng): software utilization, data analysis, figure preparation, and construction of the database. X.Z.: collection and analysis of data, preparation of figures. J.L.: software utilization, data analysis, figure preparation. C.Z.: software utilization, data analysis, figure preparation. J.M.: software utilization, data analysis, figure preparation. Y.Z. (Yuhong Zhong): software utilization, data analysis, figure preparation. H.M.H.: methodology, software utilization, data analysis, revising the manuscript. A.A.S.: methodology, software utilization, data analysis, drafting, revising the manuscript, and editing. M.W.: conceptualization, design, project administration, supervision, interpretation, funding acquisition, drafting, and revising the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Ministry of Science and Technology High-end Foreign Expert Project (G2023014066L), the National 14th Five-Year Plan Key Research and Development Program (2023YFD1301705), and the Bintuan Agricultural Innovation Project (NCG202232) and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Institutional Review Board Statement

The animal experiments conducted in this study adhered to protocols sanctioned by the Animal Care and Use Committee (IACUC) of Yangzhou University, China.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this manuscript and its information files.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhou, Q.; Wang, R.; Su, Y.; Wang, B.; Zhang, Y.; Qin, X. The Molecular Circadian Rhythms Regulating the Cell Cycle. J. Cell. Biochem. 2024, 125, e30539. [Google Scholar] [CrossRef] [PubMed]
  2. Mortimer, T.; Zinna, V.M.; Atalay, M.; Laudanna, C.; Deryagin, O.; Posas, G.; Smith, J.G.; García-Lara, E.; Vaca-Dempere, M.; Monteiro de Assis, L.V.; et al. The Epidermal Circadian Clock Integrates and Subverts Brain Signals to Guarantee Skin Homeostasis. Cell Stem Cell 2024, 31, 834–849.e4. [Google Scholar] [CrossRef] [PubMed]
  3. Luo, B.; Song, J.; Zhang, J.; Han, J.; Zhou, X.; Chen, L. The Contribution of Circadian Clock to the Biological Processes. Front. Mol. Biosci. 2024, 11, 1387576. [Google Scholar] [CrossRef] [PubMed]
  4. He, Q.; Qu, B.; Chen, Y.; Liu, L.; Zhao, C.; Li, Y.; Xu, X.; Luo, X.; Jin, F. The Circadian Clock Gene BMAL1 Increases Radiosensitivity in Nasopharyngeal Carcinoma Cell CNE2. J. Radiat. Res. Appl. Sci. 2024, 17, 100933. [Google Scholar] [CrossRef]
  5. Schrader, L.A.; Ronnekleiv-Kelly, S.M.; Hogenesch, J.B.; Bradfield, C.A.; Malecki, K.M.C. Circadian Disruption, Clock Genes, and Metabolic Health. J. Clin. Investig. 2024, 134, e170998. [Google Scholar] [CrossRef]
  6. Newbold, C.J.; Ramos-Morales, E. Review: Ruminal Microbiome and Microbial Metabolome: Effects of Diet and Ruminant Host. Animal 2020, 14, s78–s86. [Google Scholar] [CrossRef]
  7. Liu, K.; Zhang, Y.; Yu, Z.; Xu, Q.; Zheng, N.; Zhao, S.; Huang, G.; Wang, J. Ruminal Microbiota–Host Interaction and Its Effect on Nutrient Metabolism. Anim. Nutr. 2021, 7, 49–55. [Google Scholar] [CrossRef]
  8. Choi, H.; Rao, M.C.; Chang, E.B. Gut Microbiota as a Transducer of Dietary Cues to Regulate Host Circadian Rhythms and Metabolism. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 679–689. [Google Scholar] [CrossRef]
  9. Butler, T.D.; Gibbs, J.E. Circadian Host-Microbiome Interactions in Immunity. Front. Immunol. 2020, 11, 1783. [Google Scholar] [CrossRef]
  10. Fonseca, P.A.S.; Suárez-Vega, A.; Pelayo, R.; Marina, H.; Alonso-García, M.; Gutiérrez-Gil, B.; Arranz, J.-J. Intergenerational Impact of Dietary Protein Restriction in Dairy Ewes on Epigenetic Marks in the Perirenal Fat of Their Suckling Lambs. Sci. Rep. 2023, 13, 4351. [Google Scholar] [CrossRef]
  11. Bonmatí-Carrión, M.-Á.; Rol, M.-A. Melatonin as a Mediator of the Gut Microbiota–Host Interaction: Implications for Health and Disease. Antioxidants 2023, 13, 34. [Google Scholar] [CrossRef] [PubMed]
  12. McKee, C.A.; Polino, A.J.; King, M.W.; Musiek, E.S. Circadian Clock Protein BMAL1 Broadly Influences Autophagy and Endolysosomal Function in Astrocytes. Proc. Natl. Acad. Sci. USA 2023, 120, e2220551120. [Google Scholar] [CrossRef] [PubMed]
  13. Kwak, J.S.; León-Tapia, M.Á.; Diblasi, C.; Manousi, D.; Grønvold, L.; Sandvik, G.K.; Saitou, M. Functional and Regulatory Diversification of Period Genes Responsible for Circadian Rhythm in Vertebrates. G3 2024, 14, jkae162. [Google Scholar] [CrossRef]
