Role of Luteolin as Potential New Therapeutic Option for Patients with Glioblastoma through Regulation of Sphingolipid Rheostat
Abstract
:1. Introduction
2. Results
2.1. Study Cohort
2.2. Cell Culture Challenging
3. Discussion
4. Materials and Methods
4.1. Study Design
4.2. Tumor Processing and Cell Culture
4.3. Cell Counting
4.4. Pyrosequencing Analyses
4.5. Drug Administration
4.6. MTT Assay
4.7. Immunofluorescence Assay
4.8. Autophagy Assay
4.9. Annexin V Apoptosis and Necrosis Assay
4.10. RNA Extraction and Quantification
4.11. Real-Time Quantitative Reverse Trascription PCR
4.12. Western Blot Analyses
4.13. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hanif, F.; Muzaffar, K.; Perveen, K.; Malhi, S.M.; Simjee, S.U. Glioblastoma Multiforme: A Review of Its Epidemiology and Pathogenesis through Clinical Presentation and Treatment. Asian Pac. J. Cancer Prev. 2017, 18, 3–9. [Google Scholar] [CrossRef] [PubMed]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A Summary. Neuro-Oncology 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Wang, Y.; Zhao, B.; Liu, P.; Liu, L.; Wang, Y.; Ma, W. Optimal Therapies for Recurrent Glioblastoma: A Bayesian Network Meta-Analysis. Front. Oncol. 2021, 11, 641878. [Google Scholar] [CrossRef] [PubMed]
- Luo, C.; Song, K.; Wu, S.; Hameed, N.U.F.; Kudulaiti, N.; Xu, H.; Qin, Z.-Y.; Wu, J.-S. The Prognosis of Glioblastoma: A Large, Multifactorial Study. Br. J. Neurosurg. 2021, 35, 555–561. [Google Scholar] [CrossRef] [PubMed]
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef] [PubMed]
- Brandner, S.; McAleenan, A.; Kelly, C.; Spiga, F.; Cheng, H.Y.; Dawson, S.; Schmidt, L.; Faulkner, C.L.; Wragg, C.; Jefferies, S.; et al. MGMT promoter methylation testing to predict overall survival in people with glioblastoma treated with temozolomide: A comprehensive meta-analysis based on a Cochrane Systematic Review. Neuro-Oncology 2021, 23, 1457–1469. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.-Z.; Wang, Z.-F.; Lan, T.; Huang, W.-H.; Zhao, Y.-H.; Ma, C.; Li, Z.-Q. Carmustine as a Supplementary Therapeutic Option for Glioblastoma: A Systematic Review and Meta-Analysis. Front. Neurol. 2020, 11, 1036. [Google Scholar] [CrossRef]
- Li, Y.; Ali, S.; Clarke, J.; Cha, S. Bevacizumab in Recurrent Glioma: Patterns of Treatment Failure and Implications. Brain Tumor Res. Treat. 2017, 5, 1–9. [Google Scholar] [CrossRef]
- Fabian, D.; Guillermo Prieto Eibl, M.D.P.; Alnahhas, I.; Sebastian, N.; Giglio, P.; Puduvalli, V.; Gonzalez, J.; Palmer, J.D. Treatment of Glioblastoma (GBM) with the Addition of Tumor-Treating Fields (TTF): A Review. Cancers 2019, 11, 174. [Google Scholar] [CrossRef]
- Eramo, A.; Ricci-Vitiani, L.; Zeuner, A.; Pallini, R.; Lotti, F.; Sette, G.; Pilozzi, E.; Larocca, L.M.; Peschle, C.; De Maria, R. Chemotherapy Resistance of Glioblastoma Stem Cells. Cell Death Differ. 2006, 13, 1238–1241. [Google Scholar] [CrossRef]
