Immune Response and Transcriptome Analysis of the Head Kidney to Different Concentrations of Aeromonas veronii in Common Carp (Cyprinus carpio)
Abstract
1. Introduction
2. Results
2.1. Comparison of Morbidity and Mortality at Six Infection Concentrations
2.2. Blood Serum LZM and IgM Responses to Different Infection Concentrations
2.3. Identification and Analysis of DEGs Under Low- and High-Concentration Infection
2.4. Functional and Pathway Enrichment Analyses of the Identified DEGs
2.5. WGCNA Revealed the Modules Relevant to Serum LZM and IgM
2.6. Functional and Pathway Enrichment Analysis of the Significant Modules and Screening of Hub Genes
2.7. Validation of RNA-Seq Results
3. Discussion
4. Materials and Methods
4.1. Sampling and Ethics Statement
4.2. Bacterial Strains and Infection
4.3. Detection of Serum LZM and IgM
4.4. RNA Extraction
4.5. RNA-Seq Library Construction and Sequencing
4.6. Quality Control and Annotation
4.7. DEGs and Pathway Enrichment Analysis
4.8. Gene Co-Expression Network Analysis
4.9. Validating the Gene Expression via Real-Time Quantitative PCR (RT–qPCR)
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Koehn, J.D. Carp (Cyprinus carpio) as a powerful invader in Australian waterways. Freshw. Biol. 2004, 49, 882–894. [Google Scholar] [CrossRef]
- Schilling, H.T.; Butler, G.L.; Cheshire, K.J.M.; Gilligan, D.M.; Stocks, J.R.; Thiem, J.D.; Crook, D.A. Contribution of invasive carp (Cyprinus carpio) to fish biomass in rivers of the Murray–Darling Basin, Australia. Biol. Invasions 2024, 26, 2955–2971. [Google Scholar] [CrossRef]
- Fanson, B.G.; Hale, R.; Thiem, J.D.; Lyon, J.P.; Koehn, J.D.; Bennett, A.F.; Stuart, I. Assessing impacts of a notorious invader (common carp Cyprinus carpio) on Australia’s aquatic ecosystems: Coupling abundance-impact relationships with a spatial biomass model. Biol. Conserv. 2024, 290, 110420. [Google Scholar] [CrossRef]
- Nakajima, T.; Hudson, M.J.; Uchiyama, J.; Makibayashi, K.; Zhang, J. Common carp aquaculture in Neolithic China dates back 8000 years. Nat. Ecol. Evol. 2019, 3, 1415–1418. [Google Scholar] [CrossRef]
- Yao, G.; Li, W. Mandarin Fish Culture: Status and Development Prospects: Success Stories and Modern Trends. In Aquaculture in China; Gui, J.F., Tang, Q.S., Li, Z.J., Liu, J.S., Silva, S.S., Eds.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2018; pp. 256–269. [Google Scholar]
- Zivna, D.; Sehonova, P.; Plhalova, L.; Marsalek, P.; Blahova, J.; Prokes, M.; Divisova, L.; Stancova, V.; Dobsikova, R.; Tichy, F.; et al. Effect of salicylic acid on early life stages of common carp (Cyprinus carpio). Environ. Toxicol. Pharmacol. 2015, 40, 319–325. [Google Scholar] [CrossRef]
- Zhou, M.; Qiang, J.; Gan, J.; Xu, X.; Li, X.; Zhang, S.; Xu, B.; Dong, Z. Quercetin attenuates environmental Avermectin-induced ROS accumulation and alleviates gill damage in carp through activation of the Nrf2 pathway. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2023, 274, 109744. [Google Scholar] [CrossRef]
- Parte, A.C. LPSN–list of prokaryotic names with standing in nomenclature. Nucleic Acids Res. 2014, 42, D613–D616. [Google Scholar] [CrossRef]
- Abbott, S.L.; Cheung, W.K.; Janda, J.M. The genus Aeromonas: Biochemical characteristics, atypical reactions, and phenotypic identification schemes. J. Clin. Microbiol. 2003, 41, 2348–2357. [Google Scholar] [CrossRef]
- Rahman, M.; Colque-Navarro, P.; Kühn, I.; Huys, G.; Swings, J.; Möllby, R. Identification and characterization of pathogenic Aeromonas veronii biovar sobria associated with epizootic ulcerative syndrome in fish in Bangladesh. Appl. Environ. Microbiol. 2002, 68, 650–655. [Google Scholar] [CrossRef]