  14. Cao, Q.; Gery, S.; Dashti, A.; Yin, D.; Zhou, Y.; Gu, J.; Koeffler, H.P. A Role for the Clock Gene Per1 in Prostate Cancer. Cancer Res. 2009, 69, 7619–7625. [Google Scholar] [CrossRef]
  15. Kaneshiro, K.; Nakagawa, K.; Tsukamoto, H.; Matsuoka, G.; Okuno, S.; Tateishi, K.; Terashima, Y.; Shibanuma, N.; Yoshida, K.; Hashiramoto, A. The Clock Gene Bmal1 Controls Inflammatory Mediators in Rheumatoid Arthritis Fibroblast-like Synoviocytes. Biochem. Biophys. Res. Commun. 2024, 691, 149315. [Google Scholar] [CrossRef] [PubMed]
  16. Taleb, Z.; Haireek, M.; Stokes, K.; Wang, H.; Collins, S.; Khan, W.; Karpowicz, P. A30 epithelial function of the circadian clock gene, bmal1, is necessary for colonic regeneration. J. Can. Assoc. Gastroenterol. 2023, 6 (Suppl. 1), 16. [Google Scholar] [CrossRef]
  17. Herrera, J.; Button, M.; Doherty-Haigh, P.; Goldfarb, C.; Quteishat, N.; Amir, S.; Schoettner, K. Circadian Clock Genes Bmal1 and Per2 in the Nucleus Accumbens Are Negative Regulators of Alcohol-Drinking Behavior in Mice. bioRxiv 2023. [Google Scholar] [CrossRef]
  18. Yang, X.; Wood, P.A.; Oh, E.-Y.; Du-Quiton, J.; Ansell, C.M.; Hrushesky, W.J.M. Down Regulation of Circadian Clock Gene Period 2 Accelerates Breast Cancer Growth by Altering Its Daily Growth Rhythm. Breast Cancer Res. Treat. 2009, 117, 423–431. [Google Scholar] [CrossRef]
  19. Wang, Q.; Ao, Y.; Yang, K.; Tang, H.; Chen, D. Circadian Clock Gene Per2 Plays an Important Role in Cell Proliferation, Apoptosis and Cell Cycle Progression in Human Oral Squamous Cell Carcinoma. Oncol. Rep. 2016, 35, 3387–3394. [Google Scholar] [CrossRef]
  20. Grimaldi, B.; Bellet, M.M.; Katada, S.; Astarita, G.; Hirayama, J.; Amin, R.H.; Granneman, J.G.; Piomelli, D.; Leff, T.; Sassone-Corsi, P. PER2 Controls Lipid Metabolism by Direct Regulation of PPARγ. Cell Metab. 2010, 12, 509–520. [Google Scholar] [CrossRef]
  21. Tang, S.; Liu, Z.; Deng, F.; Xu, Y.; Zhong, R.; Chen, L.; Zhang, H. Ammonia Exposure-Triggered Redox Imbalance with the Occurrence of Inflammatory Response, Cell Apoptosis, and the Circadian Clock Disturbance Leads to Lung Injury in Growing Pigs. Air Qual. Atmos. Health 2024, 1–19. [Google Scholar] [CrossRef]
  22. Coming, J.T. Environmental Implications of Modern Food Production: An Analysis for the Conscious Consumer. Master’s Thesis, California Polytechnic State University Humboldt, Arcata, CA, USA, 2024. [Google Scholar]
  23. Casey, T.M.; Plaut, K. Lactation Biology Symposium: Circadian Clocks as Mediators of the Homeorhetic Response to Lactation1. J. Anim. Sci. 2012, 90, 744–754. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, M.; Zhou, Z.; Khan, M.J.; Gao, J.; Loor, J.J. Clock Circadian Regulator (CLOCK) Gene Network Expression Patterns in Bovine Adipose, Liver, and Mammary Gland at 3 Time Points during the Transition from Pregnancy into Lactation. J. Dairy Sci. 2015, 98, 4601–4612. [Google Scholar] [CrossRef]
  25. Wang, M.; Jing, Y.; Hu, L.; Gao, J.; Ding, L.; Zhang, J. Recent Advances on the Circadian Gene PER2 and Metabolic Rhythm of Lactation of Mammary Gland. Anim. Nutr. 2015, 1, 257–261. [Google Scholar] [CrossRef] [PubMed]
  26. Hu, L.Y.; Wang, M.Z.; Ouyang, J.L.; Li, P.F.; Loor, J.J. Rapid Communication: Period2 Gene Silencing Increases the Synthesis of As–Casein Protein in Bovine Mammary Epithelial Cells1. J. Anim. Sci. 2017, 95, 4510–4513. [Google Scholar] [CrossRef]
  27. Bhatnagar, A.; Puppala, A.; Rankawat, S.; Ray, S.; Ray, S. Role of Circadian Rhythms in Metabolic Syndrome. In Metabolic Syndrome; Elsevier: Amsterdam, The Netherlands, 2024; pp. 199–218. [Google Scholar]
  28. de Barros Dantas, L.L.; Eldridge, B.M.; Dorling, J.; Dekeya, R.; Lynch, D.A.; Dodd, A.N. Circadian Regulation of Metabolism across Photosynthetic Organisms. Plant J. 2023, 116, 650–668. [Google Scholar] [CrossRef]
  29. Ansermet, C.; Centeno, G.; Bignon, Y.; Ortiz, D.; Pradervand, S.; Garcia, A.; Menin, L.; Gachon, F.; Yoshihara, H.A.I.; Firsov, D. Dysfunction of the Circadian Clock in the Kidney Tubule Leads to Enhanced Kidney Gluconeogenesis and Exacerbated Hyperglycemia in Diabetes. Kidney Int. 2022, 101, 563–573. [Google Scholar] [CrossRef]
  30. Sussman, W.; Stevenson, M.; Mowdawalla, C.; Mota, S.; Ragolia, L.; Pan, X. BMAL1 Controls Glucose Uptake through Paired-Homeodomain Transcription Factor 4 in Differentiated Caco-2 Cells. Am. J. Physiol. Cell Physiol. 2019, 317, C492–C501. [Google Scholar] [CrossRef]
