Modulation of Unfolded Protein Response Restores Survival and Function of β-Cells Exposed to the Endocrine Disruptor Bisphenol A
Abstract
1. Introduction
2. Results
2.1. BPA Exposure Induces Death of Both MIN6 Cells and Isolated Mouse Pancreatic Islets
2.2. The Morphology of the Early Secretory Pathway in MIN6 Cells Is Affected by BPA
2.3. BPA Leads to Impaired Insulin Synthesis
2.4. BPA-Exposed Cells Display A Pro-Apoptotic UPR
2.5. TUDCA Improves Viability of BPA-Compromised MIN6 Cells
2.6. Co-Treatment of MIN6 Cells with BPA and TUDCA Regulates Perk Downstream Effectors
2.7. Ultrastructure and Function of BPA-Exposed MIN6 Cells Are Improved by Addition of TUDCA
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Antibodies
4.3. Cell Culture, Drug Treatment and Transfection
4.4. Mice
4.5. Islet Isolation and Culture
4.6. Apoptosis and Death Assays
4.7. Microscopy and Image Analysis
4.8. Reverse Transcription and qPCR
4.9. Western Blot
4.10. Transmission Electron Microscopy Evaluation
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bao, W.; Tobias, D.K.; Bowers, K.; Chavarro, J.; Vaag, A.; Grunnet, L.G.; Strom, M.; Mills, J.; Liu, A.; Kiely, M.; et al. Physical activity and sedentary behaviors associated with risk of progression from gestational diabetes mellitus to type 2 diabetes mellitus: A prospective cohort study. JAMA Intern. Med. 2014, 174, 1047–1055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knowler, W.C.; Barrett-Connor, E.; Fowler, S.E.; Hamman, R.F.; Lachin, J.M.; Walker, E.A.; Nathan, D.M.; Diabetes Prevention Program Research, G. Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin. N. Engl. J. Med. 2002, 346, 393–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Pan, X.F.; Chen, J.; Xia, L.; Cao, A.; Zhang, Y.; Wang, J.; Li, H.; Yang, K.; Guo, K.; et al. Combined lifestyle factors and risk of incident type 2 diabetes and prognosis among individuals with type 2 diabetes: A systematic review and meta-analysis of prospective cohort studies. Diabetologia 2020, 63, 21–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Liu, H.; Wu, J.; Yuan, L.; Wang, Y.; Du, X.; Wang, R.; Marwa, P.W.; Petlulu, P.; Chen, X.; et al. The adverse health effects of bisphenol A and related toxicity mechanisms. Environ. Res. 2019, 176, 108575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, S.Y.; Chang, W.J.; Sojinu, S.O.; Ni, H.G. Bisphenol A in supermarket receipts and its exposure to human in Shenzhen, China. Chemosphere 2013, 92, 1190–1194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geens, T.; Goeyens, L.; Covaci, A. Are potential sources for human exposure to bisphenol-A overlooked? Int. J. Hyg. Environ. Health 2011, 214, 339–347. [Google Scholar] [CrossRef] [Scilit]
- Manzoor, M.F.; Tariq, T.; Fatima, B.; Sahar, A.; Tariq, F.; Munir, S.; Khan, S.; Nawaz Ranjha, M.M.A.; Sameen, A.; Zeng, X.A.; et al. An insight into bisphenol A, food exposure and its adverse effects on health: A review. Front. Nutr. 2022, 9, 1047827. [Google Scholar] [CrossRef] [Scilit]
- Inoue, H.; Kemanai, S.; Sano, C.; Kato, S.; Yokota, H.; Iwano, H. Bisphenol A glucuronide/sulfate diconjugate in perfused liver of rats. J. Vet. Med. Sci. 2016, 78, 733–737. [Google Scholar] [CrossRef] [Scilit]
