Tri-Lineage Differentiation Potential of Osteosarcoma Cell Lines and Human Bone Marrow Stromal Cells from Different Anatomical Locations
Abstract
1. Introduction
2. Results
2.1. Osteogenic Differentiation of HBMSCs
2.2. Adipogenic Differentiation of HBMSCs
2.3. Chondrogenic Differentiation of HBMSCs
2.4. Osteogenic Differentiation of Osteosarcoma Cell Lines
2.5. Adipogenic Differentiation of Osteosarcoma Cells
2.6. Chondrogenic Differentiation of Osteosarcoma Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Osteogenic Differentiation
4.3. Adipogenic Differentiation
4.4. Chondrogenic Differentiation
4.5. qPCR Analysis
4.6. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huang, X.; Zhao, J.; Bai, J.; Shen, H.; Zhang, B.; Deng, L.; Sun, C.; Liu, Y.; Zhang, J.; Zheng, J. Risk and clinicopathological features of osteosarcoma metastasis to the lung: A population-based study. J. Bone Oncol. 2019, 16, 100230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wittig, J.C.; Bickels, J.; Priebat, D.; Jelinek, J.; Kellar-Graney, K.; Shmookler, B.; Malawer, M.M. Osteosarcoma: A multidisciplinary approach to diagnosis and treatment. Am. Fam. Physician 2002, 65, 1123–1132. [Google Scholar] [PubMed]
- Dubousset, J.; Missenard, G.; Kalifa, C. Management of osteogenic sarcoma in children and adolescents. Clin. Orthop. Relat. Res. 1991, 270, 52–59. [Google Scholar] [CrossRef] [Scilit]
- Campanacci, L.; Manfrini, M.; Colangeli, M.; Ali, N.; Mercuri, M. Long-term results in children with massive bone osteoarticular allografts of the knee for high-grade osteosarcoma. J. Pediatr. Orthop. 2010, 30, 919–927. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Yang, R.; Roth, M.; Piperdi, S.; Zhang, W.; Dorfman, H.; Rao, P.; Park, A.; Tripathi, S.; Freeman, C.; et al. Genetically transforming human osteoblasts to sarcoma: Development of an osteosarcoma model. Genes Cancer 2017, 8, 484–494. [Google Scholar] [CrossRef] [Scilit]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage potential of adult human mesenchymal stem cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [Scilit]
- Blebea, J.S.; Houseni, M.; Torigian, D.A.; Fan, C.; Mavi, A.; Zhuge, Y.; Iwanaga, T.; Mishra, S.; Udupa, J.; Zhuang, J.; et al. Structural and Functional Imaging of Normal Bone Marrow and Evaluation of Its Age-Related Changes. Semin. Nucl. Med. 2007, 37, 185–194. [Google Scholar] [CrossRef] [Scilit]
- Hwang, S.; Panicek, D.M. Magnetic resonance imaging of bone marrow in oncology, Part 1. Skelet. Radiol. 2007, 36, 913–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mercier, F.E.; Ragu, C.; Scadden, D.T. The bone marrow at the crossroads of blood and immunity. Nat. Rev. Immunol. 2012, 12, 49–60. [Google Scholar] [CrossRef] [Scilit]
- Nombela-Arrieta, C.; Isringhausen, S. The Role of the Bone Marrow Stromal Compartment in the Hematopoietic Response to Microbial Infections. Front. Immunol. 2017, 7, 689. [Google Scholar] [CrossRef] [Scilit]
- Cuminetti, V.; Arranz, L. Bone Marrow Adipocytes: The Enigmatic Components of the Hematopoietic Stem Cell Niche. J. Clin. Med. 2019, 8, 707. [Google Scholar] [CrossRef] [Scilit]
- Miggitsch, C.; Meryk, A.; Naismith, E.; Pangrazzi, L.; Ejaz, A.; Jenewein, B.; Wagner, S.; Nagele, F.; Fenkart, G.; Trieb, K.; et al. Human bone marrow adipocytes display distinct immune regulatory properties. EBioMedicine 2019, 46, 387–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liney, G.P.; Bernard, C.P.; Manton, D.J.; Turnbull, L.W.; Langton, C.M. Age, gender, and skeletal variation in bone marrow composition: A preliminary study at 3.0 Tesla. J. Magn. Reson. Imaging JMRI 2007, 26, 787–793. [Google Scholar] [CrossRef] [Scilit]
- Małkiewicz, A.; Dziedzic, M. Bone marrow reconversion-imaging of physiological changes in bone marrow. Pol. J. Radiol. 2012, 77, 45–50. [Google Scholar] [CrossRef] [Scilit]