  31. Lu, D.; Chen, M.; Wang, Y.; Chen, M.; Wu, B. Circadian Clock and Uptake Transporters. In Circadian Pharmacokinetics; Springer: Singapore, 2020; pp. 131–158. [Google Scholar] [CrossRef]
  32. Gao, J.; Xu, Q.; Wang, M.; Ouyang, J.; Tian, W.; Feng, D.; Liang, Y.; Jiang, B.; Loor, J.J. Ruminal Epithelial Cell Proliferation and Short-Chain Fatty Acid Transporters in Vitro Are Associated with Abundance of Period Circadian Regulator 2 (PER2). J. Dairy Sci. 2020, 103, 12091–12103. [Google Scholar] [CrossRef]
  33. Zhao, C.; Meng, X.; Li, Y.; Liu, L.; He, Q.; Jiang, J.; Chen, Y.; Li, X.; Li, Y.; Tang, Y.; et al. Circadian Clock Gene BMAL1 Inhibits the Proliferation and Tumor-Formation Ability of Nasopharyngeal Carcinoma Cells and Increases the Sensitivity of Radiotherapy. Chronobiol. Int. 2022, 39, 1340–1351. [Google Scholar] [CrossRef]
  34. Panda, S. Circadian Physiology of Metabolism. Science 2016, 354, 1008–1015. [Google Scholar] [CrossRef] [PubMed]
  35. Zhou, X.; Wan, D.; Zhang, Y.; Zhang, Y.; Long, C.; Chen, S.; He, L.; Tan, B.; Wu, X.; Yin, Y. Diurnal Variations in Polyunsaturated Fatty Acid Contents and Expression of Genes Involved in Their de Novo Synthesis in Pigs. Biochem. Biophys. Res. Commun. 2017, 483, 430–434. [Google Scholar] [CrossRef] [PubMed]
  36. Xie, C.; Duan, X.; Long, C.; Wu, X. Hepatic Lipid Metabolism Is Affected by a Daily 3-Meal Pattern with Varying Dietary Crude Protein with a Pig Model. Anim. Nutr. 2020, 6, 16–23. [Google Scholar] [CrossRef] [PubMed]
  37. Wu, X.; Xie, C.; Long, C.; Li, J.; Zhou, X.; Fan, Z.; Blachier, F.; Yin, Y. Effects of a Daily Three-meal Pattern with Different Dietary Protein Contents on Pig Growth Performance, Carcass and Muscle Quality Traits. J. Sci. Food Agric. 2018, 98, 415–421. [Google Scholar] [CrossRef]
  38. Cardoso, T.F.; Quintanilla, R.; Tibau, J.; Gil, M.; Mármol-Sánchez, E.; González-Rodríguez, O.; González-Prendes, R.; Amills, M. Nutrient Supply Affects the MRNA Expression Profile of the Porcine Skeletal Muscle. BMC Genom. 2017, 18, 603. [Google Scholar] [CrossRef]
  39. Shinomiya, A.; Shimmura, T.; Nishiwaki-Ohkawa, T.; Yoshimura, T. Regulation of Seasonal Reproduction by Hypothalamic Activation of Thyroid Hormone. Front. Endocrinol. 2014, 5, 12. [Google Scholar] [CrossRef]
  40. Dardente, H.; Wyse, C.A.; Lincoln, G.A.; Wagner, G.C.; Hazlerigg, D.G. Effects of Photoperiod Extension on Clock Gene and Neuropeptide RNA Expression in the SCN of the Soay Sheep. PLoS ONE 2016, 11, e0159201. [Google Scholar] [CrossRef] [PubMed]
  41. Wagner, G.C.; Johnston, J.D.; Clarke, I.J.; Lincoln, G.A.; Hazlerigg, D.G. Redefining the Limits of Day Length Responsiveness in a Seasonal Mammal. Endocrinology 2008, 149, 32–39. [Google Scholar] [CrossRef]
  42. Lincoln, G.; Messager, S.; Andersson, H.; Hazlerigg, D. Temporal Expression of Seven Clock Genes in the Suprachiasmatic Nucleus and the Pars Tuberalis of the Sheep: Evidence for an Internal Coincidence Timer. Proc. Natl. Acad. Sci. USA 2002, 99, 13890–13895. [Google Scholar] [CrossRef]
  43. Johnston, J.D.; Bashforth, R.; Diack, A.; Andersson, H.; Lincoln, G.A.; Hazlerigg, D.G. Rhythmic Melatonin Secretion Does Not Correlate with the Expression of Arylalkylamine N-ACETYLTRANSFERASE, Inducible Cyclic Amp Early Repressor, Period1 or Cryptochrome1 MRNA in the Sheep Pineal. Neuroscience 2004, 124, 789–795. [Google Scholar] [CrossRef]
  44. Shimizu, T.; Hirai, Y.; Murayama, C.; Miyamoto, A.; Miyazaki, H.; Miyazaki, K. Circadian Clock Genes Per2 and Clock Regulate Steroid Production, Cell Proliferation, and Luteinizing Hormone Receptor Transcription in Ovarian Granulosa Cells. Biochem. Biophys. Res. Commun. 2011, 412, 132–135. [Google Scholar] [CrossRef] [PubMed]
  45. Ginther, O.J.; Pinaffi, F.L.V.; Khan, F.A.; Duarte, L.F.; Beg, M.A. Circadian Influence on the Preovulatory LH Surge, Ovulation, and Prolactin Concentrations in Heifers. Theriogenology 2013, 79, 528–533. [Google Scholar] [CrossRef]
  46. Plaut, K.; Casey, T. Does the Circadian System Regulate Lactation? Animal 2012, 6, 394–402. [Google Scholar] [CrossRef] [PubMed]
  47. Peters, R.R.; Chapin, L.T.; Leining, K.B.; Tucker, H.A. Supplemental Lighting Stimulates Growth and Lactation in Cattle. Science 1978, 199, 911–912. [Google Scholar] [CrossRef] [PubMed]