- Corbel, T.; Perdu, E.; Gayrard, V.; Puel, S.; Lacroix, M.Z.; Viguie, C.; Toutain, P.L.; Zalko, D.; Picard-Hagen, N. Conjugation and deconjugation reactions within the fetoplacental compartment in a sheep model: A key factor determining bisphenol A fetal exposure. Drug Metab. Dispos. 2015, 43, 467–476. [Google Scholar] [CrossRef] [Scilit]
- Gauderat, G.; Picard-Hagen, N.; Toutain, P.L.; Corbel, T.; Viguie, C.; Puel, S.; Lacroix, M.Z.; Mindeguia, P.; Bousquet-Melou, A.; Gayrard, V. Bisphenol A glucuronide deconjugation is a determining factor of fetal exposure to bisphenol A. Environ. Int. 2016, 86, 52–59. [Google Scholar] [CrossRef] [Scilit]
- MacKay, H.; Abizaid, A. A plurality of molecular targets: The receptor ecosystem for bisphenol-A (BPA). Horm. Behav. 2018, 101, 59–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calafat, A.M.; Ye, X.; Wong, L.Y.; Reidy, J.A.; Needham, L.L. Exposure of the U.S. population to bisphenol A and 4-tertiary-octylphenol: 2003–2004. Environ. Health Perspect. 2008, 116, 39–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biemann, R.; Bluher, M.; Isermann, B. Exposure to endocrine-disrupting compounds such as phthalates and bisphenol A is associated with an increased risk for obesity. Best Pract. Res. Clin. Endocrinol. Metab. 2021, 35, 101546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haverinen, E.; Fernandez, M.F.; Mustieles, V.; Tolonen, H. Metabolic Syndrome and Endocrine Disrupting Chemicals: An Overview of Exposure and Health Effects. Int. J. Environ. Res. Public Health 2021, 18, 13047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haq, M.E.U.; Akash, M.S.H.; Rehman, K.; Mahmood, M.H. Chronic exposure of bisphenol A impairs carbohydrate and lipid metabolism by altering corresponding enzymatic and metabolic pathways. Environ. Toxicol. Pharmacol. 2020, 78, 103387. [Google Scholar] [CrossRef] [Scilit]
- Akash, M.S.H.; Sabir, S.; Rehman, K. Bisphenol A-induced metabolic disorders: From exposure to mechanism of action. Environ. Toxicol. Pharmacol. 2020, 77, 103373. [Google Scholar] [CrossRef] [Scilit]
- Huang, M.; Liu, S.; Fu, L.; Jiang, X.; Yang, M. Bisphenol A and its analogues bisphenol S, bisphenol F and bisphenol AF induce oxidative stress and biomacromolecular damage in human granulosa KGN cells. Chemosphere 2020, 253, 126707. [Google Scholar] [CrossRef] [Scilit]
- Lin, M.; Hua, R.; Ma, J.; Zhou, Y.; Li, P.; Xu, X.; Yu, Z.; Quan, S. Bisphenol A promotes autophagy in ovarian granulosa cells by inducing AMPK/mTOR/ULK1 signalling pathway. Environ. Int. 2021, 147, 106298. [Google Scholar] [CrossRef] [Scilit]
- Karagoz, G.E.; Acosta-Alvear, D.; Walter, P. The Unfolded Protein Response: Detecting and Responding to Fluctuations in the Protein-Folding Capacity of the Endoplasmic Reticulum. Cold Spring Harb. Perspect. Biol. 2019, 11, a033886. [Google Scholar] [CrossRef] [Scilit]
- Lenghel, A.; Gheorghita, A.M.; Vacaru, A.M.; Vacaru, A.M. What Is the Sweetest UPR Flavor for the beta-cell? That Is the Question. Front. Endocrinol. 2020, 11, 614123. [Google Scholar] [CrossRef] [Scilit]
- Preissler, S.; Ron, D. Early Events in the Endoplasmic Reticulum Unfolded Protein Response. Cold Spring Harb. Perspect. Biol. 2019, 11, a033894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boland, B.B.; Rhodes, C.J.; Grimsby, J.S. The dynamic plasticity of insulin production in beta-cells. Mol. Metab. 2017, 6, 958–973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roep, B.O. There Is Something About Insulin Granules. Diabetes 2020, 69, 2575–2577. [Google Scholar] [CrossRef] [Scilit]