- Vega-Sánchez, V.; Acosta-Dibarrat, J.; Vega-Castillo, F.; Castro-Escarpulli, G.; Aguilera-Arreola, M.G.; Soriano-Vargas, E. Phenotypical characteristics, genetic identification, and antimicrobial sensitivity of Aeromonas species isolated from farmed rainbow trout (Onchorynchus mykiss) in Mexico. Acta Trop. 2014, 130, 76–79. [Google Scholar] [CrossRef]
- Zhu, M.; Wang, X.R.; Li, J.; Li, G.Y.; Liu, Z.P.; Mo, Z.L. Identification and virulence properties of Aeromonas veronii bv. sobria isolates causing an ulcerative syndrome of loach Misgurnus anguillicaudatus. J. Fish Dis. 2016, 39, 777–781. [Google Scholar] [CrossRef] [PubMed]
- Pablos, M.; Huys, G.; Cnockaert, M.; Rodríguez-Calleja, J.M.; Otero, A.; Santos, J.A.; García-López, M.L. Identification and epidemiological relationships of Aeromonas isolates from patients with diarrhea, drinking water and foods. Int. J. Food Microbiol. 2011, 147, 203–210. [Google Scholar] [CrossRef]
- Chen, P.L.; Tsai, P.J.; Chen, C.S.; Lu, Y.C.; Chen, H.M.; Lee, N.Y.; Lee, C.C.; Li, C.W.; Li, M.C.; Wu, C.J.; et al. Aeromonas stool isolates from individuals with or without diarrhea in southern Taiwan: Predominance of Aeromonas Veronii. J. Microbiol. Immunol. Infect. 2015, 48, 618–624. [Google Scholar] [CrossRef]
- Parker, J.L.; Shaw, J.G. Aeromonas spp. clinical microbiology and disease. J. Infect. 2011, 62, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Qin, L.; Zhu, Y.; Qian, Q.; Gao, X.; Jiang, Q.; Wang, J.; Liu, G.; Zhang, X. Characteristics and Complete Genome Analysis of a Pathogenic Aeromonas Veronii SJ4 from Diseased Siniperca Chuatsi. Mar. Biotechnol. 2023, 25, 966–982. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Li, J.; Jiang, Z.; Zhu, X.; Gao, X.; Jiang, Q.; Wang, J.; Wei, W.; Zhang, X. Pathogenicity of Aeromonas veronii causing mass mortalities of Odontobutis potamophila and its induced host immune response. Fish Shellfish Immunol. 2022, 125, 180–189. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Wang, X.; Chen, C.; Gao, J.; Lv, A. Transcriptome profiles in the spleen of African catfish (Clarias gariepinus) challenged with Aeromonas Veronii. Fish Shellfish Immunol. 2019, 86, 858–867. [Google Scholar] [CrossRef]
- Wang, X.; Liu, L.; Zhang, R.; Li, H.; Zhu, H. Involvement of galectin-9 from koi carp (Cyprinus carpio) in the immune response against Aeromonas veronii infection. Fish Shellfish Immunol. 2022, 129, 64–73. [Google Scholar] [CrossRef]
- Tang, H.; Zhang, J.; Zhu, L.; Jiang, X.; Pei, C.; Li, L.; Kong, X. Characteristics of CD4-1 gene and its immune responses against Aeromonas veronii infection by activating NF-κB signaling in Qihe crucian carp Carassius Auratus. Fish Shellfish Immunol. 2024, 145, 109318. [Google Scholar] [CrossRef]
- Tang, H.; Zhu, L.; Zhao, X.; Jiang, X.; Zhang, J.; Pei, C.; Li, L.; Kong, X. Characterization of CD3γ/δ gene and its immune response in Qihe crucian carp Carassius auratus after challenged by Aeromonas veronii and Poly(I:C). Fish Shellfish Immunol. 2023, 133, 108550. [Google Scholar] [CrossRef]
- Han, Z.; Sun, J.; Jiang, B.; Hu, X.; Lv, A.; Chen, L.; Guo, Y. Concurrent infections of Aeromonas veronii and Vibrio cholerae in koi carp (Cyprinus carpio Var. Koi). Aquaculture 2021, 535, 736395. [Google Scholar] [CrossRef]
- Chen, F.; Sun, J.; Han, Z.; Yang, X.; Xian, J.A.; Lv, A.; Hu, X.; Shi, H. Isolation, Identification and Characteristics of Aeromonas veronii From Diseased Crucian Carp (Carassius auratus gibelio). Front. Microbiol. 2019, 10, 2742. [Google Scholar] [CrossRef] [PubMed]
- Hoai, T.D.; Trang, T.T.; Van Tuyen, N.; Giang, N.T.H.; Van Van, K. Aeromonas veronii caused disease and mortality in channel catfish in Vietnam. Aquaculture 2019, 513, 734425. [Google Scholar] [CrossRef]