  48. Peters, R.R.; Chapin, L.T.; Emery, R.S.; Tucker, H.A. Milk Yield, Feed Intake, Prolactin, Growth Hormone, and Glucocorticoid Response of Cows to Supplemented Light. J. Dairy. Sci. 1981, 64, 1671–1678. [Google Scholar] [CrossRef]
  49. Dahl, G.E. Effects of Short Day Photoperiod on Prolactin Signaling in Dry Cows: A Common Mechanism among Tissues and Environments? J. Anim. Sci. 2008, 86 (Suppl. 13), 10–14. [Google Scholar] [CrossRef]
  50. Sanchez-Barcelo, E.J.; Mediavilla, M.D.; Zinn, S.A.; Buchanan, B.A.; Chapin, L.T.; Allen Tucker, H. Melatonin Suppression of Mammary Growth in Heifers. Biol. Reprod. 1991, 44, 875–879. [Google Scholar] [CrossRef]
  51. Niu, M.; Ying, Y.; Bartell, P.A.; Harvatine, K.J. The Effects of Feeding Time on Milk Production, Total-Tract Digestibility, and Daily Rhythms of Feeding Behavior and Plasma Metabolites and Hormones in Dairy Cows. J. Dairy Sci. 2014, 97, 7764–7776. [Google Scholar] [CrossRef]
  52. Zhanfeng, N.; Chengquan, W.; Hechun, X.; Jun, W.; Lijian, Z.; Dede, M.; Wenbin, L.; Lei, Y. Period2 Downregulation Inhibits Glioma Cell Apoptosis by Activating the MDM2-TP53 Pathway. Oncotarget 2016, 7, 27350. [Google Scholar] [CrossRef]
  53. Tan, X.-M.; Ye, H.; Yang, K.; Chen, D.; Wang, Q.-Q.; Tang, H.; Zhao, N.-B. Circadian Variations of Clock Gene Per2 and Cell Cycle Genes in Different Stages of Carcinogenesis in Golden Hamster Buccal Mucosa. Sci. Rep. 2015, 5, 9997. [Google Scholar] [CrossRef]
  54. Hua, H.; Wang, Y.; Wan, C.; Liu, Y.; Zhu, B.; Yang, C.; Wang, X.; Wang, Z.; Cornelissen–Guillaume, G.; Halberg, F. Circadian Gene MPer2 Overexpression Induces Cancer Cell Apoptosis. Cancer Sci. 2006, 97, 589–596. [Google Scholar] [CrossRef] [PubMed]
  55. Sun, C.; Huang, S.; Zeng, J.; Liu, D.; Xiao, Q.; Tian, W.; Zhu, X.; Huang, Z.; Feng, W. Per2 Inhibits K562 Leukemia Cell Growth in Vitro and in Vivo through Cell Cycle Arrest and Apoptosis Induction. Pathol. Oncol. Res. 2010, 16, 403–411. [Google Scholar] [CrossRef] [PubMed]
  56. Gery, S.; Komatsu, N.; Baldjyan, L.; Yu, A.; Koo, D.; Koeffler, H.P. The Circadian Gene Per1 Plays an Important Role in Cell Growth and DNA Damage Control in Human Cancer Cells. Mol. Cell 2006, 22, 375–382. [Google Scholar] [CrossRef] [PubMed]
  57. Gery, S.; Komatsu, N.; Kawamata, N.; Miller, C.W.; Desmond, J.; Virk, R.K.; Marchevsky, A.; Mckenna, R.; Taguchi, H.; Koeffler, H.P. Epigenetic Silencing of the Candidate Tumor Suppressor Gene Per1 in Non–Small Cell Lung Cancer. Clin. Cancer Res. 2007, 13, 1399–1404. [Google Scholar] [CrossRef]
  58. Osorio, J.S.; Vailati-Riboni, M.; Palladino, A.; Luo, J.; Loor, J.J. Application of Nutrigenomics in Small Ruminants: Lactation, Growth, and Beyond. Small Rumin. Res. 2017, 154, 29–44. [Google Scholar] [CrossRef]
  59. Pavithra, S.; Aich, A.; Chanda, A.; Zohra, I.F.; Gawade, P.; Das, R.K. PER2 Gene and Its Association with Sleep-Related Disorders: A Review. Physiol. Behav. 2024, 273, 114411. [Google Scholar] [CrossRef]
  60. Savvidis, C.; Kallistrou, E.; Kouroglou, E.; Dionysopoulou, S.; Gavriiloglou, G.; Ragia, D.; Tsiama, V.; Proikaki, S.; Belis, K.; Ilias, I. Circadian Rhythm Disruption and Endocrine-Related Tumors. World J. Clin. Oncol. 2024, 15, 818–834. [Google Scholar] [CrossRef]
  61. Chen, K.; Wang, Y.; Li, D.; Wu, R.; Wang, J.; Wei, W.; Zhu, W.; Xie, W.; Feng, D.; He, Y. Biological Clock Regulation by the PER Gene Family: A New Perspective on Tumor Development. Front. Cell Dev. Biol. 2024, 12, 1332506. [Google Scholar] [CrossRef]
  62. Liu, H.; Liu, Y.; Hai, R.; Liao, W.; Luo, X. The Role of Circadian Clocks in Cancer: Mechanisms and Clinical Implications. Genes Dis. 2023, 10, 1279–1290. [Google Scholar] [CrossRef]
  63. El-Hennamy, R.E.; Elmasry, H.A. Alterations in Per2, Bcl2 Gene Expression, and Oxidative Status in Aged Rats Liver after Light Pulse at Night. Sleep Biol. Rhythm. 2024, 22, 181–190. [Google Scholar] [CrossRef]
  64. Wang, Q.; Liu, H.; Wang, Z.; Chen, Y.; Zhou, S.; Hu, X.; Xu, Y.; Zhang, X.; Wang, Y.; Gao, Y.; et al. Circadian Gene Per3 Promotes Astroblastoma Progression through the P53/BCL2/BAX Signalling Pathway. Gene 2024, 895, 147978. [Google Scholar] [CrossRef] [PubMed]
  65. Liu, H.; Gong, X.; Yang, K. Overexpression of the Clock Gene Per2 Suppresses Oral Squamous Cell Carcinoma Progression by Activating Autophagy via the PI3K/AKT/MTOR Pathway. J. Cancer 2020, 11, 3655. [Google Scholar] [CrossRef] [PubMed]