- Omar-Hmeadi, M.; Idevall-Hagren, O. Insulin granule biogenesis and exocytosis. Cell. Mol. Life Sci. 2021, 78, 1957–1970. [Google Scholar] [CrossRef] [Scilit]
- Ravelli, R.B.; Kalicharan, R.D.; Avramut, M.C.; Sjollema, K.A.; Pronk, J.W.; Dijk, F.; Koster, A.J.; Visser, J.T.; Faas, F.G.; Giepmans, B.N. Destruction of tissue, cells and organelles in type 1 diabetic rats presented at macromolecular resolution. Sci. Rep. 2013, 3, 1804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J.; Cui, J.; He, Q.; Chen, Z.; Arvan, P.; Liu, M. Proinsulin misfolding and endoplasmic reticulum stress during the development and progression of diabetes. Mol. Asp. Med. 2015, 42, 105–118. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.H.; Lee, J. Endoplasmic Reticulum (ER) Stress and Its Role in Pancreatic beta-Cell Dysfunction and Senescence in Type 2 Diabetes. Int. J. Mol. Sci. 2022, 23, 4843. [Google Scholar] [CrossRef] [Scilit]
- Asahi, J.; Kamo, H.; Baba, R.; Doi, Y.; Yamashita, A.; Murakami, D.; Hanada, A.; Hirano, T. Bisphenol A induces endoplasmic reticulum stress-associated apoptosis in mouse non-parenchymal hepatocytes. Life Sci. 2010, 87, 431–438. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, R.; Amaral, C.; Correia-da-Silva, G.; Almada, M.; Borges, M.; Cunha, S.C.; Fernandes, J.O.; Teixeira, N. Bisphenols A, F, S and AF trigger apoptosis and/or endoplasmic reticulum stress in human endometrial stromal cells. Toxicology 2022, 478, 153282. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Huang, G.; Nagy, T.; Guo, T.L. Bisphenol A alteration of type 1 diabetes in non-obese diabetic (NOD) female mice is dependent on window of exposure. Arch. Toxicol. 2019, 93, 1083–1093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Huang, G.; Guo, T.L. Bisphenol S Modulates Type 1 Diabetes Development in Non-Obese Diabetic (NOD) Mice with Diet- and Sex-Related Effects. Toxics 2019, 7, 35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bodin, J.; Kocbach Bolling, A.; Wendt, A.; Eliasson, L.; Becher, R.; Kuper, F.; Lovik, M.; Nygaard, U.C. Exposure to bisphenol A, but not phthalates, increases spontaneous diabetes type 1 development in NOD mice. Toxicol. Rep. 2015, 2, 99–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tokarz, V.L.; MacDonald, P.E.; Klip, A. The cell biology of systemic insulin function. J. Cell Biol. 2018, 217, 2273–2289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nam, D.; Mantell, J.; Bull, D.; Verkade, P.; Achim, A. A novel framework for segmentation of secretory granules in electron micrographs. Med. Image Anal. 2014, 18, 411–424. [Google Scholar] [CrossRef] [Scilit]
- Zangerolamo, L.; Vettorazzi, J.F.; Solon, C.; Bronczek, G.A.; Engel, D.F.; Kurauti, M.A.; Soares, G.M.; Rodrigues, K.S.; Velloso, L.A.; Boschero, A.C.; et al. The bile acid TUDCA improves glucose metabolism in streptozotocin-induced Alzheimer’s disease mice model. Mol. Cell. Endocrinol. 2021, 521, 111116. [Google Scholar] [CrossRef] [Scilit]