- Wurtz, T.; Ellerström, C.; Lundmark, C.; Christersson, C. Collagen mRNA expression during tissue development: The temporospacial order coordinates bone morphogenesis with collagen fiber formation. Matrix Biol. J. Int. Soc. Matrix Biol. 1998, 17, 349–360. [Google Scholar] [CrossRef] [Scilit]
- Benya, P.D.; Shaffer, J.D. Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels. Cell 1982, 30, 215–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lian, C.; Wang, X.; Qiu, X.; Wu, Z.; Gao, B.; Liu, L.; Liang, G.; Zhou, H.; Yang, X.; Peng, Y.; et al. Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1−SMAD1 interaction. Bone Res. 2019, 7, 8. [Google Scholar] [CrossRef] [Scilit]
- Kiani, C.; Chen, L.; Wu, Y.J.; Yee, A.J.; Yang, B.B. Structure and function of aggrecan. Cell Res. 2002, 12, 19–32. [Google Scholar] [CrossRef] [Scilit]
- Jesus-Garcia, R.; Seixas, M.T.; Costa, S.R.; Petrilli, A.S.; Laredo Filho, J. Epiphyseal plate involvement in osteosarcoma. Clin. Orthop. Relat. Res. 2000, 373, 32–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, L.; Mendoza, A.; Zhu, J.; Briggs, J.W.; Halsey, C.; Hong, E.S.; Burkett, S.S.; Morrow, J.; Lizardo, M.M.; Osborne, T.; et al. Characterization of the metastatic phenotype of a panel of established osteosarcoma cells. Oncotarget 2015, 6, 29469–29481. [Google Scholar] [CrossRef] [Scilit]
- Mohseny, A.B.; Machado, I.; Cai, Y.; Schaefer, K.L.; Serra, M.; Hogendoorn, P.C.; Llombart-Bosch, A.; Cleton-Jansen, A.M. Functional characterization of osteosarcoma cell lines provides representative models to study the human disease. Lab. Investig. 2011, 91, 1195–1205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, M.-Z.; Jin, W.-L. The updated landscape of tumor microenvironment and drug repurposing. Signal Transduct. Target. Ther. 2020, 5, 166. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Liu, Y.; Sun, Y.; Wang, B.; Xiong, Y.; Lin, W.; Wei, Q.; Wang, H.; He, W.; Wang, B.; et al. Tissue source determines the differentiation potentials of mesenchymal stem cells: A comparative study of human mesenchymal stem cells from bone marrow and adipose tissue. Stem Cell Res. Ther. 2017, 8, 275. [Google Scholar] [CrossRef] [Scilit]
- Cimino, M.; Gonçalves, R.M.; Bauman, E.; Barroso-Vilares, M.; Logarinho, E.; Barrias, C.C.; Martins, M.C.L. Optimization of the use of a pharmaceutical grade xeno-free medium for in vitro expansion of human mesenchymal stem/stromal cells. J. Tissue Eng. Regen. Med. 2018, 12, e1785–e1795. [Google Scholar] [CrossRef] [Scilit]
- Colnot, C. Skeletal cell fate decisions within periosteum and bone marrow during bone regeneration. J. Bone Miner. Res. Off. J. Am. Soc. Bone Miner. Res. 2009, 24, 274–282. [Google Scholar] [CrossRef] [Scilit]
- Gu, R.; Sun, Y. Does serum alkaline phosphatase level really indicate the prognosis in patients with osteosarcoma? A meta-analysis. J. Cancer Res. Ther. 2018, 14, 468–472. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.H.; Shin, K.-H.; Moon, S.-H.; Jang, J.; Kim, H.S.; Suh, J.-S.; Yang, W.-I. Reassessment of alkaline phosphatase as serum tumor marker with high specificity in osteosarcoma. Cancer Med. 2017, 6, 1311–1322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jukkola, A.; Risteli, L.; Melkko, J.; Risteli, J. Procollagen synthesis and extracellular matrix deposition in MG-63 osteosarcoma cells. J. Bone Miner. Res. Off. J. Am. Soc. Bone Miner. Res. 1993, 8, 651–657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Hasan, M.; Martin, P.E.; Shu, X.; Patterson, S.; Bartholomew, C. Type III Collagen is Required for Adipogenesis and Actin Stress Fibre Formation in 3T3-L1 Preadipocytes. Biomolecules 2021, 11, 156. [Google Scholar] [CrossRef] [Scilit]