  66. Jia, J. Effect of Rhythm Gene PER2 Silencing on Mammary Epithelial Cell Proliferation and Milk Fat Synthesis in Dairy Cows. Master’s Thesis, Yangzhou University, Yangzhou, China, 2018. [Google Scholar]
  67. Cheng, J.; Pei, J.; Xu, Q.; Gao, J.; Xi, Z.; Ouyang, J.; Wang, M.; Yin, J.; Zhang, W. Effect of Supplementation of Short-Fatty Acid on PER2 and Genes Related to Volatile Fatty Acid in Isolated Goat Ruminal Epithelial Tissue. Pak. J. Zool. 2023, 1–9. [Google Scholar] [CrossRef]
  68. Hua, H.; Wang, Y.; Wan, C.; Liu, Y.; Zhu, B.; Wang, X.; Wang, Z.; Ding, J.M. Inhibition of Tumorigenesis by Intratumoral Delivery of the Circadian Gene MPer2 in C57BL/6 Mice. Cancer Gene Ther. 2007, 14, 815–818. [Google Scholar] [CrossRef]
  69. Yang, W.; Shen, Z.; Martens, H. An Energy-Rich Diet Enhances Expression of Na+/H+ Exchanger Isoform 1 and 3 Messenger RNA in Rumen Epithelium of Goat. J. Anim. Sci. 2012, 90, 307–317. [Google Scholar] [CrossRef]
  70. Ai, Y.; Meng, Y.; Yan, B.; Zhou, Q.; Wang, X. The Biochemical Pathways of Apoptotic, Necroptotic, Pyroptotic, and Ferroptotic Cell Death. Mol. Cell 2024, 84, 170–179. [Google Scholar] [CrossRef]
  71. Ghorbani, N.; Yaghubi, R.; Davoodi, J.; Pahlavan, S. How Does Caspases Regulation Play Role in Cell Decisions? Apoptosis and Beyond. Mol. Cell. Biochem. 2024, 479, 1599–1613. [Google Scholar] [CrossRef] [PubMed]
  72. Atroosh, F.; AL-Habori, M.; Al-Eryani, E.; Saif-Ali, R. Impact of Khat (Catha Edulis) and Oral Contraceptive Use on Telomerase Levels and Tumor Suppressor Genes P53 and P21 in Normal Subjects and Breast Cancer Patients. Sci. Rep. 2024, 14, 16365. [Google Scholar] [CrossRef]
  73. Jia, X.; Wang, Y.; Cui, J.; Li, Y.; Wu, W.; Zhang, X.; Wang, J. Ochratoxin A-Induced DNA Damage Triggers G2 Phase Arrest via HMLH1-P53-P21 Signaling Pathway in Human Gastric Epithelium Immortalized Cells in Vitro. Toxicol. Lett. 2024, 400, 42–48. [Google Scholar] [CrossRef]
  74. Hill, R.J.; Bona, N.; Smink, J.; Webb, H.K.; Crisp, A.; Garaycoechea, J.I.; Crossan, G.P. P53 Regulates Diverse Tissue-Specific Outcomes to Endogenous DNA Damage in Mice. Nat. Commun. 2024, 15, 2518. [Google Scholar] [CrossRef]
  75. Zhu, J.; Zhou, T.; Menggen, M.; Aimulajiang, K.; Wen, H. Ghrelin Regulating Liver Activity and Its Potential Effects on Liver Fibrosis and Echinococcosis. Front. Cell. Infect. Microbiol. 2024, 13, 1324134. [Google Scholar] [CrossRef] [PubMed]
  76. Magnone, M.C.; Langmesser, S.; Bezdek, A.C.; Tallone, T.; Rusconi, S.; Albrecht, U. The Mammalian Circadian Clock Gene Per2 Modulates Cell Death in Response to Oxidative Stress. Front. Neurol. 2015, 5, 289. [Google Scholar] [CrossRef] [PubMed]
  77. Jiang, H.; Yang, X.; Mi, M.; Wei, X.; Wu, H.; Xin, Y.; Sun, C. PER2: A Potential Molecular Marker for Hematological Malignancies. Mol. Biol. Rep. 2021, 48, 7587–7595. [Google Scholar] [CrossRef] [PubMed]
  78. Hafner, A.; Bulyk, M.L.; Jambhekar, A.; Lahav, G. The Multiple Mechanisms That Regulate P53 Activity and Cell Fate. Nat. Rev. Mol. Cell Biol. 2019, 20, 199–210. [Google Scholar] [CrossRef] [PubMed]
  79. Kasprzak, A. Prognostic Biomarkers of Cell Proliferation in Colorectal Cancer (CRC): From Immunohistochemistry to Molecular Biology Techniques. Cancers 2023, 15, 4570. [Google Scholar] [CrossRef]
  80. Soták, M.; Sumová, A.; Pácha, J. Cross-Talk between the Circadian Clock and the Cell Cycle in Cancer. Ann. Med. 2014, 46, 221–232. [Google Scholar] [CrossRef]
  81. Colon, T.; Kou, Z.; Choi, B.H.; Tran, F.; Zheng, E.; Dai, W. Enzyme-Independent Role of EZH2 in Regulating Cell Cycle Progression via the SKP2-KIP/CIP Pathway. Sci. Rep. 2024, 14, 13389. [Google Scholar]
  82. Roy, R.; Gampa, S.C.; Garimella, S.V. Role of Specific CDKs in Regulating DNA Damage Repair Responses and Replication Stress. Curr. Opin. Pharmacol. 2024, 79, 102485. [Google Scholar] [CrossRef]
  83. Lossaint, G.; Horvat, A.; Gire, V.; Bačević, K.; Mrouj, K.; Charrier-Savournin, F.; Georget, V.; Fisher, D.; Dulić, V. Reciprocal regulation of p21 and Chk1 controls the Cyclin D1-RB pathway to mediate senescence onset after G2 arrest. J. Cell Sci. 2022, 135, jcs259114. [Google Scholar] [CrossRef]
  84. Goel, B.; Tripathi, N.; Bhardwaj, N.; Jain, S.K. Small molecule CDK inhibitors for the therapeutic management of cancer. Curr. Top. Med. Chem. 2020, 20, 1535–1563. [Google Scholar] [CrossRef]