- Bronczek, G.A.; Vettorazzi, J.F.; Soares, G.M.; Kurauti, M.A.; Santos, C.; Bonfim, M.F.; Carneiro, E.M.; Balbo, S.L.; Boschero, A.C.; Costa Junior, J.M. The Bile Acid TUDCA Improves Beta-Cell Mass and Reduces Insulin Degradation in Mice With Early-Stage of Type-1 Diabetes. Front. Physiol. 2019, 10, 561. [Google Scholar] [CrossRef] [Scilit]
- Weldingh, N.M.; Jorgensen-Kaur, L.; Becher, R.; Holme, J.A.; Bodin, J.; Nygaard, U.C.; Bolling, A.K. Bisphenol A Is More Potent than Phthalate Metabolites in Reducing Pancreatic beta-Cell Function. Biomed. Res. Int. 2017, 2017, 4614379. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Pinna, J.; Marroqui, L.; Hmadcha, A.; Lopez-Beas, J.; Soriano, S.; Villar-Pazos, S.; Alonso-Magdalena, P.; Dos Santos, R.S.; Quesada, I.; Martin, F.; et al. Oestrogen receptor beta mediates the actions of bisphenol-A on ion channel expression in mouse pancreatic beta cells. Diabetologia 2019, 62, 1667–1680. [Google Scholar] [CrossRef] [Scilit]
- Boronat-Belda, T.; Ferrero, H.; Al-Abdulla, R.; Quesada, I.; Gustafsson, J.A.; Nadal, A.; Alonso-Magdalena, P. Bisphenol-A exposure during pregnancy alters pancreatic beta-cell division and mass in male mice offspring: A role for ERbeta. Food Chem. Toxicol. 2020, 145, 111681. [Google Scholar] [CrossRef] [Scilit]
- Prins, G.S.; Patisaul, H.B.; Belcher, S.M.; Vandenberg, L.N. CLARITY-BPA academic laboratory studies identify consistent low-dose Bisphenol A effects on multiple organ systems. Basic Clin. Pharmacol. Toxicol. 2019, 125, 14–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meslin, M.; Beausoleil, C.; Zeman, F.A.; Antignac, J.P.; Kolossa-Gehring, M.; Rousselle, C.; Apel, P. Human Biomonitoring Guidance Values (HBM-GVs) for Bisphenol S and Assessment of the Risk Due to the Exposure to Bisphenols A. and S, in Europe. Toxics 2022, 10, 228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corrales, J.; Kristofco, L.A.; Steele, W.B.; Yates, B.S.; Breed, C.S.; Williams, E.S.; Brooks, B.W. Global Assessment of Bisphenol A in the Environment: Review and Analysis of Its Occurrence and Bioaccumulation. Dose Response 2015, 13, 1559325815598308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ho, K.L.; Yuen, K.K.; Yau, M.S.; Murphy, M.B.; Wan, Y.; Fong, B.M.; Tam, S.; Giesy, J.P.; Leung, K.S.; Lam, M.H. Glucuronide and Sulfate Conjugates of Bisphenol A: Chemical Synthesis and Correlation Between Their Urinary Levels and Plasma Bisphenol A Content in Voluntary Human Donors. Arch. Environ. Contam. Toxicol. 2017, 73, 410–420. [Google Scholar] [CrossRef] [Scilit]
- Ginsberg, G.; Rice, D.C. Does rapid metabolism ensure negligible risk from bisphenol A? Environ. Health Perspect. 2009, 117, 1639–1643. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; He, J.; Xu, T.; Han, H.; Zhu, Z.; Meng, L.; Pang, Q.; Fan, R. Bisphenol A(BPA), BPS and BPB-induced oxidative stress and apoptosis mediated by mitochondria in human neuroblastoma cell lines. Ecotoxicol. Environ. Saf. 2021, 207, 111299. [Google Scholar] [CrossRef] [Scilit]
- Al-Abdulla, R.; Ferrero, H.; Soriano, S.; Boronat-Belda, T.; Alonso-Magdalena, P. Screening of Relevant Metabolism-Disrupting Chemicals on Pancreatic beta-Cells: Evaluation of Murine and Human In Vitro Models. Int. J. Mol. Sci. 2022, 23, 4182. [Google Scholar] [CrossRef] [Scilit]