- Raj, N.S.; Swaminathan, T.R.; Dharmaratnam, A.; Raja, S.A.; Ramraj, D.; Lal, K.K. Aeromonas veronii caused bilateral exophthalmia and mass mortality in cultured Nile tilapia, Oreochromis niloticus (L.) in India. Aquaculture 2019, 512, 734278. [Google Scholar] [CrossRef]
- Zwollo, P.; Cole, S.; Bromage, E.; Kaattari, S. B cell heterogeneity in the teleost kidney: Evidence for a maturation gradient from anterior to posterior kidney. J. Immunol. 2005, 174, 6608–6616. [Google Scholar] [CrossRef]
- Bromage, E.S.; Kaattari, I.M.; Zwollo, P.; Kaattari, S.L. Plasmablast and plasma cell production and distribution in trout immune tissues. J. Immunol. 2004, 173, 7317–7323. [Google Scholar] [CrossRef]
- Qin, G.; Ai, X.; Xu, J.; Yang, Y. Dual RNA-seq of spleens extracted from channel catfish infected with Aeromonas veronii reveals novel insights into host-pathogen interactions. Ecotoxicol. Environ. Saf. 2023, 252, 114609. [Google Scholar] [CrossRef]
- Han, C.; Li, Q.; Chen, Q.; Zhou, G.; Huang, J.; Zhang, Y. Transcriptome analysis of the spleen provides insight into the immunoregulation of Mastacembelus armatus under Aeromonas veronii infection. Fish Shellfish Immunol. 2019, 88, 272–283. [Google Scholar] [CrossRef]
- Choi, K.C.; Lee, Y.S.; Lim, S.; Choi, H.K.; Lee, C.H.; Lee, E.K.; Hong, S.; Kim, I.H.; Kim, S.J.; Park, S.H. Smad6 negatively regulates interleukin 1-receptor-Toll-like receptor signaling through direct interaction with the adaptor Pellino-1. Nat. Immunol. 2006, 7, 1057–1065. [Google Scholar] [CrossRef]
- Burge, S.; Kelly, E.; Lonsdale, D.; Mutowo-Muellenet, P.; McAnulla, C.; Mitchell, A.; Sangrador-Vegas, A.; Yong, S.Y.; Mulder, N.; Hunter, S. Manual GO annotation of predictive protein signatures: The InterPro approach to GO curation. Database 2012, 2012, bar068. [Google Scholar] [CrossRef]
- Yulis, M.; Quiros, M.; Hilgarth, R.; Parkos, C.A.; Nusrat, A. Intracellular Desmoglein-2 cleavage sensitizes epithelial cells to apoptosis in response to pro-inflammatory cytokines. Cell Death Dis. 2018, 9, 389. [Google Scholar] [CrossRef] [PubMed]
- Fu, M.; Blackshear, P.J. RNA-binding proteins in immune regulation: A focus on CCCH zinc finger proteins. Nat. Rev. Immunol. 2017, 17, 130–143. [Google Scholar] [CrossRef] [PubMed]
- Gao, N.; Hibi, Y.; Cueno, M.; Asamitsu, K.; Okamoto, T. A-kinase-interacting protein 1 (AKIP1) acts as a molecular determinant of PKA in NF-κB signaling. J. Biol. Chem. 2010, 285, 28097–28104. [Google Scholar] [CrossRef] [PubMed]
- Veillette, A.; Dong, Z.; Latour, S. Consequence of the SLAM-SAP signaling pathway in innate-like and conventional lymphocytes. Immunity 2007, 27, 698–710. [Google Scholar] [CrossRef]
- Detre, C.; Keszei, M.; Romero, X.; Tsokos, G.C.; Terhorst, C. SLAM family receptors and the SLAM-associated protein (SAP) modulate T cell functions. Semin. Immunopathol. 2010, 32, 157–171. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Li, J.T.; Wang, Q.; Huang Yang, M.D.; Li, Q.S.; Cui, M.S.; Dong, Z.J.; Wang, H.W.; Yu, J.H.; Zhao, Y.J.; Yang, C.R.; et al. Parallel subgenome structure and divergent expression evolution of allo-tetraploid common carp and goldfish. Nat. Genet. 2021, 53, 1493–1503. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
- Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.L.L.; Tosatto, S.C.E.; Paladin, L.; Raj, S.; Richardson, L.J.; et al. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Haynes, W. Benjamini–Hochberg Method. In Encyclopedia of Systems Biology; Dubitzky, W., Wolkenhauer, O., Cho, K.H., Yokota, H., Eds.; Springer: New York, NY, USA, 2013; p. 78. [Google Scholar]