  85. Zeng, Y.; Guo, Z.; Wu, M.; Chen, F.; Chen, L. Circadian rhythm regulates the function of immune cells and participates in the development of tumors. Cell Death Discov. 2024, 10, 199. [Google Scholar] [CrossRef] [PubMed]
  86. Xu, H.; Huang, L.; Zhao, J.; Chen, S.; Liu, J.; Li, G. The Circadian Clock and Inflammation: A New Insight. Clin. Chim. Acta 2021, 512, 12–17. [Google Scholar] [CrossRef] [PubMed]
  87. Lin, Y.; He, L.; Cai, Y.; Wang, X.; Wang, S.; Li, F. The Role of Circadian Clock in Regulating Cell Functions: Implications for Diseases. MedComm 2024, 5, e504. [Google Scholar] [CrossRef]
  88. Luo, Y.; Zhang, G.; Hu, C.; Huang, L.; Wang, D.; Chen, Z.; Wang, Y. The Role of Natural Products from Herbal Medicine in TLR4 Signaling for Colorectal Cancer Treatment. Molecules 2024, 29, 2727. [Google Scholar] [CrossRef]
  89. Muthukumarasamy, I.; Buel, S.M.; Hurley, J.M.; Dordick, J.S. NOX2 Inhibition Enables Retention of the Circadian Clock in BV2 Microglia and Primary Macrophages. Front. Immunol. 2023, 14, 1106515. [Google Scholar] [CrossRef]
  90. Tung, C.-L.; Wu, J.-H.; Chang, H.-C.; Xu, J.-W.; Yang, Y.-C.S.H.; Wu, C.W.; Tung, Y.-T. Effects of Black Soybean Seed Coat (BSSC) Crude Extract on the Immune Regulation, Gut Microbiota, and Brain Function of Mice with Sleep Deprivation. J. Funct. Foods 2024, 119, 106335. [Google Scholar] [CrossRef]
  91. Pácha, J.; Sumová, A. Circadian Regulation of Epithelial Functions in the Intestine. Acta Physiol. 2013, 208, 11–24. [Google Scholar] [CrossRef]
  92. de Oliveira Melo, N.C.; Cuevas-Sierra, A.; Souto, V.F.; Martínez, J.A. Biological Rhythms, Chrono-Nutrition, and Gut Microbiota: Epigenomics Insights for Precision Nutrition and Metabolic Health. Biomolecules 2024, 14, 559. [Google Scholar] [CrossRef]
  93. Chen, Y.; Jing, Y.; Hu, L.; Xi, Z.; Lu, Z.; Loor, J.J.; Wang, M. Overexpression of PER2 Promotes De Novo Fatty Acid Synthesis, Fatty Acid Desaturation, and Triglyceride Accumulation in Bovine Mammary Epithelial Cells. Int. J. Mol. Sci. 2024, 25, 9785. [Google Scholar] [CrossRef]
  94. Kinoshita, Y.; Takahashi, H.; Katsumata, M. Circadian Rhythms of the MRNA Abundances of Clock Genes and Glucose Transporters in the Jejunum of Weanling-growing Pigs. Vet. Med. Sci. 2022, 8, 1113–1118. [Google Scholar] [CrossRef]
  95. Gooley, J.J. Circadian Regulation of Lipid Metabolism. Proc. Nutr. Soc. 2016, 75, 440–450. [Google Scholar] [CrossRef] [PubMed]
  96. Subramanian, P.; Somasundaram, D.B.; Natarajan, A. Cancer Stem Cell Signaling in Neuroblastoma Progression—In Touch with Reality. In Cancer Stem Cells and Signaling Pathways; Elsevier: Amsterdam, The Netherlands, 2024; pp. 77–118. [Google Scholar]
  97. Graham, C.; Gatherar, I.; Haslam, I.; Glanville, M.; Simmons, N.L. Expression and Localization of Monocarboxylate Transporters and Sodium/Proton Exchangers in Bovine Rumen Epithelium. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 292, R997–R1007. [Google Scholar] [CrossRef]
  98. Bellet, M.M.; Stincardini, C.; Costantini, C.; Gargaro, M.; Pieroni, S.; Castelli, M.; Piobbico, D.; Sassone-Corsi, P.; Della-Fazia, M.A.; Romani, L. The Circadian Protein PER1 Modulates the Cellular Response to Anticancer Treatments. Int. J. Mol. Sci. 2021, 22, 2974. [Google Scholar] [CrossRef] [PubMed]
  99. Luo, D.; Peng, Z.; Yang, L.; Qu, M.; Xiong, X.; Xu, L.; Zhao, X.; Pan, K.; Ouyang, K. Niacin Protects against Butyrate-induced Apoptosis in Rumen Epithelial Cells. Oxid. Med. Cell. Longev. 2019, 2019, 2179738. [Google Scholar] [CrossRef]
  100. Boidot, R.; Végran, F.; Meulle, A.; Le Breton, A.; Dessy, C.; Sonveaux, P.; Lizard-Nacol, S.; Feron, O. Regulation of Monocarboxylate Transporter MCT1 Expression by P53 Mediates Inward and Outward Lactate Fluxes in Tumors. Cancer Res. 2012, 72, 939–948. [Google Scholar] [CrossRef]
  101. Peng, X.; He, Z.; Yuan, D.; Liu, Z.; Rong, P. Lactic Acid: The Culprit behind the Immunosuppressive Microenvironment in Hepatocellular Carcinoma. Biochim. Biophys. Acta (BBA)-Rev. Cancer 2024, 1879, 189164. [Google Scholar] [CrossRef]
  102. Costello, H.M.; Johnston, J.G.; Juffre, A.; Crislip, G.R.; Gumz, M.L. Circadian Clocks of the Kidney: Function, Mechanism, and Regulation. Physiol. Rev. 2022, 102, 1669–1701. [Google Scholar] [CrossRef]
  103. Bhoi, J.D.; Goel, M.; Ribelayga, C.P.; Mangel, S.C. Circadian Clock Organization in the Retina: From Clock Components to Rod and Cone Pathways and Visual Function. Prog. Retin. Eye Res. 2023, 94, 101119. [Google Scholar] [CrossRef] [PubMed]