- Song, L.; Xia, W.; Zhou, Z.; Li, Y.; Lin, Y.; Wei, J.; Wei, Z.; Xu, B.; Shen, J.; Li, W.; et al. Low-level phenolic estrogen pollutants impair islet morphology and beta-cell function in isolated rat islets. J. Endocrinol. 2012, 215, 303–311. [Google Scholar] [CrossRef] [Scilit]
- Lagarde, F.; Beausoleil, C.; Belcher, S.M.; Belzunces, L.P.; Emond, C.; Guerbet, M.; Rousselle, C. Non-monotonic dose-response relationships and endocrine disruptors: A qualitative method of assessment. Environ. Health 2015, 14, 13. [Google Scholar] [CrossRef] [Scilit]
- Makaji, E.; Raha, S.; Wade, M.G.; Holloway, A.C. Effect of environmental contaminants on Beta cell function. Int. J. Toxicol. 2011, 30, 410–418. [Google Scholar] [CrossRef] [Scilit]
- Quan, W.; Lim, Y.M.; Lee, M.S. Role of autophagy in diabetes and endoplasmic reticulum stress of pancreatic beta-cells. Exp. Mol. Med. 2012, 44, 81–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, S.; Jung, H.S. Endoplasmic Reticulum Stress and Dysregulated Autophagy in Human Pancreatic Beta Cells. Diabetes Metab. J. 2022, 46, 533–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Priego, A.R.; Parra, E.G.; Mas, S.; Morgado-Pascual, J.L.; Ruiz-Ortega, M.; Rayego-Mateos, S. Bisphenol A Modulates Autophagy and Exacerbates Chronic Kidney Damage in Mice. Int. J. Mol. Sci. 2021, 22, 7189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Yao, Y.; Tao, W.; Liu, F.; Yang, S.; Zhao, A.; Song, D.; Li, X. Coenzyme Q10 ameliorates BPA-induced apoptosis by regulating autophagy-related lysosomal pathways. Ecotoxicol. Environ. Saf. 2021, 221, 112450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orci, L.; Ravazzola, M.; Amherdt, M.; Madsen, O.; Perrelet, A.; Vassalli, J.D.; Anderson, R.G. Conversion of proinsulin to insulin occurs coordinately with acidification of maturing secretory vesicles. J. Cell Biol. 1986, 103, 2273–2281. [Google Scholar] [CrossRef] [Scilit]
- Puyal, J.; Petremand, J.; Dubuis, G.; Rummel, C.; Widmann, C. HDLs protect the MIN6 insulinoma cell line against tunicamycin-induced apoptosis without inhibiting ER stress and without restoring ER functionality. Mol. Cell. Endocrinol. 2013, 381, 291–301. [Google Scholar] [CrossRef] [Scilit]
- Oliviero, F.; Marmugi, A.; Viguie, C.; Gayrard, V.; Picard-Hagen, N.; Mselli-Lakhal, L. Are BPA Substitutes as Obesogenic as BPA? Int. J. Mol. Sci. 2022, 23, 4238. [Google Scholar] [CrossRef] [Scilit]
- Cohen, I.C.; Cohenour, E.R.; Harnett, K.G.; Schuh, S.M. BPA, BPAF and TMBPF Alter Adipogenesis and Fat Accumulation in Human Mesenchymal Stem Cells, with Implications for Obesity. Int. J. Mol. Sci. 2021, 22, 5363. [Google Scholar] [CrossRef] [Scilit]
- Yong, J.; Johnson, J.D.; Arvan, P.; Han, J.; Kaufman, R.J. Therapeutic opportunities for pancreatic beta-cell ER stress in diabetes mellitus. Nat. Rev. Endocrinol. 2021, 17, 455–467. [Google Scholar] [CrossRef] [Scilit]
- Abdulkarim, B.; Nicolino, M.; Igoillo-Esteve, M.; Daures, M.; Romero, S.; Philippi, A.; Senee, V.; Lopes, M.; Cunha, D.A.; Harding, H.P.; et al. A Missense Mutation in PPP1R15B Causes a Syndrome Including Diabetes, Short Stature, and Microcephaly. Diabetes 2015, 64, 3951–3962. [Google Scholar] [CrossRef] [Scilit]