- Bu, D.; Luo, H.; Huo, P.; Wang, Z.; Zhang, S.; He, Z.; Wu, Y.; Zhao, L.; Liu, J.; Guo, J.; et al. KOBAS-i: Intelligent prioritization and exploratory visualization of biological functions for gene enrichment analysis. Nucleic Acids Res. 2021, 49, W317–W325. [Google Scholar] [CrossRef]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant. 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Horvath, S. A general framework for weighted gene co-expression network analysis. Stat. Appl. Genet. Mol. Biol. 2005, 4, 17. [Google Scholar] [CrossRef]
- Yip, A.M.; Horvath, S. Gene network interconnectedness and the generalized topological overlap measure. BMC Bioinform. 2007, 8, 22. [Google Scholar] [CrossRef]
- Li, A.; Horvath, S. Network neighborhood analysis with the multi-node topological overlap measure. Bioinformatics 2007, 23, 222–231. [Google Scholar] [CrossRef]
- Horvath, S.; Dong, J. Geometric interpretation of gene coexpression network analysis. PLoS Comput. Biol. 2008, 4, e1000117. [Google Scholar] [CrossRef]
- Xiao, Z.; Shen, J.; Feng, H.; Liu, H.; Wang, Y.; Huang, R.; Guo, Q. Characterization of two thymosins as immune-related genes in common carp (Cyprinus carpio L.). Dev. Comp. Immunol. 2015, 50, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]








| Group | Concentration (cfu/mL) | Total Number | Morbid Individuals | Dead Individuals | Morbidity | Mortality |
|---|---|---|---|---|---|---|
| NC | 0 | 30 | 0 | 0 | 0.00% | 0.00% |
| T4 | 4.38 × 104 | 30 | 0 | 0 | 0.00% | 0.00% |
| T5 | 4.38 × 105 | 30 | 2 | 0 | 6.67% | 0.00% |
| T6 | 4.38 × 106 | 30 | 2 | 0 | 6.67% | 0.00% |
| T7 | 4.38 × 107 | 30 | 22 | 3 | 73.33% | 10.00% |
| T8 | 4.38 × 108 | 30 | 29 | 9 | 96.67% | 30.00% |
| T9 | 4.38 × 109 | 30 | 29 | 24 | 96.67% | 80.00% |
| Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| β-actin | GATGATGAAATTGCCGCACTG | ACCAACCATGACACCCTGATGT |
| col6a3 | GCCATCCGTGAGTTTATTCGG | CTTCCACCTTTTGCTGTAAGGC |
| smad6b | GACTTTCCCCCAGCGAAGAA | CGCCACGTTACACCAATGAC |
| dsg2.1 | CTTCAAAGACGGCAACAGGC | TCCCCATAGTTCCTTCTGGGA |
| zfp36l2 | GTTTGCTCACGGCTATCACG | GAGCCTCGGCTGAGTGTTAC |
| LOC109069404 | GGGGACCAGAGGGACCTAAT | CCTGGTGGGCCTTTGAAGAA |
| LOC109096249 | TCAAGATGGCTCTCCAGGTTTA | CAAATCTAGCAGGCTCTCCCT |
| LOC109053842 | TGTTTCCCATCGCCTCTCTG | TGTCATTTTTGCGTTGCACAT |
| LOC109053336 | GAGCTGCTGTAAGGAGGTGT | CGGTCTTTAATCCAGCGCAC |
| LOC109048270 | GTGTTGGAGGGAGGTGTTCTC | GTCTAACTGCACTCTGCCTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Ding, N.; Qi, Y.; Jiang, N.; Xing, W.; Li, T.; Ma, Z.; Cao, Y.; Zhang, Y.; Li, J. Immune Response and Transcriptome Analysis of the Head Kidney to Different Concentrations of Aeromonas veronii in Common Carp (Cyprinus carpio). Int. J. Mol. Sci. 2024, 25, 12070. https://doi.org/10.3390/ijms252212070
Zhang J, Ding N, Qi Y, Jiang N, Xing W, Li T, Ma Z, Cao Y, Zhang Y, Li J. Immune Response and Transcriptome Analysis of the Head Kidney to Different Concentrations of Aeromonas veronii in Common Carp (Cyprinus carpio). International Journal of Molecular Sciences. 2024; 25(22):12070. https://doi.org/10.3390/ijms252212070
Chicago/Turabian StyleZhang, Jin, Ning Ding, Yingjie Qi, Na Jiang, Wei Xing, Tieliang Li, Zhihong Ma, Yiming Cao, Yan Zhang, and Jiongtang Li. 2024. "Immune Response and Transcriptome Analysis of the Head Kidney to Different Concentrations of Aeromonas veronii in Common Carp (Cyprinus carpio)" International Journal of Molecular Sciences 25, no. 22: 12070. https://doi.org/10.3390/ijms252212070
APA StyleZhang, J., Ding, N., Qi, Y., Jiang, N., Xing, W., Li, T., Ma, Z., Cao, Y., Zhang, Y., & Li, J. (2024). Immune Response and Transcriptome Analysis of the Head Kidney to Different Concentrations of Aeromonas veronii in Common Carp (Cyprinus carpio). International Journal of Molecular Sciences, 25(22), 12070. https://doi.org/10.3390/ijms252212070