  104. Zhang, H.; Zhou, Z.; Guo, J. The Function, Regulation, and Mechanism of Protein Turnover in Circadian Systems in Neurospora and Other Species. Int. J. Mol. Sci. 2024, 25, 2574. [Google Scholar] [CrossRef]
  105. Micklem, C.N.; Locke, J.C.W. Cut the Noise or Couple up: Coordinating Circadian and Synthetic Clocks. iScience 2021, 24, 103051. [Google Scholar] [CrossRef]
  106. Parnell, A.A.; De Nobrega, A.K.; Lyons, L.C. Translating around the Clock: Multi-Level Regulation of Post-Transcriptional Processes by the Circadian Clock. Cell. Signal. 2021, 80, 109904. [Google Scholar] [CrossRef] [PubMed]
  107. Fortin, B.M.; Mahieu, A.L.; Fellows, R.C.; Pannunzio, N.R.; Masri, S. Circadian Clocks in Health and Disease: Dissecting the Roles of the Biological Pacemaker in Cancer. F1000Res 2023, 12, 116. [Google Scholar] [CrossRef] [PubMed]
  108. Su, K.; Din, Z.U.; Cui, B.; Peng, F.; Zhou, Y.; Wang, C.; Zhang, X.; Lu, J.; Luo, H.; He, B.; et al. A Broken Circadian Clock: The Emerging Neuro-Immune Link Connecting Depression to Cancer. Brain Behav. Immun. Health 2022, 26, 100533. [Google Scholar] [CrossRef]
  109. Reddy, A.B.; O’Neill, J.S. Healthy Clocks, Healthy Body, Healthy Mind. Trends Cell Biol. 2010, 20, 36–44. [Google Scholar] [CrossRef] [PubMed]
  110. Parasram, K.; Karpowicz, P. Time after Time: Circadian Clock Regulation of Intestinal Stem Cells. Cell. Mol. Life Sci. 2020, 77, 1267–1288. [Google Scholar] [CrossRef]
  111. Crislip, G.R.; Johnston, J.G.; Douma, L.G.; Costello, H.M.; Juffre, A.; Boyd, K.; Li, W.; Maugans, C.C.; Gutierrez-Monreal, M.; Esser, K.A.; et al. Circadian Rhythm Effects on the Molecular Regulation of Physiological Systems. In Comprehensive Physiology; Wiley: Hoboken, NJ, USA, 2021; pp. 2769–2798. [Google Scholar] [CrossRef]
  112. Baldwin, R.L.; Jesse, B.W. Technical Note: Isolation and Characterization of Sheep Ruminal Epithelial Cells. J. Anim. Sci. 1991, 69, 3603–3609. [Google Scholar] [CrossRef]
  113. Baldwin, R.L.; Connor, E.E. Rumen Function and Development. Vet. Clin. N. Am. Food Anim. Pract. 2017, 33, 427–439. [Google Scholar] [CrossRef]
  114. Wang, M.; Xu, B.; Wang, H.; Bu, D.; Wang, J.; Loor, J.-J. Effects of Arginine Concentration on the in Vitro Expression of Casein and MTOR Pathway Related Genes in Mammary Epithelial Cells from Dairy Cattle. PLoS ONE 2014, 9, e95985. [Google Scholar] [CrossRef]
Figure 1. Relative expression of PER2 gene in goat rumen epithelial cells. The data of each group were mean ± SEM (n = 3), ** showed significant difference (p ≤ 0.01).
Figure 1. Relative expression of PER2 gene in goat rumen epithelial cells. The data of each group were mean ± SEM (n = 3), ** showed significant difference (p ≤ 0.01).
Ijms 25 12428 g001
Figure 2. Influence of PER2 overexpression on goat rumen epithelial cell proliferation and apoptosis. (A,B) Consequences of PER2 overexpression on goat rumen epithelial cell apoptosis; (C) consequences of PER2 overexpression on goat rumen epithelial cell proliferation. Each group’s data are represented as mean ± SEM (n = 3), ** indicates a significant difference (p ≤ 0.01), * indicates a significant difference (p ≤ 0.05).
Figure 2. Influence of PER2 overexpression on goat rumen epithelial cell proliferation and apoptosis. (A,B) Consequences of PER2 overexpression on goat rumen epithelial cell apoptosis; (C) consequences of PER2 overexpression on goat rumen epithelial cell proliferation. Each group’s data are represented as mean ± SEM (n = 3), ** indicates a significant difference (p ≤ 0.01), * indicates a significant difference (p ≤ 0.05).
Ijms 25 12428 g002
Figure 3. Effect of PER2 overexpression on membrane damage in goat rumen epithelial cells.
Figure 3. Effect of PER2 overexpression on membrane damage in goat rumen epithelial cells.
Ijms 25 12428 g003
Figure 4. Effect of PER2 overexpression on ROS levels in goat rumen epithelial cells.
Figure 4. Effect of PER2 overexpression on ROS levels in goat rumen epithelial cells.
Ijms 25 12428 g004
Figure 5. Effect of PER2 overexpression on antioxidant markers in goat rumen epithelial cells.
Figure 5. Effect of PER2 overexpression on antioxidant markers in goat rumen epithelial cells.
Ijms 25 12428 g005
Figure 6. (a) Construction model of overexpression vector, (b) PER2 CDS amplification results, and (c) pcDNA3.1 double enzyme cut results. M; 5 kb.