- Chen, Z.; Kong, S.; Song, F.; Li, L.; Jiang, H. Pharmacokinetic Study of Luteolin, Apigenin, Chrysoeriol and Diosmetin after Oral Administration of Flos Chrysanthemi Extract in Rats. Fitoterapia 2012, 83, 1616–1622. [Google Scholar] [CrossRef] [PubMed]
- Lamy, S.; Moldovan, P.L.; Ben Saad, A.; Annabi, B. Biphasic Effects of Luteolin on Interleukin-1β-Induced Cyclooxygenase-2 Expression in Glioblastoma Cells. Biochim. Biophys. Acta 2015, 1853, 126–135. [Google Scholar] [CrossRef] [PubMed]
- Riboni, L.; Abdel Hadi, L.; Navone, S.E.; Guarnaccia, L.; Campanella, R.; Marfia, G. Sphingosine-1-Phosphate in the Tumor Microenvironment: A Signaling Hub Regulating Cancer Hallmarks. Cells 2020, 9, 337. [Google Scholar] [CrossRef] [PubMed]
- Abdel Hadi, L.; Di Vito, C.; Marfia, G.; Ferraretto, A.; Tringali, C.; Viani, P.; Riboni, L. Sphingosine Kinase 2 and Ceramide Transport as Key Targets of the Natural Flavonoid Luteolin to Induce Apoptosis in Colon Cancer Cells. PLoS ONE 2015, 10, e0143384. [Google Scholar] [CrossRef] [PubMed]
- Çetinkaya, M.; Baran, Y. Therapeutic Potential of Luteolin on Cancer. Vaccines 2023, 11, 554. [Google Scholar] [CrossRef]
- Singh Tuli, H.; Rath, P.; Chauhan, A.; Sak, K.; Aggarwal, D.; Choudhary, R.; Sharma, U.; Vashishth, K.; Sharma, S.; Kumar, M.; et al. Luteolin, a Potent Anticancer Compound: From Chemistry to Cellular Interactions and Synergetic Perspectives. Cancers 2022, 14, 5373. [Google Scholar] [CrossRef] [PubMed]
- Thurston, G. Role of Angiopoietins and Tie Receptor Tyrosine Kinases in Angiogenesis and Lymphangiogenesis. Cell Tissue Res. 2003, 314, 61–68. [Google Scholar] [CrossRef]
- Marfia, G.; Campanella, R.; Navone, S.E.; Di Vito, C.; Riccitelli, E.; Hadi, L.A.; Bornati, A.; de Rezende, G.; Giussani, P.; Tringali, C.; et al. Autocrine/Paracrine Sphingosine-1-Phosphate Fuels Proliferative and Stemness Qualities of Glioblastoma Stem Cells. Glia 2014, 62, 1968–1981. [Google Scholar] [CrossRef]
- Imran, M.; Rauf, A.; Abu-Izneid, T.; Nadeem, M.; Shariati, M.A.; Khan, I.A.; Imran, A.; Orhan, I.E.; Rizwan, M.; Atif, M.; et al. Luteolin, a Flavonoid, as an Anticancer Agent: A Review. Biomed. Pharmacother. 2019, 112, 108612. [Google Scholar] [CrossRef]
- Yun, C.W.; Lee, S.H. The Roles of Autophagy in Cancer. Int. J. Mol. Sci. 2018, 19, 3466. [Google Scholar] [CrossRef]
- Gao, C.-F.; Xie, Q.; Su, Y.-L.; Koeman, J.; Khoo, S.K.; Gustafson, M.; Knudsen, B.S.; Hay, R.; Shinomiya, N.; Vande Woude, G.F. Proliferation and Invasion: Plasticity in Tumor Cells. Proc. Natl. Acad. Sci. USA 2005, 102, 10528–10533. [Google Scholar] [CrossRef] [PubMed]
- Mizoguchi, M.; Betensky, R.A.; Batchelor, T.T.; Bernay, D.C.; Louis, D.N.; Nutt, C.L. Activation of STAT3, MAPK, and AKT in Malignant Astrocytic Gliomas: Correlation with EGFR Status, Tumor Grade, and Survival. J. Neuropathol. Exp. Neurol. 2006, 65, 1181–1188. [Google Scholar] [CrossRef] [PubMed]
- Sunayama, J.; Matsuda, K.-I.; Sato, A.; Tachibana, K.; Suzuki, K.; Narita, Y.; Shibui, S.; Sakurada, K.; Kayama, T.; Tomiyama, A.; et al. Crosstalk between the PI3K/MTOR and MEK/ERK Pathways Involved in the Maintenance of Self-Renewal and Tumorigenicity of Glioblastoma Stem-like Cells. Stem Cells 2010, 28, 1930–1939. [Google Scholar] [CrossRef] [PubMed]