- Rozpedek, W.; Pytel, D.; Mucha, B.; Leszczynska, H.; Diehl, J.A.; Majsterek, I. The Role of the PERK/eIF2alpha/ATF4/CHOP Signaling Pathway in Tumor Progression During Endoplasmic Reticulum Stress. Curr. Mol. Med. 2016, 16, 533–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, G.; Lee, A.S. Role of the unfolded protein response, GRP78 and GRP94 in organ homeostasis. J. Cell. Physiol. 2015, 230, 1413–1420. [Google Scholar] [CrossRef] [Scilit]
- Engin, F.; Yermalovich, A.; Nguyen, T.; Hummasti, S.; Fu, W.; Eizirik, D.L.; Mathis, D.; Hotamisligil, G.S. Restoration of the unfolded protein response in pancreatic beta cells protects mice against type 1 diabetes. Sci. Transl. Med. 2013, 5, 211ra156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Ye, R.; Barron, E.; Baumeister, P.; Mao, C.; Luo, S.; Fu, Y.; Luo, B.; Dubeau, L.; Hinton, D.R.; et al. Essential role of the unfolded protein response regulator GRP78/BiP in protection from neuronal apoptosis. Cell Death Differ. 2010, 17, 488–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nougarede, A.; Tesniere, C.; Ylanko, J.; Rimokh, R.; Gillet, G.; Andrews, D.W. Improved IRE1 and PERK Pathway Sensors for Multiplex Endoplasmic Reticulum Stress Assay Reveal Stress Response to Nuclear Dyes Used for Image Segmentation. Assay Drug Dev. Technol. 2018, 16, 350–360. [Google Scholar] [CrossRef] [Scilit]
- Bankhead, P.; Loughrey, M.B.; Fernandez, J.A.; Dombrowski, Y.; McArt, D.G.; Dunne, P.D.; McQuaid, S.; Gray, R.T.; Murray, L.J.; Coleman, H.G.; et al. QuPath: Open source software for digital pathology image analysis. Sci. Rep. 2017, 7, 16878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thorel, F.; Nepote, V.; Avril, I.; Kohno, K.; Desgraz, R.; Chera, S.; Herrera, P.L. Conversion of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss. Nature 2010, 464, 1149–1154. [Google Scholar] [CrossRef] [Scilit]
- Rutkowski, D.T.; Arnold, S.M.; Miller, C.N.; Wu, J.; Li, J.; Gunnison, K.M.; Mori, K.; Sadighi Akha, A.A.; Raden, D.; Kaufman, R.J. Adaptation to ER stress is mediated by differential stabilities of pro-survival and pro-apoptotic mRNAs and proteins. PLoS Biol. 2006, 4, e374. [Google Scholar] [CrossRef] [Scilit]
- Bek, M.F.; Bayer, M.; Muller, B.; Greiber, S.; Lang, D.; Schwab, A.; August, C.; Springer, E.; Rohrbach, R.; Huber, T.B.; et al. Expression and function of C/EBP homology protein (GADD153) in podocytes. Am. J. Pathol. 2006, 168, 20–32. [Google Scholar] [CrossRef] [Scilit]
- Gerhardt, E.; Graber, S.; Szego, E.M.; Moisoi, N.; Martins, L.M.; Outeiro, T.F.; Kermer, P. Idebenone and resveratrol extend lifespan and improve motor function of HtrA2 knockout mice. PLoS ONE 2011, 6, e28855. [Google Scholar] [CrossRef] [Scilit]
- Duan, P.; Hu, C.; Butler, H.J.; Quan, C.; Chen, W.; Huang, W.; Tang, S.; Zhou, W.; Yuan, M.; Shi, Y.; et al. 4-Nonylphenol induces disruption of spermatogenesis associated with oxidative stress-related apoptosis by targeting p53-Bcl-2/Bax-Fas/FasL signaling. Environ. Toxicol. 2017, 32, 739–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, B.M.; McManus, S.A.; Hughes, W.E.; Schmitz-Peiffer, C. Flavin-Containing Monooxygenase 3 Reduces Endoplasmic Reticulum Stress in Lipid-Treated Hepatocytes. Mol. Endocrinol. 2016, 30, 417–428. [Google Scholar] [CrossRef] [Scilit]