- Burdall, S.E.; Hanby, A.M.; Lansdown, M.R.J.; Speirs, V. Breast cancer cell lines: Friend or foe? Breast Cancer Res. 2003, 5, 89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cidonio, G.; Glinka, M.; Kim, Y.H.; Kanczler, J.M.; Lanham, S.A.; Ahlfeld, T.; Lode, A.; Dawson, J.I.; Gelinsky, M.; Oreffo, R.O.C. Nanoclay-based 3D printed scaffolds promote vascular ingrowth ex vivo and generate bone mineral tissue in vitro and in vivo. Biofabrication 2020, 12, 035010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tare, R.S.; Mitchell, P.D.; Kanczler, J.; Oreffo, R.O. Isolation, differentiation, and characterisation of skeletal stem cells from human bone marrow in vitro and in vivo. Methods Mol. Biol. 2012, 816, 83–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Black, C.; Kanczler, J.M.; de Andrés, M.C.; White, L.J.; Savi, F.M.; Bas, O.; Saifzadeh, S.; Henkel, J.; Zannettino, A.; Gronthos, S.; et al. Characterisation and evaluation of the regenerative capacity of Stro-4+ enriched bone marrow mesenchymal stromal cells using bovine extracellular matrix hydrogel and a novel biocompatible melt electro-written medical-grade polycaprolactone scaffold. Biomaterials 2020, 247, 119998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serguienko, A.; Wang, M.Y.; Myklebost, O. Real-Time Vital Mineralization Detection and Quantification during In Vitro Osteoblast Differentiation. Biol. Proced. Online 2018, 20, 14. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Name | Media | Supplements |
|---|---|---|
| Basal | αMEM (Lonza) | 10% FCS (Sigma, St. Louis, MO, USA), 1% P/S (100 U/mL Penicillin +100 µg/mL Streptomycin, Life technologies) |
| Osteogenic I | αMEM | 10% FCS + 1% P/S +100 µM ascorbate acid 2-phosphate (Sigma) + 10 nM dexamethasone (Sigma) |
| Osteogenic II | αMEM | 10% FCS +1% P/S + 50 µM Ascorbic acid 2-phosphate + 10 nM Vitamin D3 (Sigma) |
| Mineralization | αMEM | 10% FCS +1% P/S + 50 µM Ascorbic acid 2-phosphate + 10 nM Dexamethasone + 2 mM Beta-Glycerol phosphate (Sigma) |
| Adipogenic | αMEM | +10 % FCS +1% P/S +100 mM Dexamethasone +0.5 mM IBMX (Sigma) +3 µg/mL ITS solution (Sigma) + 1 µM Rosiglitazone (Sigma) |
| Chondrogenic | αMEM | +1% P/S +100 µL ascorbic acid 2-phosphate +10 ng/mL TGF-β3 (Peprotech) +10 µg/mL ITS solution +10 nM Dexamethasone |
| Gene | Protein | Forward 5′-3′ | Reverse 5′3′ |
|---|---|---|---|
| ACTB | βActin | GGCATCCTCACCCTGAAGTA | AGGTGTGGTGCCAGATTTTC |
| PPARγ | PPARγ | GGGCGATCTTGACAGGAAAG | GGGGGGTGATGTGTTTGAACTTG |
| FABP4 | FABP4 | TAGATGGGGGTGTCCTGGTA | CGCATTCCACCACCAGTT |
| ALPL | ALP | GGAACTCCTGACCCTTGACC | TCCTGTTCAGCTCGTACTGC |
| COL1A1 | Collagen type I α1 | GAGTGCTGTCCCGTCTGC | TTTCTTGGTCGGTGGGTG |
| SOX9 | SOX9 | CCCTTCAACCTCCCACACTA | TGGTGGTCGGTGTAGTCGTA |
| COL2A1 | Collagen, type II α1 | CCTGGTCCCCCTGGTCTTGG | CATCAAATCCTCCAGCCATC |
| ACAN | Aggrecan | GACGGCTTCCACCAGTGT | GTCTCCATAGCAGCCTTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smith, H.L.; Gray, J.C.; Beers, S.A.; Kanczler, J.M. Tri-Lineage Differentiation Potential of Osteosarcoma Cell Lines and Human Bone Marrow Stromal Cells from Different Anatomical Locations. Int. J. Mol. Sci. 2023, 24, 3667. https://doi.org/10.3390/ijms24043667
Smith HL, Gray JC, Beers SA, Kanczler JM. Tri-Lineage Differentiation Potential of Osteosarcoma Cell Lines and Human Bone Marrow Stromal Cells from Different Anatomical Locations. International Journal of Molecular Sciences. 2023; 24(4):3667. https://doi.org/10.3390/ijms24043667
Chicago/Turabian StyleSmith, Hannah L., Juliet C. Gray, Stephen A. Beers, and Janos M. Kanczler. 2023. "Tri-Lineage Differentiation Potential of Osteosarcoma Cell Lines and Human Bone Marrow Stromal Cells from Different Anatomical Locations" International Journal of Molecular Sciences 24, no. 4: 3667. https://doi.org/10.3390/ijms24043667
APA StyleSmith, H. L., Gray, J. C., Beers, S. A., & Kanczler, J. M. (2023). Tri-Lineage Differentiation Potential of Osteosarcoma Cell Lines and Human Bone Marrow Stromal Cells from Different Anatomical Locations. International Journal of Molecular Sciences, 24(4), 3667. https://doi.org/10.3390/ijms24043667