- Daniele, S.; Costa, B.; Zappelli, E.; Da Pozzo, E.; Sestito, S.; Nesi, G.; Campiglia, P.; Marinelli, L.; Novellino, E.; Rapposelli, S.; et al. Combined Inhibition of AKT/MTOR and MDM2 Enhances Glioblastoma Multiforme Cell Apoptosis and Differentiation of Cancer Stem Cells. Sci. Rep. 2015, 5, 9956. [Google Scholar] [CrossRef] [PubMed]
- Gousias, K.; Theocharous, T.; Simon, M. Mechanisms of Cell Cycle Arrest and Apoptosis in Glioblastoma. Biomedicines 2022, 10, 564. [Google Scholar] [CrossRef] [PubMed]
- Hill, J.R.; Kuriyama, N.; Kuriyama, H.; Israel, M.A. Molecular Genetics of Brain Tumors. Arch. Neurol. 1999, 56, 439–441. [Google Scholar] [CrossRef]
- Sutphen, R.; Xu, Y.; Wilbanks, G.D.; Fiorica, J.; Grendys, E.C.J.; LaPolla, J.P.; Arango, H.; Hoffman, M.S.; Martino, M.; Wakeley, K.; et al. Lysophospholipids are potential biomarkers of ovarian cancer. Cancer Epidemiol. Biomark. Prev. 2004, 13, 1185–1191. [Google Scholar] [CrossRef]
- Alberg, A.J.; Armeson, K.; Pierce, J.S.; Bielawski, J.; Bielawska, A.; Visvanathan, K.; Hill, E.G.; Ogretmen, B. Plasma sphingolipids and lung cancer: A population-based, nested case-control study. Cancer Epidemiol. Biomarkers Prev. 2013, 22, 1374–1382. [Google Scholar] [CrossRef]
- Nunes, J.; Naymark, M.; Sauer, L.; Muhammad, A.; Keun, H.; Sturge, J.; Waxman, J.; Pchejetski, D. Circulating sphingosine-1-phosphate and erythrocyte sphingosine kinase-1 activity as novel biomarkers for early prostate cancer detection. Br. J. Cancer 2012, 106, 909–915. [Google Scholar] [CrossRef]
- Nagahashi, M.; Tsuchida, J.; Moro, K.; Hasegawa, M.; Tatsuda, K.; Woelfel, I.A.; Takabe, K.; Wakai, T. High levels of sphingolipids in human breast cancer. J. Surg. Res. 2016, 204, 435–444. [Google Scholar] [CrossRef]
- Pettus, B.J.; Kitatani, K.; Chalfant, C.E.; Taha, T.A.; Kawamori, T.; Bielawski, J.; Obeid, L.M.; Hannun, Y.A. The coordination of prostaglandin E2 production by sphingosine-1-phosphate and ceramide-1-phosphate. Mol. Pharmacol. 2005, 68, 330–335. [Google Scholar] [CrossRef] [PubMed]
- Billich, A.; Bornancin, F.; Mechtcheriakova, D.; Natt, F.; Huesken, D.; Baumruker, T. Basal and induced sphingosine kinase 1 activity in A549 carcinoma cells: Function in cell survival and IL-1beta and TNF-alpha induced production of inflammatory mediators. Cell Signal. 2005, 17, 1203–1217. [Google Scholar] [CrossRef] [PubMed]
- Aoki, H.; Aoki, M.; Katsuta, E.; Ramanathan, R.; Idowu, M.O.; Spiegel, S.; Takabe, K. Host sphingosine kinase 1 worsens pancreatic cancer peritoneal carcinomatosis. J. Surg. Res. 2016, 205, 510–517. [Google Scholar] [CrossRef] [PubMed]
- Lai, W.Q.; Irwan, A.W.; Goh, H.H.; Melendez, A.J.; McInnes, I.B.; Leung, B.P. Distinct roles of sphingosine kinase 1 and 2 in murine collagen-induced arthritis. J. Immunol. 2009, 183, 2097–2103. [Google Scholar] [CrossRef]
- Koybasi, S.; Senkal, C.E.; Sundararaj, K.; Spassieva, S.; Bielawski, J.; Osta, W.; Day, T.A.; Jiang, J.C.; Jazwinski, S.M.; Hannun, Y.A.; et al. Defects in cell growth regulation by C18:0-ceramide and longevity assurance gene 1 in human head and neck squamous cell carcinomas. J. Biol. Chem. 2004, 279, 44311–44319. [Google Scholar] [CrossRef] [PubMed]
- Senkal, C.E.; Ponnusamy, S.; Manevich, Y.; Meyers-Needham, M.; Saddoughi, S.A.; Mukhopadyay, A.; Dent, P.; Bielawski, J.; Ogretmen, B. Alteration of ceramide synthase 6/C16-ceramide induces activating transcription factor 6-mediated endoplasmic reticulum (ER) stress and apoptosis via perturbation of cellular Ca2+ and ER/Golgi membrane network. J. Biol. Chem. 2011, 286, 42446–42458. [Google Scholar] [CrossRef]
- de Araujo Junior, R.F.; Eich, C.; Jorquera, C.; Schomann, T.; Baldazzi, F.; Chan, A.B.; Cruz, L.J. Ceramide and palmitic acid inhibit macrophage-mediated epithelial-mesenchymal transition in colorectal cancer. Mol. Cell Biochem. 2020, 468, 153–168. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Bae, S.H.; Jeong, J.W.; Kim, S.H. Hypoxia-inducible factor (HIF-1)alpha: Its protein stability and biological functions. Exp. Mol. Med. 2004, 36, 1–12. [Google Scholar] [CrossRef]
- Abuhusain, H.J.; Matin, A.; Qiao, Q.; Shen, H.; Kain, N.; Day, B.W.; Stringer, B.W.; Daniels, B.; Laaksonen, M.A.; Teo, C.; et al. A metabolic shift favoring sphingosine 1-phosphate at the expense of ceramide controls glioblastoma angiogenesis. J. Biol. Chem. 2013, 288, 37355–37364. [Google Scholar] [CrossRef]
- Young, N.; Pearl, D.K.; Van Brocklyn, J.R. Sphingosine-1-phosphate regulates glioblastoma cell invasiveness through the urokinase plasminogen activator system and CCN1/Cyr61. Mol. Cancer Res. 2009, 7, 23–32. [Google Scholar] [CrossRef]
- Doan, N.B.; Alhajala, H.; Al-Gizawiy, M.M.; Mueller, W.M.; Rand, S.D.; Connelly, J.M.; Cochran, E.J.; Chitambar, C.R.; Clark, P.; Kuo, J.; et al. Acid ceramidase and its inhibitors: A de novo drug target and a new class of drugs for killing glioblastoma cancer stem cells with high efficiency. Oncotarget 2017, 8, 112662–112674. [Google Scholar] [CrossRef] [PubMed]
- Abdel Hadi, L.; Anelli, V.; Guarnaccia, L.; Navone, S.; Beretta, M.; Moccia, F.; Tringali, C.; Urechie, V.; Campanella, R.; Marfia, G.; et al. A bidirectional crosstalk between glioblastoma and brain endothelial cells potentiates the angiogenic and proliferative signaling of sphingosine-1-phosphate in the glioblastoma microenvironment. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2018, 1863, 1179–1192. [Google Scholar] [CrossRef] [PubMed]
- Brinkmann, V.; Billich, A.; Baumruker, T.; Heining, P.; Schmouder, R.; Francis, G.; Aradhye, S.; Burtin, P. Fingolimod (FTY720): Discovery and development of an oral drug to treat multiple sclerosis. Nat. Rev. Drug Discov. 2010, 9, 883–897. [Google Scholar] [CrossRef] [PubMed]
- Jairajpuri, D.S.; Mohammad, T.; Adhikari, K.; Gupta, P.; Hasan, G.M.; Alajmi, M.F.; Rehman, T.; Hussain, A.; Hassan, I. Identification of Sphingosine Kinase-1 Inhibitors from Bioactive Natural Products Targeting Cancer Therapy. ACS Omega 2020, 5, 14720–14729. [Google Scholar] [CrossRef] [PubMed]
- Pandurangan, A.K.; Kumar, S.A.; Dharmalingam, P.; Ganapasam, S. Luteolin, a bioflavonoid inhibits azoxymethane-induced colon carcinogenesis: Involvement of iNOS and COX-2. Pharmacogn. Mag. 2014, 10 (Suppl. 2), S306–S310. [Google Scholar] [CrossRef] [PubMed]
- Pandurangan, A.K.; Dharmalingam, P.; Sadagopan, S.K.; Ganapasam, S. Luteolin inhibits matrix metalloproteinase 9 and 2 in azoxymethane-induced colon carcinogenesis. Hum. Exp. Toxicol. 2014, 33, 1176–1185. [Google Scholar] [CrossRef] [PubMed]
- Pandurangan, A.K.; Ananda Sadagopan, S.K.; Dharmalingam, P.; Ganapasam, S. Luteolin, a bioflavonoid inhibits Azoxymethane-induced colorectal cancer through activation of Nrf2 signaling. Toxicol. Mech. Methods 2014, 24, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Meng, G.; Chai, K.; Li, X.; Zhu, Y.; Huang, W. Luteolin exerts pro-apoptotic effect and anti-migration effects on A549 lung adenocarcinoma cells through the activation of MEK/ERK signaling pathway. Chem. Biol. Interact. 2016, 257, 26–34. [Google Scholar] [CrossRef]
- Park, S.H.; Park, H.S.; Lee, J.H.; Chi, G.Y.; Kim, G.Y.; Moon, S.K.; Chang, Y.C.; Hyun, J.W.; Kim, W.J.; Choi, Y.H. Induction of endoplasmic reticulum stress-mediated apoptosis and non-canonical autophagy by luteolin in NCI-H460 lung carcinoma cells. Food Chem. Toxicol. 2013, 56, 100–109. [Google Scholar] [CrossRef]
- Lee, H.S.; Park, B.S.; Kang, H.M.; Kim, J.H.; Shin, S.H.; Kim, I.R. Role of Luteolin-Induced Apoptosis and Autophagy in Human Glioblastoma Cell Lines. Medicina 2021, 57, 879. [Google Scholar] [CrossRef]
- Franco, Y.E.M.; de Lima, C.A.; Rosa, M.N.; Silva, V.A.O.; Reis, R.M.; Priolli, D.G.; Carvalho, P.O.; do Nascimento, J.R.; da Rocha, C.Q.; Longato, G.B. Investigation of U-251 cell death triggered by flavonoid luteolin: Towards a better understanding on its anticancer property against glioblastomas. Nat. Prod. Res. 2021, 35, 4807–4813. [Google Scholar] [CrossRef] [PubMed]









| Gene | Forward Primer (5′-3′) | Reverse Primer (3′-5′) | Tm, °C |
|---|---|---|---|
| 18S | ACTTTCGATGGTAGTCGCCGT | CCTTGGATGTGGTAGCCGTTT | 61 |
| RAS | AGCAGGTGGTCATTGATGGG | CCGTTTGATCTGCTCCCTGT | 60 |
| MEK-1 | CTTCGCAGAGCGGCTAGG | AGCTCTAGCTCCTCCAGCTT | 61 |
| ERK-1 | ACTCCAAAGCCCTTGACCTG | CTTCAGCCGCTCCTTAGGTA | 60 |
| PI3K | GCTCCTAGCAGAAGCCTATG | TCTGGTCCTCCCGGTACA | 60 |
| AKT | TCTATGGCGCTGAGATTGTG | CTTAATGTGCCCGTCCTTGT | 58 |
| mTOR | CTTAGAGGACAGCGGGGAAG | TCCAAGCATCTTGCCCTGAG | 62 |
| MDR1 | CCCATCATTGCAATAGCAGG | GTTCAAACTTCTGCTCCTGA | 57 |
| P53 | AGGCCTTGGAACTCAAGGAT | CCCTTTTTGGACTTCAGGTG | 58 |
| P27 | TGGCTTGTCAGGAACTCGAC | CTAGTCTCCAGGGAGGTGCT | 63 |
| CDK1 | AAACTACAGGTCAAGTGGTAGCC | TCCTGCATAAGCACATCCTGA | 61 |
| CCND1 | TGGAGCCCGTGAAAAAGAGC | TCTCCTTCATCTTAGAGGCCAC | 61 |
| CCNB1 | ACTGGGTCGGGAAGTCACTG | CATTCTTAGCCAGGTGCTGC | 61 |
| CASPASE-3 | ATGGTTTGAGCCTGAGCAGA | GGCAGCATCATCCACACATAC | 60 |
| CASPASE-7 | GAGCAGGGGGTTGAGGATTC | GTCTTTTCCGTGCTCCTCCA | 61 |
| CASPASE-9 | GCAGGCTCTGGATCTCGGC | GCTGCTTGCCTGTTAGTTCGC | 63 |
| BAX | AGCAAACTGGTGCTCAAGG | TCTTGGATCCAGCCCAAC | 57 |
| BCL-2 | AGTACCTGAACCGGCACCT | GCCGTACAGTTCCACAAAGG | 60 |
| SPHK1 | TGCAGTTGGTCAGGAGGTCT | GCTCTGGTGGTCATGTCTGG | 66 |
| SPHK2 | CCCCGGTTGCTTCTATTGGT | ATCCCACTCACTCAGGCTCA | 66 |
| SPNS2 | GCAGCTACGTCTTCTCCTCC | AGGTGATGGCCCCAAAGATG | 67 |
| S1PR1 | GGGAGCAATAACTTCCGCCT | AAGCAGAGTGAAGACCGTGG | 66 |
| S1PR3 | CAACCACAACAACTCGGAGC | GCCAACACGATGAACCACTG | 64 |
| SGPL1 | AAGCATATCGGGATCTGGCC | TAGCTCTTCTCATTGCCCGC | 65 |
| CERS1 | CCCTTCTTCCATGACCCACC | CTCAGTGGCTTCTCGGCTTT | 61 |
| Antibody | Supplier | Catalog Number | Concentration |
|---|---|---|---|
| β-actin | Sigma, St. Louis, MO, USA) | A5441 | 1:500 |
| RAS | SantaCruz Biotechnology (Dallas, TX, USA) | Sc-35 | 1:500 |
| MEK | SantaCruz Biotechnology (Dallas, TX, USA) | Sc-81504 | 1:500 |
| ERK-1 | (ThermoFisher Scientific, Waltham, MA, USA) | 44-654G | 1:1000 |
| ERK-2 | (ThermoFisher Scientific, Waltham, MA, USA) | 44-654G | 1:1000 |
| CASP3 | Cell Signaling Technology (Danvers, MA, USA) | 9662 | 1:1000 |
| CASP7 | SantaCruz Biotechnology (Dallas, TX, USA) | Sc-56063 | 1:500 |
| SPHK1 | Cell Signaling Technology (Danvers, MA, USA) | 3297 | 1:1000 |
| SPHK2 | Abcam (Cambridge, UK) | Ab37977 | 1:1000 |
| SGPL1 | Abnova (Taipei, Taiwan) | H00008879-W01P | 1:500 |
| MGMT | SantaCruz Biotechnology (Dallas, TX, USA) | Sc-166528 | 1:500 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Navone, S.E.; Guarnaccia, L.; Rizzaro, M.D.; Begani, L.; Barilla, E.; Alotta, G.; Garzia, E.; Caroli, M.; Ampollini, A.; Violetti, A.; et al. Role of Luteolin as Potential New Therapeutic Option for Patients with Glioblastoma through Regulation of Sphingolipid Rheostat. Int. J. Mol. Sci. 2024, 25, 130. https://doi.org/10.3390/ijms25010130
Navone SE, Guarnaccia L, Rizzaro MD, Begani L, Barilla E, Alotta G, Garzia E, Caroli M, Ampollini A, Violetti A, et al. Role of Luteolin as Potential New Therapeutic Option for Patients with Glioblastoma through Regulation of Sphingolipid Rheostat. International Journal of Molecular Sciences. 2024; 25(1):130. https://doi.org/10.3390/ijms25010130
Chicago/Turabian StyleNavone, Stefania Elena, Laura Guarnaccia, Massimiliano D. Rizzaro, Laura Begani, Emanuela Barilla, Giovanni Alotta, Emanuele Garzia, Manuela Caroli, Antonella Ampollini, Aniello Violetti, and et al. 2024. "Role of Luteolin as Potential New Therapeutic Option for Patients with Glioblastoma through Regulation of Sphingolipid Rheostat" International Journal of Molecular Sciences 25, no. 1: 130. https://doi.org/10.3390/ijms25010130
APA StyleNavone, S. E., Guarnaccia, L., Rizzaro, M. D., Begani, L., Barilla, E., Alotta, G., Garzia, E., Caroli, M., Ampollini, A., Violetti, A., Gervasi, N., Campanella, R., Riboni, L., Locatelli, M., & Marfia, G. (2024). Role of Luteolin as Potential New Therapeutic Option for Patients with Glioblastoma through Regulation of Sphingolipid Rheostat. International Journal of Molecular Sciences, 25(1), 130. https://doi.org/10.3390/ijms25010130