- Girard, C.A.; Wunderlich, F.T.; Shimomura, K.; Collins, S.; Kaizik, S.; Proks, P.; Abdulkader, F.; Clark, A.; Ball, V.; Zubcevic, L.; et al. Expression of an activating mutation in the gene encoding the KATP channel subunit Kir6.2 in mouse pancreatic beta cells recapitulates neonatal diabetes. J. Clin. Investig. 2009, 119, 80–90. [Google Scholar] [CrossRef] [Scilit]
- Guo, W.; Gong, Y.; Fu, Z.; Fu, J.; Sun, Y.; Ju, X.; Chang, Y.; Wang, W.; Zhu, X.; Gao, B.; et al. The effect of cholesteryl ester transfer protein on pancreatic beta cell dysfunction in mice. Nutr. Metab. 2016, 13, 21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, Y.; Wang, Z.V.; Tao, C.; Gao, N.; Holland, W.L.; Ferdous, A.; Repa, J.J.; Liang, G.; Ye, J.; Lehrman, M.A.; et al. The Xbp1s/GalE axis links ER stress to postprandial hepatic metabolism. J. Clin. Investig. 2013, 123, 455–468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, J.; Song, B.; Kim, J.; Kodali, V.K.; Pottekat, A.; Wang, M.; Hassler, J.; Wang, S.; Pennathur, S.; Back, S.H.; et al. Antioxidants Complement the Requirement for Protein Chaperone Function to Maintain beta-Cell Function and Glucose Homeostasis. Diabetes 2015, 64, 2892–2904. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit]








| Gene | Forward Primer 5′-3′ | Reverse Primer 3′-5′ | Reference |
|---|---|---|---|
| Gapdh | TCCATGACAACTTTGGCATTG | CAGTCTTCTGGGTGGCAGTGA | [67] |
| Atf4 | ATGGCCGGCTATGGATGAT | CGAAGTCAAACTCTTTCAGATCCATT | [68] |
| Ddit3 | CACATCCCAAAGCCCTCG | CTCAGTCCCCTCCTCAGC | [69] |
| Bcl-2 | TCGCAGAGATGTCCAGTCAG | ATGCCGGTTCAGGTACTCAG | [70] |
| Bax | CAGGATGCGTCCACCAAGAA | CGTGTCCACGTCAGCAATCA | [71] |
| Bad | GCCCTAGGCTTGAGGAAGTC | CAAACTCTGGGATCTGGAACA | [71] |
| Bip | AGGACAAGAAGGAGGATGTGGG | ACCGAAGGGTCATTCCAAGTG | [72] |
| uXbp1 | CAGCACTCAGACTATGTGCA | GTCCATGGGAAGATGTTCTGG | [73] |
| sXbp1 | CTGAGTCCGCAGCAGGTGCAG | GTCCATGGGAAGATGTTCTGG | [73] |
| Atf6 | GACTCACCCATCCGAGTTGTG | CTCCCAGTCTTCATCTGGTCC | [74] |
| Edem1 | CTGCAATGAAGGAGAAGGAG | TAGAAGGCGTGTAGGCAGAT | [75] |
| Dnajc3 | TCCTGGTGGACCTGCAGTACG | CTGCGAGTAATTTCTTCCCC | [76] |
| Ins2 | TCAACATGGCCCTGTGGAT | AAAGGTGCTGCTTGACAAAAGC | [67] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Daian, L.M.; Tanko, G.; Vacaru, A.M.; Ghila, L.; Chera, S.; Vacaru, A.-M. Modulation of Unfolded Protein Response Restores Survival and Function of β-Cells Exposed to the Endocrine Disruptor Bisphenol A. Int. J. Mol. Sci. 2023, 24, 2023. https://doi.org/10.3390/ijms24032023
Daian LM, Tanko G, Vacaru AM, Ghila L, Chera S, Vacaru A-M. Modulation of Unfolded Protein Response Restores Survival and Function of β-Cells Exposed to the Endocrine Disruptor Bisphenol A. International Journal of Molecular Sciences. 2023; 24(3):2023. https://doi.org/10.3390/ijms24032023
Chicago/Turabian StyleDaian, Laura Maria, Gabriela Tanko, Andrei Mircea Vacaru, Luiza Ghila, Simona Chera, and Ana-Maria Vacaru. 2023. "Modulation of Unfolded Protein Response Restores Survival and Function of β-Cells Exposed to the Endocrine Disruptor Bisphenol A" International Journal of Molecular Sciences 24, no. 3: 2023. https://doi.org/10.3390/ijms24032023
APA StyleDaian, L. M., Tanko, G., Vacaru, A. M., Ghila, L., Chera, S., & Vacaru, A.-M. (2023). Modulation of Unfolded Protein Response Restores Survival and Function of β-Cells Exposed to the Endocrine Disruptor Bisphenol A. International Journal of Molecular Sciences, 24(3), 2023. https://doi.org/10.3390/ijms24032023