Figure 6. (a) Construction model of overexpression vector, (b) PER2 CDS amplification results, and (c) pcDNA3.1 double enzyme cut results. M; 5 kb.
Ijms 25 12428 g006
Table 1. Effect of PER2 overexpression on the expression of genes related to the apoptosis pathway in goat rumen epithelial cells.
Table 1. Effect of PER2 overexpression on the expression of genes related to the apoptosis pathway in goat rumen epithelial cells.
GeneConstituenciesp-Value
Control GroupOverexpression Group
BCL21.00 ± 0.04 a0.83 ± 0.01 b<0.001
CASPASE31.00 ± 0.061.20 ± 0.420.488
CASPASE81.00 ± 0.033.28 ± 1.800.093
CASPASE91.00 ± 0.131.15 ± 0.250.347
p531.00 ± 0.02 b2.73 ± 0.80 a0.043
p211.00 ± 0.02 b2.87 ± 0.79 a0.015
BAX1.00 ± 0.06 b1.68 ± 0.17 a0.003
CASPASE61.00 ± 0.02 b3.28 ± 0.85 a0.010
CASPASE71.00 ± 0.030.76 ± 0.200.109
Note: data with different superscript letters indicate a significant difference (p ≤ 0.05), while data with the same superscript letters indicate no significant difference (p > 0.05).
Table 2. Effect of PER2 overexpression on cell cycle gene expression in goat rumen epithelial cells.
Table 2. Effect of PER2 overexpression on cell cycle gene expression in goat rumen epithelial cells.
GeneConstituenciesp-Value
Control GroupOverexpression Group
CCND11.02 ± 0.06 b2.22 ± 1.00 a0.035
CCNE11.00 ± 0.061.20 ± 0.420.520
CCNB11.01 ± 0.031.17 ± 0.180.062
CDK11.00 ± 0.131.58 ± 0.270.309
CDK21.02 ± 0.060.82 ± 0.320.135
CDK41.02 ± 0.04 a0.74 ± 0.17 b0.041
WEE11.01 ± 0.01 b1.58 ± 0.07 a0.033
p211.00 ± 0.02 b2.87 ± 0.79 a0.015
p161.01 ± 0.01 b1.47 ± 0.05 a0.039
Note: data with different letter superscripts mean a significant difference (p ≤ 0.05), while data with the same letter superscripts mean no significant difference (p > 0.05).
Table 3. Effect of PER2 overexpression on the expression of inflammatory genes in goat rumen epithelial cells.
Table 3. Effect of PER2 overexpression on the expression of inflammatory genes in goat rumen epithelial cells.
GeneConstituenciesp-Value
Control GroupOverexpression Group
TNF-α1.01 ± 0.03 a1.40 ± 0.10 b0.051
TLR-41.04 ± 0.06 a1.26 ± 0.22 b 0.096
IL-61.02 ± 0.04 a1.35 ± 0.03 b0.736
IL-1β1.01 ± 0.01 a1.11 ± 0.13 a0.791
Note: data with different letter superscripts mean a significant difference (p ≤ 0.05), while data with the same letter superscripts mean no significant difference (p > 0.05).
Table 4. Impact of PER2 overexpression on VFA absorption-related gene expression in goat rumen epithelial cells.
Table 4. Impact of PER2 overexpression on VFA absorption-related gene expression in goat rumen epithelial cells.
GeneConstituenciesp-Value
Control GroupOverexpression Group
AE21.03 ± 0.13 a0.79 ± 0.06 b0.003
NHE11.18 ± 0.18 a0.59 ± 0.11 b0.008
NHE31.05 ± 0.311.11 ± 0.200.317
NA/K ATPase1.00 ± 0.211.77 ± 0.480.501
VH+ ATPase1.00 ± 0.17 b2.40 ± 0.27 a0.029
MCT11.00 ± 0.05 a0.74 ± 0.05 b0.021
MCT41.00 ± 0.03 a0.75 ± 0.05 b0.021
PAT11.09 ± 0.02 b1.78 ± 0.23 a0.006
Note: data with different letter superscripts mean a significant difference (p ≤ 0.05), while data with the same letter superscripts mean no significant difference (p > 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ali, R.; Zhen, Y.; Zanna, X.; Lin, J.; Zhang, C.; Ma, J.; Zhong, Y.; Husien, H.M.; Saleh, A.A.; Wang, M. Impact of Circadian Clock PER2 Gene Overexpression on Rumen Epithelial Cell Dynamics and VFA Transport Protein Expression. Int. J. Mol. Sci. 2024, 25, 12428. https://doi.org/10.3390/ijms252212428

AMA Style

Ali R, Zhen Y, Zanna X, Lin J, Zhang C, Ma J, Zhong Y, Husien HM, Saleh AA, Wang M. Impact of Circadian Clock PER2 Gene Overexpression on Rumen Epithelial Cell Dynamics and VFA Transport Protein Expression. International Journal of Molecular Sciences. 2024; 25(22):12428. https://doi.org/10.3390/ijms252212428

Chicago/Turabian Style

Ali, Rahmat, Yongkang Zhen, Xi Zanna, Jiaqi Lin, Chong Zhang, Jianjun Ma, Yuhong Zhong, Hosameldeen Mohamed Husien, Ahmad A. Saleh, and Mengzhi Wang. 2024. "Impact of Circadian Clock PER2 Gene Overexpression on Rumen Epithelial Cell Dynamics and VFA Transport Protein Expression" International Journal of Molecular Sciences 25, no. 22: 12428. https://doi.org/10.3390/ijms252212428

APA Style

Ali, R., Zhen, Y., Zanna, X., Lin, J., Zhang, C., Ma, J., Zhong, Y., Husien, H. M., Saleh, A. A., & Wang, M. (2024). Impact of Circadian Clock PER2 Gene Overexpression on Rumen Epithelial Cell Dynamics and VFA Transport Protein Expression. International Journal of Molecular Sciences, 25(22), 12428. https://doi.org/10.3390/ijms252212428

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop